introduction to genomics using yeasts as model organisms · just working by similarity, no...
TRANSCRIPT
![Page 1: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/1.jpg)
Introduction to Genomics using yeasts
as model organisms
![Page 2: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/2.jpg)
Strasbourg team
Bleykasten Claudine
Despons Laurence
de Montigny Jacky
Friedrich Anne
Ivanov Samy (Sofia)
Jung Paul
Kugler Valérie
Leh Véronique
Potier Serge
Schacherer Joseph
Souciet Jean-Luc
Straub Marie-laure
Spehner Catherine
Uzunov Zlatyo (Sofia)
![Page 3: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/3.jpg)
Génolevures teams
J.-L. Souciet, Université de Strasbourg,CNRS (Génolevures Project Coordinator))
28 rue Goethe, F-67000 Strasbourg, France
B. Dujon, Institut Pasteur, CNRS, Université Pierre et Marie Curie
UFR927, 25 rue du Docteur Roux, F-75724 Paris, France
C. Gaillardin AgroParisTech, INRA, CNRS F-78850 Thiverval-Grignon, France
D.Sherman, LaBRI, CNRS 351 cours de la Libération, 33405 Talence Cedex, France
associated with the sequencing center
J. Weissenbach, Génoscope (CEA) 2 rue Gaston Crémieux, BP 191, F-91057 Evry Cedex, France
![Page 4: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/4.jpg)
http://www.genolevures.org/
![Page 5: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/5.jpg)
Preliminary introduction
![Page 6: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/6.jpg)
Darwin
2009 bicentenary celebration
it is over
2010 is the year of Biodiversity
however we have to remember the
Darwin’s contribution in the scope
of the studies on genome evolution
![Page 7: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/7.jpg)
Darwinian evolution in the
light of genomics
Koonin E.V. Nucleic Acids Research 2009, 37, 1011-1034
![Page 8: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/8.jpg)
In brief from Darwin :
1/ Undirected, random variation is the main driving force for evolution
2/ Evolution proceeds by fixation of the rare beneficial variations and
elimination of deleterous variations = natural selection
3/ Beneficials changes that are fixed by natural selectionn are
infinitesimally small = evolution is accumulation of these tiny modifications
4/ the evolutionary process remains processes rmained the same throught
history life
5/ evolution could be represented by a single tree TOL (Tree Of Life)
(later, later after Darwin = LUCA (Last Universal Common Ancestor))
![Page 9: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/9.jpg)
Conclusion from Genome Analysis (Genomics sensu lato) Studies April 2009.
1/ Infinitesimal changes = point mutations
2/ All kinds of duplications (WGD, segmental, single gene) or deletions
(single gene, chromsomal part, gene erasion or relics) gene lost
3/ Horizontal Gene Transfer (HGT) fot single or blocks
4/ various types of genomes rearrangements
5/ Diverse types of selfish genetic elements
6/ No unidirectionnal fates for genes (ex : gain and lost several times)
7/ The relative contributions of different evolutionarily forces greatly vary
from lineage to lineage
8/ Each genome is a PALIMPSET = a diverse collection of genes with
different evolutionary fates
![Page 10: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/10.jpg)
A palimpsest is a manuscript page from a scroll or book that has been
scraped off and used again. The word "palimpsest" comes through
Latin from Greek παλιν + ψαω = ("again" + "I scrape"), and meant
"scraped (clean and used) again." Romans wrote on wax-coated
tablets that could be smoothed and reused, and a passing use of the
rather bookish term "palimpsest" by Cicero seems to refer to this
practice.
The term has come to be used in similar context in a variety of
disciplines, notably architectural archaeology….
and Genomics!
Definition extracted from Wikipedia
![Page 11: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/11.jpg)
Genomics
![Page 12: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/12.jpg)
Basic questions:
How genes arise ?
How genes disappear ?
![Page 13: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/13.jpg)
How genes arise ?
First, duplication.
How, mechanisms ?
- segmental duplications
- tandem duplications
- duplications by retroposition
- duplication by aneuploidy
- duplication by polyploidy
- etc….
![Page 14: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/14.jpg)
How genes disappear ?
- deletions
- accumulation of numerous point mutations
- translocations
![Page 15: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/15.jpg)
The Génolevures strategy
-phylogeneticaly related species
- species or clades choice (Kurtzman)
- criteria ?
- complete sequencing ? telomere to telomere
(link to new emerging sequencing technologies)
- just working by similarity, no functional analysis
- annotation by experts?
