investigation of alternative approaches to narrow-leafed ... · transformation efficiency (6.5% for...
TRANSCRIPT
1
Investigation of alternative approaches to narrow-leafed
lupin (Lupinus angustifolius) genetic transformation
This thesis is presented for the degree of
Doctor of Philosophy of Murdoch University, 2014
by
Kanokwan Ratanasanobon
M.Sc (Biotechnology), B.Sc (Biotechnology)
2
Declaration
I declare that this thesis is my own account of my research and contains as its main
content work which has not previously been submitted for a degree at any tertiary
education institution.
...................................
(Kanokwan Ratanasanobon)
3
Abstract
Narrow-leafed lupin (Lupinus angustifolius) is one of the top six crops that contribute
value to the Australian economy. Gene transfer technology has been studied as a
strategy to improve lupin varieties against diseases to improve yield, production and
seed quality. However, the established method used for transformation of lupin is based
on Agrobacterium and embryonic axes as explants is a method of low efficiency. The
aim of this project was to investigate the alternative genetic transformation methods for
genetic manipulation of narrow-leafed lupin (L. angustifolius) to improve the
transformation efficiency. Two potential genetic transformation methods were
investigated: particle bombardment (direct gene transfer), and in planta transformation
(Agrobacterium-based transformation). In addition, lupin-Agrobacterium interactions
were studied to provide information of the factors limiting transformation, and whether
the involvement of an additional virG using construct carrying virGN54D (constitutive
virG mutant carrying Asn-54 to Asp amino acid substitution) improved lupin
transformation efficiency.
In this project, a genetic transformation protocol using particle bombardment for
narrow-leafed lupin was accomplished. The following conditions were identified as
being optimal for transformation via particle bombardment using a helium inflow
particle gun with lupin embryonic axes as target explants:
a) Embryonic axes used as explants were pre-treated in MS media supplemented
with 5 mg/L BAP and 0.5 mg/L NAA, 3% sucrose and 0.7% agar for 3 days in
the dark at 25oC.
b) Pre-treated explants were placed onto MS media with 0.3 M mannitol as
osmoticum 4 h prior to bombardment.
c) Bombardment was carried out by:
A precipitation protocol using plasmid DNA prepared at 2 ng DNA per
μg tungsten particles.
Bombardment was carried out twice at 400 psi with a 7 cm target
distance with 10 L coated particles.
d) Bombarded explants were kept on osmoticum media (MS media with 0.3 M
mannitol) for 4 h then transferred to pre-/post-treatment media for post-treatment
for another 3 days and kept in the dark at 25oC.
4
e) After post-treatment, explants were transferred to selection media (MS medium
with 1 mg/L BAP and 0.1 mg/L NAA, 3% sucrose, 0.7% agar and 10 mg/L
PPT) for 8 weeks with subculture every two weeks. Surviving shoots were
transferred to rooting media and analysed for presence of the transgene by PCR.
A transformation efficiency of 0.4% for T0 production was achieved as confirmed by
amplification of a gus gene by PCR. However those transformed explants did not form
roots.
In planta transformation of seedlings and flowers of narrow-leafed lupin was
investigated. For seedling transformation, factors essential for delivering A.
tumefaciens to the target tissues (L2 layer of apical meristem of seedings) and to
enhance the ability of A. tumefaciens cells to transform plant cells were studied and
optimised. Sonication and vacuum infiltration facilitated penetration of A. tumefaciens
cells to the target tissue, sonicating seedlings 15 min before 10 min infiltration with A.
tumefaciens cells gave the best overall balance of both gene transfer determined by
GUS staining and seedling survival rate. The Agrobacterium induction condition and
infiltration medium was developed after testing and optimising of media and
Agrobacterium growth. Modified LB medium with glucose 30 g/L was the best
medium that gave the highest percentage of shoots showing GUS expression, at 35±5%
which was significantly higher than the control infiltration media used for Medicago
and A. thaliana in planta transformation at the 0.05 level Tukey HSD. The combined
optimised conditions were further tested. Some shoots, picked at random, were positive
for GUS expression, including the whole apical area and parts of leaves of new shoots,
indicating gene transfer and stable transformation although chimeric. However,
transformants were not obtained. Further investigations suggested that there may not
have been enough viable A. tumefaciens on seedling shoots for successful
transformation. Survival of A. tumefaciens cells on the plant tissues was about 103
times less than routinely used for transformation of lupins in the established in vitro
lupin transformation method.
