introduction to epigenetics: chromatin modifications, dna methylation and the cpg island landscape...
TRANSCRIPT
![Page 1: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/1.jpg)
Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2)
Héctor Corrada BravoCMSC858P Spring 2012
(many slides courtesy of Rafael Irizarry)
![Page 2: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/2.jpg)
How do we measure DNA methylation?
![Page 3: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/3.jpg)
Microarray Data
![Page 4: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/4.jpg)
One question…
• Where do we measure?
• At least 7 arrays are needed to measure entire genome
• CpG are depleated
• Remaining CpGs cluster
![Page 5: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/5.jpg)
CpG Islands
![Page 6: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/6.jpg)
But variation seen outside
![Page 7: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/7.jpg)
McRBC
No Methylation
Cuts at AmCG or GmCG Input
![Page 8: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/8.jpg)
McRBC
Methylation
![Page 9: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/9.jpg)
McRBC after GEL
Methylation
![Page 10: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/10.jpg)
McRBC after GEL
Methylation
![Page 11: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/11.jpg)
Now unmethylated
No Methylation
![Page 12: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/12.jpg)
McRBC after Gel
No Methylation
![Page 13: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/13.jpg)
![Page 14: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/14.jpg)
![Page 15: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/15.jpg)
![Page 16: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/16.jpg)
Gene Expression Normalization does not work well here
![Page 17: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/17.jpg)
We use control probes
![Page 18: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/18.jpg)
There are also waves
![Page 19: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/19.jpg)
Smoothing
![Page 20: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/20.jpg)
McRBC on tiling two channel array
We smooth
![Page 21: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/21.jpg)
Proportion of neighboring CpG also methylated/not methylated
![Page 22: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/22.jpg)
True signal (simulated)
![Page 23: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/23.jpg)
Observed data
![Page 24: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/24.jpg)
Observed data and true signal
![Page 25: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/25.jpg)
What is methylated (above 50%)?
![Page 26: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/26.jpg)
Naïve approach
![Page 27: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/27.jpg)
Many false positives (FP)
![Page 28: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/28.jpg)
Smooth
![Page 29: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/29.jpg)
No FP, but one false negative
![Page 30: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/30.jpg)
Smooth less? No FN, lots of FP
![Page 31: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/31.jpg)
We prefer this!
![Page 32: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/32.jpg)
CHARMDMR for three tissues (five replicates)
Irizarry et al, Nature Genetics 2009
![Page 33: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/33.jpg)
Some findings
[Irizarry et al., 2009, Nat. Genetics]
![Page 34: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/34.jpg)
Tissue easily distinguished
![Page 35: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/35.jpg)
Cancer DMR
![Page 36: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/36.jpg)
Many Regions like thisNote: hypo and hyper methylation
![Page 37: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/37.jpg)
Both hyper and hypo methylated
![Page 38: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/38.jpg)
Cancer and Tissue DMRs coincide
![Page 39: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/39.jpg)
DMR enriched in Shores
![Page 40: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/40.jpg)
Still affects expression
T-DMRs
![Page 41: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/41.jpg)
Still affects expression
C-DMRs
![Page 42: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/42.jpg)
USING SEQUENCING (BS-SEQ)
![Page 43: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/43.jpg)
TTCGATTACGA
AAGCTAATGCT
CH3
CH3
TTCGATTACGA
AAGCTAATGCT
CH3
CH3
Liver Brain
![Page 44: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/44.jpg)
TTCGATTACGA
AAGCTAATGCT
CH3
CH3
TTCGATTACGA
AAGCTAATGCT
CH3
CH3
TTCGATTACGA
AAGCTAATGCT
CH3
CH3
TTCGATTACGA
AAGCTAATGCT
CH3
TTCGATTACGA
AAGCTAATGCT
CH3
CH3TTCGATTACGA
AAGCTAATGCT
CH3
CH3
TTCGATTACGA
AAGCTAATGCT
CH3
CH3
85% Methylationchr3:44,031,616-44,031,626
![Page 45: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/45.jpg)
Bisulfite Treatment
![Page 46: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/46.jpg)
Bisulfite Treatment
GGGGAGCAGCATGGAGGAGCCTTCGGCTGACT
GGGGAGCAGTATGGAGGAGTTTTCGGTTGATT
![Page 47: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/47.jpg)
BS-seq
GTCGTAGTATTTGTCT GTCGTAGTATTTGTNN TGTCGTAGTATCTGTC TATGTCGTAGTATTTG TATATCGTAGTATTTT TATATCGTAGTATTTG NATATCGTAGTATNTG TTTTATATCGCAGTAT ATATTTTATGTCGTA ATATTTTATCTCGTA ATATTTTATGTCGTA GA-TATTTTATGTCGTGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTAC
GTTCAATATT
Coverage: 13Methylation Evidence: 13Methylation Percentage: 100%
![Page 48: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/48.jpg)
BS-seq
GTCGTAGTATTTGTCT GTCGTAGTATTTGTNN TGTCGTAGTATCTGTC TATGTCGTAGTATTTG TATATTGTAGTATTTT TATATCGTAGTATTTG NATATTGTAGTATNTG TTTTATATTGCAGTAT ATATTTTATGTCGTA ATATTTTATCTTGTA ATATTTTATGTCGTA GA-TATTTTATGTCGTGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTAC
GTTCAATATT
Coverage: 13Methylation Evidence: 9Methylation Percentage: 69%
![Page 49: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/49.jpg)
BS-seq
GTCGTAGTATTTGTCT GTCGTAGTATTTGTNN TGTTGTAGTATCTGTC TATGTTGTAGTATTTG TATATTGTAGTATTTT TATATTGTAGTATTTG NATATTGTAGTATNTG TTTTATATTGCAGTAT ATATTTTATGTCGTA ATATTTTATCTTGTA ATATTTTATGTTGTA GA-TATTTTATGTCGTGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTAC
GTTCAATATT
Coverage: 13Methylation Evidence: 4Methylation Percentage: 31%
![Page 50: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/50.jpg)
BS-seq
• Alignment is much trickier:– Naïve strategy: do nothing, hope not many CpG in a
single read– Smarter strategy: “bisulfite convert” reference: turn all
Cs to Ts• Also needs to be done on reverse complement reference and
reads
– Smartest strategy: be unbiased and try all combinations of methylated/un-methylated CpGs in each read
• Computationally expensive (see Hansen et al, 2011, for a strategy)
![Page 51: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/51.jpg)
BS-seq
• There are similarities to SNP calling (we’ll see this in a couple of weeks)
• EXCEPT: we want to measure percentages– Use a binomial model to estimate p, percentage of
methylation– Allow for sequencing errors, coverage differences,
etc.