(proteome of high quality and most of the detectable ncARN are identified)
- database devoted to comparative genomic analysis
(http://www.genolevures.org/)
![Page 16: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/16.jpg)
Fungal biodiversity
![Page 17: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/17.jpg)
![Page 18: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/18.jpg)
(Euascomycetes)
(Hemiascomycetes)
(Archiascomycetes)
![Page 19: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/19.jpg)
A least 3 major groups within Saccharomycotina ,
(previously hemiascomycetes) :
- Saccharomyces complex or Saccharomycetaceae
14 clades (Kurtzman 2003), point centromeres
- reassigment of the genetic code : the CTG codons ar translated
in serine rather than leucine ex. Candida albicans or
Debaryomyces hansenii
- GC rich genome ex. Yarrowia lipolytica
![Page 20: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/20.jpg)
WGD
Kurtzman 2003
14 clades for the
Saccharomyces complex or Saccharomycetaceae (compact centromere)
- Wolfe 1997 - Kellis 2004
(P.Philippsen)
P
r
o
t
o
p
l
o
i
d
s
![Page 21: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/21.jpg)
- goals, strains, genome sizes: eukaryotes/prokaryotes
- chromosomal mapping, genomic DNA banks,
and genome coverage, redundancy, overlapping
fragments
- DNA sequencing (and new methods Pyrosequencing
evolving very fast= new approaches)
- chromosomal assembly
- identifications of the genetic elements ( ORFs/CDSs, TR,
tRNA, repetitive sequences,
- definitions: orthologs, paralogs, duplication,
common and specific genes, species specific genes,
synteny
- ncRNA,…
![Page 22: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/22.jpg)
- comparisons using BLAST
- mirror effects
- small ORFs /CDSs
- intron detection (a possible strategy)
- mechanisms of genome evolution
- comparative genomics and phylogenetics
- impact of new sequencing technologies , 454, Solexa
- other developments: transcriptomics
![Page 23: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/23.jpg)
TOL three domains of life (cf LUCA)
![Page 24: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/24.jpg)
Eubacteria
Eukaryotes
Archea Tree of life
![Page 25: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/25.jpg)
Saccharomyces
cerevisiae
Caenorabditis elegans
Drosophila
melanogaster
Mus musculus
Arabidopsis thaliana
Model organisms
![Page 26: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/26.jpg)
Goals of genomics
Systematic sequencing of each chromosome
(eucaryotes from telomere to telomere)
(procaryotes often circular not always (!) and number of
DNA molecule/strain)
Both DNA strands with perfect complementarity
Towards 0% error (difficult)
If the previous steps are finished: it will be
possible (theoretically) to detect all the genetic objects
within the sequenced species
![Page 27: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/27.jpg)
General strategy:
- step 1: from chromosome to the
DNA sequence
- step 2: identification within the
DNA sequence of all the genetic
objects for production of a very
precise chromosomal map
![Page 28: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/28.jpg)
![Page 29: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/29.jpg)
The G+C content:
Highly variable among procaryotes
- 28,6 % Borrelia burgdorferi
- 69,4 % Thermus thermophilus
Less variable among eucaryotes
- 41 % Mus musculus
- 38 % S. cerevisiae
- 49 % Yarrowia lipolytica
- 35 % Arabidopsis thaliana
one example
link = genetic code, codon usage
![Page 30: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/30.jpg)
G+ C value is important , example:
Nature, March 2010, A.J. Chapman et al.
Hydra 29% G+C Hydra magnipapillata
Associated with Hydra is a bacteria
a novel Curvibacter (the reference name will be published later)
with G+C content up to 60%
If contigs (see later) are differents with their respective
G+C content, this is an indication that there are probably
different genomes
![Page 31: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/31.jpg)
![Page 32: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/32.jpg)
Classes of interspersed repeat in the human genome
6-8 kb 850,000 21%
Length Copy Fraction of
number genome
100-300 bp 1,500,000 13%
6-11 kb
1.5-3 kb
450,000 8%
2-3 kb
80-3,000 bp
300,000 3% }
}
AAA
AAA A B
gag pol (env)
(gag)
transposase
LINEs Autonomous
SINEs Non-autonomous
Retrovirus-like
elements Autonomous
Non-autonomous
DNA Autonomous
transposon
fossils Non-autonomous ] [
![Page 33: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/33.jpg)
Retrovirus
LTR LTR gag pol env
7 kb
Ty1/copia retrotransposon
LINE (Long Interspersed Nuclear Elements)
gag ? pol poly(A)
6 kb
SINE (Short Interspersed Nuclear Elements)
0,3 kb
![Page 34: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/34.jpg)
![Page 35: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/35.jpg)
JA Chapman et al. Nature 000, 1-5 (2010) doi:10.1038/nature08830
Dynamics of transposable element expansion in
Hydra reveals several periods of transposon activity.