In in planta transformation of lupin flowers, experiments were designed to deliver
Agrobacterium cells to lupin ovules as target tissues. Factors reported to contribute to
success in this type of transformation, such as using surfactant, infiltration period and
times under vacuum and composition of infiltration medium were tested and optimised
5
for lupins. Thirty plants with floral inflorescences having flowers ranging from the
dome to open stages were infiltrated twice for 3 min each with MS liquid medium
containing 10 mM glucose, 0.01% Silwet L-77 and A. tumefaciens cells in early
exponential stage at concentration of OD 1.87. Pod set was 10.82 %. No transformant
was obtained. The same infiltration media and conditions were used with Arabidopsis
thaliana cv Columbia as control plants and transformants obtained at 0.255%.
Histology studies of lupin flower structure by SEM and wax-embedded sectioning
revealed that there did not appear to be a physical channel for A. tumefaciens cells to
gain access to the ovule via the stigma or style before anthesis. Furthermore,
Agrobacterium cells could not gain access to the ovule through the immature carpel of
young flowers as the developing carpel closed while the ovule developed inside.
Interactions between Agrobacterium and lupin were studied to determine which stages
limit transfer of genes from Agrobacterium to lupins, and which might be modified to
achieve and/or improve transformation efficiency by A. tumefaciens in a genotype-
independent fashion. The stages studied were: the attachment of Agrobacterium to the
lupin explants, T-DNA transport across the cell wall and through the cell membrane. In
addition, the effect of an extra virG was examined to find out if it would increase T-
DNA transport. The interaction studies were done by comparing reactions to gene
transfer in lupin cultivars Merrit and Quillinock which have significant difference in
transformation efficiency (6.5% for cv Merrit and ~1% for cv Quillinock). The results
of the attachment of Agrobacterium cells experiment showed no significance
statistically in the number of bacterial cells attached to the explants (half embryonic
axes) of six cultivars of narrow-leafed lupin (cvs Merrit, Quilinock, Belara, Illyarrie,
Yorrel and Danja), indicative that the attachment stage was not the factor limiting gene
transfer. T-DNA transport through the cell wall and cell membrane was evaluated
through gus expression in experiment using cell suspensions (cells with cell walls) and
protoplast (cells without cell walls) with T-DNA transfer determined by the relative
intensities of the RT-PCR amplicons. The results showed, unexpectedly, that cv Merrit
had less T-DNA transferred by A. tumefaciens than cv Quillinock in cell suspensions
but not in protoplasts. The results were supported with MUG assays of transient
expression of the gus reporter gene in cell suspensions of both cultivars. This indicated
that the differences in cell wall composition between these two cultivars played an
important role in gene transfer, but the factors limiting transformation success in
6
Quillinock were downstream from T-DNA transfer to the cytoplasm of the host cell,
possibly involving in T-DNA integration and/or expression, or selection and recovery of
whole plants. The effect of an extra virG was examined with lupin, virGN54D
increased transient expression of gus only in cv Quillinock cells, not in cv Merrit cells.
Constructs carrying virGN54D may, therefore, be of some use as a component of a
transformation protocol for cv Quillinock, and possibly other recalcitrant lupin
cultivars.
This work has confirmed the relative difficulty of transforming narrow-leafed lupins,
and it is concluded that despite investigating a series of alternative approaches, the
method based on ‘stab inoculation’ of apical meristems, followed by selection of
chimeric tissues to generate transgenic inflorescences, appears to be the most reliable
approach. However, it is strongly genotype dependant, and improvements in efficiency
and reduced genotype dependence are still desirable.