![Page 52: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/52.jpg)
Measuring DNA Methylation
• Estimating percentages• Use “local-likelihood”
method– Based on loess
(Plot courtesy of Kasper Hansen)
![Page 53: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/53.jpg)
BS-seq
Lister et al. 2009, Nature
![Page 54: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/54.jpg)
Gene Expression Regulation: DNA methylation in promoter regions
Lister et al. 2009, Nature
![Page 55: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/55.jpg)
DNA methylation patterns within genomic regions
Lister et al. 2009
![Page 56: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/56.jpg)
Putting it together
![Page 57: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/57.jpg)
![Page 58: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/58.jpg)
What were we after?
• The epigenetic progenitor origin of human cancer• [Feinberg, et al., Nature Reviews Genetics, 2006]• Stochastic epigenetic variation as driving force of
disease• [Feinberg & Irizarry, PNAS, 2009]• Phenotypic variation, perhaps epigenetically mediated,
increases disease susceptibility• Increased epigenetic and gene expression variability of
specific genes/regions is a defining characteristic of cancer
![Page 59: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/59.jpg)
What did we do?
• Custom Illumina methylation microarray• Confirmed increased epigenetic variability in
specific regions across five cancer types
![Page 60: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/60.jpg)
What did we do?
• Custom Illumina methylation microarray• Confirmed increased epigenetic variability in
specific regions across five cancer types
![Page 61: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/61.jpg)
What did we do?• Custom Illumina methylation microarray
• Confirmed increased epigenetic variability in specific regions across five cancer
types
• Confirmed same sites are involved in tissue differentiation
![Page 62: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/62.jpg)
What did we do?• Custom Illumina methylation microarray
• Whole genome sequencing of bisulfite treated DNA– Found large blocks of hypo-methylation (sometimes Mbps long) in
colon cancer
![Page 63: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/63.jpg)
What did we do?• Custom Illumina methylation microarray
• Whole genome sequencing of bisulfite treated DNA– Found large blocks of hypo-methylation (sometimes Mbps long) in
colon cancer– These regions coincide with hyper-variable regions across cancer types
![Page 64: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/64.jpg)
What did we do?• Custom Illumina methylation microarray• Whole genome sequencing of bisulfite treated DNA• Gene Expression Analysis
![Page 65: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/65.jpg)
Gene Expression Data
![Page 66: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/66.jpg)
Gene Expression Data
When using multiple microarray experiments, proper normalization is key[McCall, et al., Biostatistics 2010]
![Page 67: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/67.jpg)
Normalization is key
• fRMA: a single-chip normalization procedure• GNUSE: a single-chip quality metric• Barcode: a single-chip common-scale
measurement
![Page 68: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/68.jpg)
What did we do?• Custom Illumina methylation microarray• Whole genome sequencing of bisulfite treated DNA• Gene Expression Analysis
– Genes with hyper-variable gene expression in colon cancer are enriched in hypo-methylation blocks
[Corrada Bravo, et al., under review]
![Page 69: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/69.jpg)
What are we doing next?• Custom Illumina methylation microarray• Whole genome sequencing of bisulfite treated DNA• Gene Expression Analysis
– Genes with hyper-variable gene expression in colon cancer are enriched in hypo-methylation blocks
![Page 70: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/70.jpg)
Bigger gene expression study
• 7,741 HGU133plus2 samples• 598 normal tissue samples, 4,886 tumor
samples• 176 different tissue types• 175 different GEO studies
![Page 71: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/71.jpg)
Bigger gene expression study
[Corrada Bravo, et al., under review]
![Page 72: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/72.jpg)
What are we doing next?• Custom Illumina methylation microarray• Whole genome sequencing of bisulfite treated DNA• Gene Expression Analysis
– Genes with hyper-variable gene expression in colon cancer are enriched in hypo-methylation blocks
– Tissue-specific genes have hyper-variable gene expression across cancer types
[Corrada Bravo, et al., under review]
![Page 73: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/73.jpg)
[Corrada Bravo, et al., under review]
![Page 74: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many](https://reader036.vdocument.in/reader036/viewer/2022062421/56649d6f5503460f94a505be/html5/thumbnails/74.jpg)
[Corrada Bravo, et al., under review]