![Page 36: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/36.jpg)
![Page 37: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/37.jpg)
Sequencing strategy :
(if using only Sanger technology, up to year 2007)
Genomic DNA bank 1: 3 to 5 kb long DNA fragments; high copy number E. coli vector
Genomic DNA bank 2: 5 to 7/10 kb long DNA fragments;low copy number E. coli vector
Genomic DNA bank:
- cosmides (35-40 kb)
- BACs (70-150 kb)
Both ends sequencing: required for contigs assembly
Checking the super contig assembly :
- by fingerprint
- by marqker genes assignation on chromosomes
( hybidization or chromosome painting; depending of the species)
(However depending of the genome size and of the % of repetitive elements)
![Page 38: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/38.jpg)
Genomics using yeasts as model organisms:
- goals, strains,genome size eukaryotes/prokaryotes
- chromosomal mapping, genomic DNA banks,
and genome coverage, redundancy, overlapping
fragments
- DNA sequencing (and new methods Pyrosequencing)
- chromosomal assembly
- identifications of the genetic elements ( ORFs/CDSs, TR,
tRNA, repetitive sequences,
- definitions: orthologs, paralogs, duplication,
common and specific genes, speciation genes?, synteny
- comparison with BLAST
- mirror effects
- small ORFs /CDSs
- intron detection
- mechanisms of genome evolution
- comparative genomics and phylogenetics
- impact of new sequencing technologies , 454
- other developments: transcriptomics
![Page 39: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/39.jpg)
Amino acid numbers to encode different enzymes of the glycolytic pathway in S. cerevisiae Glycolyse GLK1 aldohexose specific glucokinase 500 aa HXK 2 hexokinase II 486 aa HXK 1 hexokinase I 485 aa PGI1 glucose-6-phosphate isomerase 554 aa FBA1 fructose-bisphosphate aldolase 359 aa GPD 1 glyceraldehyde-3-phosphate dehydrogenase 1 332 aa GPD 2 glyceraldehyde-3-phosphate dehydrogenase 2 332 aa GPD 3 glyceraldehyde-3-phosphate dehydrogenase 3 332 aa PGK1 phosphoglycerate kinase 416 aa GPM 1 phosphoglycerate mutase 247 aa GPM 3 phosphoglycerate mutase 303 aa GPM 2 phosphoglycerate mutase 311 aa ENO 2 enolase II (2-phosphoglycerate dehydratase) 437 aa ENO 1 enolase I (2-phosphoglycerate dehydratase) 437 aa PYK 2 pyruvate kinase 506 aa PYK 1 pyruvate kinase 500 aa
Alcoolic fermentation PDC 1 pyruvate decarboxylase, isozyme 1 563 aa PDC 5 pyruvate decarboxylase, isozyme 2 563 aa PDC 6 pyruvate decarboxylase, isozyme 3 563 aa
![Page 40: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/40.jpg)
CDS or gene 1 CDS or gene 2 CDS or gene 3
Intergenic area Intergenic area
Part of a chromosome area
![Page 41: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/41.jpg)
![Page 42: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/42.jpg)
The cover shows the devastating results of potato blight
(Phytophthora infestans) infestation - the pathogen that triggered
the Irish potato famine in the nineteenth century. The genome
of this still dangerous pathogen has now been sequenced,
revealing fast evolving effector genes that may contribute to
the rapid adaptability to host plants that has made potato blight
so difficult to control. Nature 461, pp315-438, September 2008
75 % repeated
Sequences,
Mainly RT elements
![Page 43: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/43.jpg)
- goals, strains,genome
sizes eukaryotes/prokaryotes
Standardisation at the hapoid level
C value represents the haploid genome
size of one organism
(C for « constant » or « characteristic »)
(1000 bp= 1kb, 1000 kb= 1Mb, 1000 Mb= 1Gb)
![Page 44: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/44.jpg)
Génomes complètement séquencés de quelques Archées
![Page 45: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/45.jpg)
Génomes complètement séquencés de quelques Eubactéries
![Page 46: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/46.jpg)
Génomes complètement séquencés de quelques Eucaryotes
![Page 47: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/47.jpg)
Conclusion:
In procaryotes genome size is relatively
small and in correlation with the number
of genes encoding proteins
In eucaryotes no correlation between
the genome size and the number of
genes encoding proteins
![Page 48: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/48.jpg)
- species
- strains and polymorphism (HETEROZYGOTE!)
- genetic analysis = deletions,
duplications, translocations,… in addition to basic
point mutations
- consequence = the gene number is different
from strain to strain (very often gene number is
referring to the genes encoding proteins, but this
is wrong, tDNA, rDNA genes, sn RNA….)
![Page 49: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/49.jpg)
- the gene number of Saccharomyces
cerevisiae is
5813 is a wrong expression
- the gene number of Saccharomyces
cerevisiae
strain S288C is 5813: is a good expression
+ the date, because annotation is a never
ending process……….