7
Table of contents
Chapter 1. Introduction and Literature Review ...................................................... 15
1.1 Lupins: usage and importance ............................................................................ 15
1.2 Plant genetic transformation ............................................................................... 16
1.2.1 Indirect gene transfer system ........................................................................ 17
i) Agrobacterium-mediated gene transfer system ............................................... 17
ii) Vector systems used in Agrobacterium-mediated transformation .................. 23
a) Cointegrative Vectors ................................................................................. 23
b) Binary Vectors ........................................................................................... 23
iii) Factors affecting the efficiency of Agrobacterium-mediated plant
transformation ................................................................................................... 26
a) Agrobacterium strains ................................................................................ 26
b) Wounding methods .................................................................................... 28
1.2.2 Direct gene transfer systems......................................................................... 29
i) Macroinjection ............................................................................................... 30
ii) Microinjection .............................................................................................. 30
iii) Laser microbeam ......................................................................................... 30
iv) Electrophoresis ............................................................................................ 31
v) Electroporation.............................................................................................. 31
vi) Silicon carbide fiber (whisker)-mediated transformation .............................. 31
vii) Particle bombardment transformation (Biolistics) ........................................ 31
viii) Poly (amidoamine) dendrimer for direct DNA delivery to plant cells ......... 32
1.3 Legume transformation ...................................................................................... 32
1.4 Current status of genetic modified crops ............................................................ 36
1.5 Aims of the project ............................................................................................ 37
1.6 Future of genetically modified crops …………………………………………….38
1.7 Aims of project …………………………………………………………………..42
Chapter 2: General Materials and Methods............................................................. 43
2.1 Plant materials ................................................................................................... 43
2.1.1 In vitro cultures ............................................................................................ 43
2.1.2 Lupins in the glasshouse .............................................................................. 43
8
2.1.3 Surface-sterilisation of seeds ........................................................................ 43
2.1.4 Embryonic axes isolation ............................................................................. 43
2.2 Agrobacterium tumefaciens ................................................................................ 44
2.2.1 Storage ........................................................................................................ 44
2.2.2 Inoculum preparation ................................................................................... 44
2.2.3 Preparation of electro-competent cells.......................................................... 44
2.2.4 Electroporation of electro-competent A. tumefaciens cells ............................ 45
2.2.5 A. tumefaciens culture preparation for plant transformation .......................... 45
2.3 Plant expression vectors ..................................................................................... 46
2.4 Plant DNA extraction ......................................................................................... 47
2.4.1 Miniprep method ......................................................................................... 47
2.4.2 Easy DNA High Speed Extraction method (for plants) ................................. 48
2.5 Analysis of transgenic plant material .................................................................. 48
2.5.1 Spraying with phosphinothricin ................................................................... 48
2.5.2 Polymerase chain reaction ............................................................................ 49
2.5.3 Histochemical GUS assay ............................................................................ 50
2.6 Histology ........................................................................................................... 50
2.6.1 Paraffin wax embedded plant tissues with microtome .................................. 50
2.6.2 Dissection of plant tissues by hand ............................................................... 51
Chapter 3. Lupin Transformation via Particle Bombardment .................................. 52
3.1 Introduction ....................................................................................................... 53
3.1.1 The significance of particle bombardment transformation ............................ 53
3.1.2 Particle bombardment devices ...................................................................... 56
a) Helium-modified bombardment device ......................................................... 56
b) Particle accelerator or Accel particle gun ...................................................... 56
c) Microtargeting device ................................................................................... 56
d) Particle inflow gun ....................................................................................... 56
e) Helios gene gun ............................................................................................ 57
3.1.3 Parameters influencing transformation success............................................. 57
3.1.4 Transgene integration................................................................................... 59
3.2 Materials and Methods ....................................................................................... 60
3.2.1 Plant material and culture conditions ............................................................ 60
3.2.2 Plasmid preparation ..................................................................................... 61
9
3.2.3 Microprojectile bombardment ...................................................................... 62
3.2.4 Selection procedure of putative transformants .............................................. 63
3.2.5 Rooting ........................................................................................................ 63
3.2.6 Data analysis…………………………………………………..……………..64
3.3 Results ............................................................................................................... 64
3.3.1 Optimisation ................................................................................................ 64
i) Plasmid preparation method ........................................................................... 64
ii) Helium pressure ............................................................................................ 64
iii) Effect of helium pressure and target Distance............................................... 68
iv) Mannitol concentration ................................................................................ 69
v) Shoot regeneration versus bombardment pressure ......................................... 70
vi) Concentration of plasmid DNA .................................................................... 70
vii) Particle load ................................................................................................ 71
viii) Combining parameters to effect stable transformation ................................ 72
ix) Pre- and post-treatment of explants .............................................................. 73
x) Number of bombardments ............................................................................. 75
xi) DNA fragment length ................................................................................... 76
3.3.2 Using optimised protocol to generate transformants ..................................... 77
3.4 Discussion ......................................................................................................... 79
3.4.1 Optimisation ................................................................................................ 79
a) Plasmid preparation method .......................................................................... 80
b) Helium pressure and target distance .............................................................. 80
c) Concentration of mannitol in osmoticum medium.......................................... 80
d) Concentration of DNA .................................................................................. 81
e) Particle volume loaded .................................................................................. 81
f) Combining optimised parameters ................................................................... 81
g) Pre- and post-treatment of explants ............................................................... 82
h) The number of bombardments ....................................................................... 83
i) DNA fragment size ........................................................................................ 83
3.4.2 Developing and optimised protocol .............................................................. 84
3.5 Conclusion ......................................................................................................... 86
Chapter 4 In planta Transformation of Narrow-leafed Lupin .................................. 87
10
4.1 Introduction ....................................................................................................... 87
4.1.1 Types of in planta transformation ................................................................ 87
i) Pollen transformation ..................................................................................... 87
ii) “Clip’n Squirt” .............................................................................................. 88
iii) Seed transformation ..................................................................................... 88
iv) Vacuum infiltration ...................................................................................... 88
v) Floral dip or spray ......................................................................................... 88
4.1.2 Mechanism of in planta transformation ........................................................ 89
4.1.3 Factors influencing successful in planta transformation ............................... 89
i) Explants: stages and genotypes ...................................................................... 89
ii) Components of infiltration and inoculation media ......................................... 90
iii) Conditions of treatment ................................................................................ 90
4.2 Materials and Methods ....................................................................................... 91
4.2.1 Plant materials ............................................................................................. 91
a) Narrow-leafed lupin ...................................................................................... 91
b) A. thaliana .................................................................................................... 91
4.2.2 Transformation of lupins using vacuum infiltration ...................................... 91
4.2.3 Wounding explants with sonication .............................................................. 92
4.2.4 Isolation of A. tumefaciens cells from infiltrated lupin seedlings and 3-
ketolactose test for Agrobacterium cells…………………………………..……….92
4.2.5 Sample preparation for scanning electron microscopy (SEM) ...................... 93
4.2.6 In planta transformation of A. thaliana ......................................................... 94
4.3 Results ............................................................................................................... 94
4.3.1 Vacuum infiltration transformation of lupin seedlings .................................. 94
i) Infiltration time and sonication time ............................................................... 94
ii) A. tumefaciens growth phase ......................................................................... 98
iii) Composition of infiltrated medium and gus-intron transient expression........ 99
iv) The transformation of lupin seedlings by sonication and infiltration ........... 101
v) Viability of A. tumefaciens after infiltration versus gene transfer rate (in vitro)
........................................................................................................................ 102
4.3.2 Vacuum infiltration transformation of L. angustifolius flowers .................. 104
i) Effect of wetting agent and BAP in infiltration medium ............................... 104
ii) Effect of infiltration time ............................................................................ 106
iii) Flower infiltration with optimum media and conditions ............................. 107
11
iv) Mechanism of A. tumefaciens delivery to flowers. ...................................... 112
4.3.3 A. thaliana in planta transformation ........................................................... 116
4.4 Discussion ....................................................................................................... 117
4.4.1 Vacuum infiltration of lupin seedlings ....................................................... 117
4.4.2 Vacuum infiltration of lupin flowers .......................................................... 123
4.4.3 A. thaliana in planta transformation ........................................................... 125
4.5 Conclusion ....................................................................................................... 126
Chapter 5: Studies on Agrobacterium and Lupin Interactions ............................... 127
5.1 Introduction ..................................................................................................... 127
5.1.1 Plant and Agrobacterium interactions ......................................................... 127
5.1.2 Lupin genotype-dependent response to Agrobacterium tumefaciens ........... 129
5.2 Materials and methods ..................................................................................... 129
5.2.1 Plant materials, Agrobacterium and plant expression vector ....................... 129
5.2.2 Determination of the number of Agrobacterium cells attached to lupin
explants ............................................................................................................. 130
5.2.3 Lupin protoplast culture ............................................................................. 130
5.2.4 Cell suspension preparation of narrow-leafed lupin .................................... 132
5.2.5 RNA extraction for plant tissue .................................................................. 132
5.2.6 Analysis of GUS expression by RT-PCR ................................................... 132
5.2.7 Fluorimetric assay for β-glucuronidase (MUG assay) ................................. 133
5.3 Results ............................................................................................................. 134
5.3.1 Determination of the number of Agrobacterium attached to lupin explants . 134
5.3.2 Determination of T-DNA transfer efficiency to cell suspensions and
protoplasts by RT-PCR ....................................................................................... 134
5.3.3 Determination of T-DNA transfer to lupin cell suspensions by a fluorimetric
assay for β-glucuronidase (MUG assay).............................................................. 137
5.4 Discussion ....................................................................................................... 140
5.4.1 Binding of A. tumefaciens to plant cell walls. ............................................. 140
5.4.2 Transient gene expression. ......................................................................... 142
5.5 Conclusion ....................................................................................................... 143
Chapter 6 General Discussion .............................................................................. 144
6.1 Investigations using particle bombardment....................................................... 144
12
6.2 Investigations using in planta transformation ................................................... 146
6.3 Studies on Agrobacterium and lupin interactions .............................................. 150
6.4 Conclusion ....................................................................................................... 151
References…………………………………………………………………………....152
List of Abbreviations………..……………………………………………………….183
Publications and Presentations…………………………………………………..…186
13
Acknowledgement
I would like to thank my supervisors, Dr Stephen Wylie and Professor Michael Jones
for their advice, patience and kindness in supporting and understanding my long journey
in the development of this thesis.