The same for Homo sapiens sapiens and all
other living organisms
![Page 50: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/50.jpg)
Genomic DNA banks (10 X coverage)
- redundancy (including boundaries overlaps)
- representativity
- rich (only clones with expected DNA inserts (99 %))
![Page 51: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/51.jpg)
The BAC cloning scheme
![Page 52: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/52.jpg)
![Page 53: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/53.jpg)
Average Fragment Sizes of Mammalian DNA Produced by
Cleavage with Rare Cutting Restriction Enzymes
![Page 54: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/54.jpg)
Library size
(genome coverage) P (%)
0.5 39.3
1 63.2
2 86.4
3 95.0
4 98.2
5 99.3
6 99.75
7 99.91
8 99.97
9 99.99
10 99.995
Cx
P (x) = ------- e-c
x!
cov erage f rom 0.5 to 10.
Probability of Having One or More Clones/
Locus within a Library as a Function of Library Size
The probability of f inding x clones f rom a library of c cov erage is calculated as
The probabilities shown are those of f inding one or more clones (1- P (0)) f or libraries with genome
![Page 55: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/55.jpg)
Haploid Average
genome size insert size
of organism of clones no. of no. of 384-well
(Mb) (kb) clones plates
20 50 3000 8
1000 100 7500 20
3000 50 450 000 1172
3000 150 150 000 391
Number of Clones Required for 7.5x Genomic Coverage
Library size
![Page 56: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/56.jpg)
The importance of the physical mapping of large DNA
fragments:
duplicated DNA sequences and possible assembly
mistakes
- contigs
- ordering large DNA fragments or
chromosome walking
- correspondance contigs map and physical map
![Page 57: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/57.jpg)
![Page 58: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/58.jpg)
X
A
B
chromosome V
YEP06
FCY21 FCY22
![Page 59: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/59.jpg)
Ordering clones
by chromosome walking
![Page 60: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/60.jpg)
Contigs map check by fingerprint:
an example with Not 1 digestion
also Hind III often used ( target size and resolution)
Note: with large DNA fragments ( more than 10 kb)
the size determination is achieve by PFGE
![Page 61: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/61.jpg)
Digestion of BACs with NotI
![Page 62: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/62.jpg)
HindIII fingerprints of human BACs and PACs
![Page 63: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/63.jpg)
5’ATGTCTGCTGCTGCTGATAGATAACTTAACTTCCGGCCAC 5’AACTTAACTTCCGGCCACTTGAATGCTGGT
5’CTGCTGATAGATAACTTAACTTCCGGCCACTTGAAT
5’CCGGCCACTTGAATGCTGGTAGA
5’CTGATAGATAACTTAACTTCCGGCCACTTGAATGCTGG 5’AACTTAACTTCCGGCCACTT
5’CTGATAGATAACTTAACTTCCGGCCACTT
5’GATAACTTAACTTCCGGCCACTTGAATGCT
5’ATGTCTGCTGCTGCTGATAGATAACTT
5’GCCACTTGAATGCTGGTAGA
5’ACTTAACTTCCGGCCACTTGAATGCTGG
5’TGCTGCTGATAGATAACTTAACTTCCGG
Raw sequences :
After assembly…
![Page 64: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/64.jpg)
![Page 65: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/65.jpg)
5’ATGTCTGCTGCTGCTGATAGATAACTTAACTTCCGGCCAC
5’AACTTAACTTCCGGCCACTTGAATGCTGGT
5’CTGCTGATAGATAACTTAACTTCCGGCCACTTGAAT
5’CCGGCCACTTGAATGCTGGTAGA
5’CTGATAGATAACTTAACTTCCGGCCACTTGAATGCTGG
5’AACTTAACTTCCGGCCACTT
consensus sequence
5’ATGTCTGCTGCTGCTGATAGATAACTTAACTTCCGGCCACTTGAATGCTGGTAGA
5’CTGATAGATAACTTAACTTCCGGCCACTT
5’GATAACTTAACTTCCGGCCACTTGAATGCT
ATGTCTGCTGCTGCTGATAGATAACTT
GCCACTTGAATGCTGGTAGA
ACTTAACTTCCGGCCACTTGAATGCTGG
TGCTGCTGATAGATAACTTAACTTCCGG
![Page 66: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/66.jpg)
![Page 67: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/67.jpg)
![Page 68: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/68.jpg)
![Page 69: Introduction to Genomics using yeasts as model organisms · just working by similarity, no functional analysis ... in serine rather than leucine ex. Candida albicans or Debaryomyces](https://reader033.vdocument.in/reader033/viewer/2022050503/5f94f6e68255dc69525892fe/html5/thumbnails/69.jpg)
C-J Rubin et al. Nature 000, 1-7 (2010) doi:10.1038/nature08832
Chicken lines resequenced.
Resequencing