I would like to thank Grain Biotech Australia (GBA) for access to their inflow particle
bombardment device for experiments in chapter 3.
I would like to thank Gordon Thomson for his help in histology and electron
microscopy.
Many thanks to all the friends I met at Murdoch University, for a good company that
made this journey enjoyable.
Thanks to the staff and fellow researchers in the Western Australian State Agricultural
Biotechnology Centre, Murdoch University for technical advice and support.
Thanks to Department of Agriculture and Food, WA for supplying lupin seeds.
14
Dedication
I would like to dedicate this thesis to my parents, Mr Chairat Ratanasanobon and Ms
Nataya Suangkratok, and my little girl, Ming, for their endless love and support.
15
Chapter 1. Introduction and literature review
In this thesis, research is reported on the investigation of a range of methods of gene
transfer into the genomes of cultivated varieties of narrow-leafed lupin (Lupinus
angustifolius). These methods included Agrobacterium tumefaciens-mediated
transformation via vacuum infiltration, direct gene transfer via particle bombardment,
and a study of the interactions between lupin and A. tumefaciens cells. A literature
review on the background to this research is provided in this chapter as follows:
Lupins: use and importance
Plant genetic transformation
Legume transformation
Current status of genetically modified crops in Australia
Aims of the project
1.1 Lupins: use and importance
Lupins (also known as lupines) are classified in the genus Lupinus, a member of the
subfamily Papilionoideae, family Leguminosae. Although this is a diverse genus of
more than two-hundred described species, only five species have been cultivated
worldwide. Lupins can be grown in marginal agricultural areas with acidic sandy soils
and they have the ability to adapt to arid climates. Novel grain quality characteristics
may stimulate further interest in lupins (Lee et al. 2009). Lupin grain is as high in
protein (30-40 %) as is soybean, but it is significantly higher in dietary fibre (30 %) and
lower in oil (6 %) and contains minimal starch. It therefore has a very low Glycaemic
Index (GI), and this has significant implications for western societies that have an
increasing incidence of obesity and associated risk of diabetes and cardiovascular
disease. There is also supportive scientific evidence that consuming lupin-enriched
foods may beneficially influence satiety (appetite suppression) and energy balance (Lee
et al. 2006).
Lupin seeds are mainly used as whole or supplementary meal for cattle, pigs, fish,
poultry and sheep feed (van Barneveld and Hughes 1994; Murray 1994; Glencross
2004). A variety of human foods can also be made from lupins, including pasta, bread,
16
snacks, tempeh, tofu, miso, sauce, soup, crunchy cereal, baby formula, and fresh sprouts
(Putnam et al. 1991; Golz 1993).
Apart from their use in animal feed and human food, lupins are also grown in rotation
with monocot crops such as wheat and barley to provide a disease break (Perry et al.
1998; Rowland et al. 1986). Their ability to fix atmospheric nitrogen through
rhizobium nodules adds to their value in infertile soil types and benefits the subsequent
crops in the rotation cycle (Longnecker et al. 1998). Lupins are cultivated in parts of
Europe, Australia, the Andean highlands, North America and South Africa (Clements et
al. 2005).
Lupins fill a niche as a legume crop that yields grain in arid and infertile sandy soils,
which cover large areas in the cropping zones of southern Australia. Lupin cultivation
began in Australia after Dr John Gladstones in Western Australia bred lupins that were
adapted to Australian conditions and had low alkaloid content, high yield, and improved
seed nutrient composition, disease and pest resistance, (Gladstones 1994). The first
release of fully domesticated variety of L. angustifolius, cultivar Uniwhite, in Australia
was in 1967. Since then, Australia is the largest lupin producer in the world with annual
tonnages varying between 0.5 and 1.5 million tonnes. The narrow-leafed lupin is the
major lupin type grown in Australia and usually contributes at least 95% of total lupin
production (Agtrans Research, 2012). Lupin production in Australia for 2010/11 was
estimated at 841,000 tonnes with a gross value of 223.5 million AUD (Australian crop
report 2012, ABARE).
1.2 Plant genetic transformation
Plant genetic transformation is a series of processes used to transfer one or more copies
of a gene of interest into a plant genome. After introducing a new gene into the plant
nucleus, successful and stable transformation requires its integration, expression, and
inheritance in the plant genome. Transformation systems are designed to deliver
foreign genes into a target explant and to select transformants. Many gene transfer
systems have been developed, which can be divided into two main categories, namely
indirect and direct gene transfer systems.
17
1.2.1 Indirect gene transfer
In indirect gene transfer, the foreign genes are delivered to plant cells or tissues by
biological vectors, hence they are sometimes called vector-based gene transfer systems.
In plants the vectors used are Agrobacterium species and the related Rhizobium species.
i) A. tumefaciens-mediated gene transfer system
Agrobacterium tumefaciens is characterised as an aerobic, soil-borne, gram-negative,
non spore-forming rods of 0.6-1 m in width and 1.5-3 m in length and have one to six
peritrichous flagellae (Lippincott et al. 1981). These bacteria are found in temperate
areas worldwide, with 25-28oC required for optimal growth. Although A. tumefaciens
was recognised by Smith and Townsend in 1907 as the plant pathogen causing crown
gall disease in plants, the process of infection did not attract researchers’ attention until
the early 1980s when the main principals leading to invention of binary vectors were
discovered (Hernalsteens et al., 1980; Hoekema et al., 1983). Since then,
Agrobacterium spp. has been exploited in plant genetic engineering.
Agrobacterium tumefaciens belongs to the family Rhizobiaceae. The genus A.
tumefaciens is divided into several species, including A. tumefaciens, A. rhizogenes, A.
vitis and A. radiobacter. There is doubt that these species accurately classify the genus
because the main determinant of their taxonomy is symptom development where it
exists in pathogenic strains. It may be more accurate to classify them according to the
type of plasmid they contain because where plasmids have been swapped between
species, the symptoms of infection reflect the presence of the plasmid, not the species
type. For example, an A. rhizogenes strain that has its Ri plasmid replaced with an A.
tumefaciens-type Ti plasmid infected roots in a similar manner to A. tumefaciens
(Costantino et al. 1980). This phenomenon also occurs between Agrobacterium spp.
and Rhizobium spp. when Ti and Sym plasmids are swopped. The amalgamation of A.
tumefaciens with Rhizobium into one genus as Rhizobium was proposed by Young et al.
(2001) as the author found little or no taxonomic data to support Agrobacterium as a
genus separate from Rhizobium, and so the name of A. tumefaciens was revised to
Rhizobium radiobacter. Although the proposal was objected by Farrand et al. (2003)
and another 83 individuals, the Rhizobium nomenclature encompassing A. tumefaciens
is increasingly accepted for reporting ecological and taxonomic studies, and for
cataloguing culture collection (eg. ATCC, DSMZ, ICMP, LMG, Young 2008).
However, the name A. tumefaciens is still recognised widely and it is used in this thesis.
18
The ability of A. tumefaciens to transfer genes into plant genomes depends on its
extrachromosomal DNA, called the tumour-inducing plasmid (Ti plasmid), which is
present naturally in a small proportion of wild bacteria. When bacteria carrying a Ti
plasmid infect a plant at wound sites, they transfer a portion of the Ti plasmid called the
transferred DNA (T-DNA) to the chromosomal DNA of plant cells. T-DNA encodes
two sets of enzymes. One set is involved in the synthesis of the plant growth hormones
cytokinins and auxins that cause uncontrolled plant cell division and enlargement
resulting in a tumour, the other set is involved in the synthesis of opines (N-
(carboxylalkyl) amino acid) in the tumour and secreted into the intercellular regions of a
tumour where A. tumefaciens is present (Petit and Tempe 1985). These compounds
cannot be utilised by the plant or other bacteria, but can be metabolised by A.
tumefaciens, thus this natural transformation system is a strategy by A. tumefaciens to
create a habitat and carbon and nitrogen source on which it can grow. More than twenty
different opines have been identified to date and are classified as octopines, nopalines,
mannopines, and agrocinopines. The type produced in a tumour is determined by the
opine synthase genes present on the T-DNA. Opine types are often used to classify A.
tumefaciens strains and their Ti plasmids (Grant et al. 1991). The most common strains
are the octopine and nopaline types.
Ti plasmid
The native Ti plasmid of A. tumefaciens is a large, circular, extra-chromosomal DNA
plasmid of about 200 kbp in size. It contains two main regions: the vir and T- regions
and genes for opine catabolism, conjugative transfer (tra) and replication (OriV). The
vir region is approximately 30-40 kb in size and comprises 6-8 operons depending on
the type of Ti plasmid. The operons identified to date are virA, virB, virC, virD, virE,
virF, virG, and virH. Their functions are shown in Table 1.1. The virA and virG loci
are constitutively expressed while other loci exhibit plant-inducible expression
(Lichtenstein and Fuller 1987). The entire vir region can operate both in cis and in
trans (Kado 1991).
The T-region is flanked by 25 bp imperfect direct repeats - the so-called right border
(RB) and left border (LB) sequences (Yadav et al. 1982) as shown in Fig. 1.1. The
segment of DNA to be transferred into the plant cell (T-DNA) is determined by the
content and the orientation of these borders, especially the RB. The transfer ability of
the desired T-DNA sequence is almost lost when the RB sequence is deleted or
inverted, whereas deletion of the LB repeat has almost no effect (Shaw 1984; Jen and
19
Chilton 1986). Furthermore, the T-strand is produced in a right-to-left direction
utilising border nicks as initiation and termination sites and this occur at between
nucleotides 3 and 4 of the border (Albright et al. 1987; Wang et al. 1987a). Inversion of
the border sequence causes a change in T-strand sequence and its orientation as a
consequence of a change to the nicking initiation site of the plasmid (Albright et al.
1987).
Table 1.1 A. tumefaciens vir genes and their functions (Nester and Gordon 1991;
Sheng and Citovsky 1996; Tzfira et al. 2004).
Vir gene Inducibility Size (kb) ORF’s Function
A
G
B
D
C
E
F
H
+
+
+
+
+
+
+
+
2.8
1.0
9.5
4.5
1.5
2.2
2.9
3.4
1
1
11
4
2
2
1
2
Plant signal sensor
Transcriptional activator
Conjugation channel
Processing of T-strand and
transportation into plant
cell nucleus
Enhance T-strand
production
Single strand binding
protein to protect T-strand
from plant nuclease and
involves in plant cell
nuclear transportation
Proteolysis of virE2 and
VIP1 of T-complex before
T-DNA integration into
plant genome
Detoxification of the
harmful phenolics secreted
by wounded plant
20
A)
Right: 5’-GXX TGXCAGGATATATXXXXXXGTXAXX –3’
Left: 5’-XGG TGGCAGGATATATXXXXXTGTAAAX-3’
B) Left border
5’-CGGCAGGATATATTCAATTGTAAAT
GCCGTCCTATATAAGTTAACATTTA-5’
C) Right border
5’-TGGCAGGATATATACCGTTGTAATT
ACCGTCCTATATATGGCAACATTAA-5’
Figure 1.1 A) Conserved bases on the left and right borders of Ti plasmid.
B) and C) Site of the nick between 3rd and 4th basepairs of the 25 border repeat. (adapted
from Hansen and Wright 1999).
Besides the effect of borders on T-DNA transfer, the DNA sequence around the T-DNA
borders also has a significant role in T-DNA transfer efficiency. A cis active 24 bp
sequence known as overdrive (ode) is located 13-14 bp from the RB of octopine
plasmids which enhances the efficiency of T-DNA transfer (Peralta et al. 1986).
Enhancer sequences of different sizes and different distances from the RB were
discovered in agropine and mannopine plasmids (Slightom et al. 1986; Jouanin et al.
1989; Hansen et al. 1992), but were not found in the nopaline plasmid (Wang et al.
1987b).
The T-DNA in Ti plasmids consists of 7-13 genes encoding two different types of
enzymes (Weising and Kahl 1996). First, the oncogenes (iaaM, iaaH, and ipt) encode
enzymes involved in the synthesis of phytohormones (auxin and cytokinin) causing the
disorganised proliferation of plant cells – leading to formation of the tumour. Second,
the genes encoding enzymes involved in the synthesis of opines (ocs, nos, acs) and their
secretion (ons).
T-DNA transfer process
T-DNA transfer is a complex process that requires the activities of vir genes in the Ti
plasmid as well as chromosomal virulence genes of A. tumefaciens and molecular
interaction with host plant cells (Fig. 1.2) involving 4 main steps:
1) Host recognition and attachment: A. tumefaciens senses host competent sites for
infection through the VirA/VirG system (see review by McCullen and Binns 2006), the
two-component regulatory system belonging to bacterial chemosensors that respond to
21
the chemical environment. VirA and VirG are encoded from virA and virG in the vir
region of the Ti plasmid. The VirA “sensor” detects signals (chemicals produced by the
plant eg. phenolic compounds and hexose sugars that plants release during wound
healing), which transfers a phosphate group from itself to the “activator” (VirG) which
in turn activates transcription of all the other vir genes (Binns and Howitz 1994).
Figure 1.2 An overview of the T-DNA transfer process from A. tumefaciens to the
plant cell (Tzfira and Citovsky 2002)
Once A. tumefaciens arrives at the wound site, it binds to the plant cell wall. This
attachment process is necessary for T-DNA transfer because mutants that lack ability to
bind are avirulent (Matthysse 1987; Thomashow et al. 1987). The chromosomal genes;
chvA, chvB, exoC (pscA) and att of A. tumefaciens are involved in attachment (Grant et
al. 1991). These genes respond to biosynthesis and secretion of -1, 2 glucans required
for attachment. These cellulose fibrils are produced to anchor A. tumefaciens to the
plant cell and entrap other free A. tumefaciens (Matthysse 1986). The attachment of A.
tumefaciens to cell walls has been shown to be saturable (Neff and Binns 1985; Gurlitz
et al. 1987), so specific plant cell wall components are thought to be involved. Several
22
plant cell wall components were proposed including a vitronectin-like molecule
(Wagner and Matthysse 1992), a plant receptor for rhicadhesin (an adhesion protein
encoded by A. tumefaciens, Swart et al. 1994) and CSLA9 (a cellulose synthase-like
protein, Zhu et al. 2003).
2) T-strand production and exportation to host cell: As a result of vir gene induction by
plant phenolics, sugars and acidic pH via the VirA and VirG regulatory system, and
physical contact between A. tumefaciens and plant cell by attachment, a linear single-
stranded DNA strand (T-strand) is generated. T-DNA cleavage requires two proteins
from the virD operon; VirD1 and VirD2. VirD2 is a site-specific endonuclease
(Yanofsky et al. 1986) that cleaves the lower strand of the right border at the third
nucleotide of the border sequence as described above. VirD1 is a type I topoisomerase
(Scheiffele et al. 1995) associating with endonucleolytic cleavage of the T-DNA. After
nicking, VirD2 remains bound to the 5’-end of T-strand by a phosphotyrosine bond
(Tinland et al. 1995) and the DNA repair synthesis starts at this nick site. The synthesis
of a new T-strand was believed to displace the cleaved T-strand as it proceeds to the
next nick site at the 3’ end at the left border. The overdrive sequence and VirC1 were
found to interact with VirD1 and VirD2 to promote right border nicking and T-strand
production (Toro et al. 1988).
The T-strand and several proteins encoded by virE, virD and virF are exported from A.
tumefaciens to host cells through a channel (T-pilus) formed by at least 12 proteins
encoded from virB1-11 and virD4 in a process similar to bacterial conjugation of type
IV secretion system (see review by Christie 2004).
3) T-DNA complex formation and nuclear importation: The T-strand is then coated with
VirE2 protein, a ssDNA binding protein encoded by the virE gene, along its length and
together with VirD2 attachment forming a so-called ‘T-DNA complex’ (or T-complex).
VirE2 is essential for T-DNA transfer because it protects the T-strand from nucleases in
the cytoplasm of plant cells (Rossi et al. 1996) and assists in nuclear importation
(Citovsky et al. 1997).
After the T-DNA complex is formed in a plant cell, it is transported through the host
cell cytoplasm by a cellular motor assisted mechanism (Salman et al. 2005). The next
process is nuclear import of the T-DNA complex. The VirD2 protein pilots the T-DNA
complex to the nuclear pore using its C-terminal NLS (nuclear localisation signal)
recognised by the NLS receptor importin . The T-DNA complex bound to importin
then docks to the NPC via importin , and the 5’terminus of the T-DNA is directed
23
toward the nuclear pore channel where translocation is initiated. VirE2 is required for
translocation of the complete T-DNA complex through the nuclear pore channel. The
coating of the VirE2 protein on the T-strand creates a telephone cord-like structure
(observed by electron microscopy) that enables translocation through the nuclear pore
channel (Citovsky et al. 1997).
4) T-DNA integration: The process of integration of T-DNA into the plant genome is
still obscure. The T-DNA complex first interacts with the chromatin via host plant
protein VIP1 (see review by Lacroix and Citovsky 2009), then the T-complex is
uncoated via the SCFVirF (VirF-containing Skp1–Cdc53-cullin–F-box) pathway (Tzfira
et al. 2004), exposing the T-strand for second-strand synthesis and integration.
Information from sequence analysis of several T-DNA insertions and their pre-insertion
sites in plant DNA showed that T-DNA integration was not site-specific, but a type of
non-homologous (‘illegitimate’) recombination. Several T-DNA integration models
have been proposed and they are reviewed in Tzfira et al. (2004).
ii) Vector systems used in A. tumefaciens-mediated transformation
To exploit A. tumefaciens in plant genetic engineering, vectors made from wild-type Ti
plasmids were constructed. Ti plasmid-based vectors have been developed based on the
discoveries that DNA between the LB and RB is transferred into the plant genome and
that the vir region can function in both cis and trans (Gelvin 2003a). Engineered
vectors have selectable marker gene(s), origin(s) of replication to allow plasmid to
replicate in bacteria, the T-DNA border sequences and multiple cloning sites. The Ti
plasmids normally used on vectors are disarmed, ie the oncogenes have been excised.
Two main vector systems, namely, the cointegrative vector system and binary vector
system are utilised in plant transformation.
a) Cointegrative vectors
The cointegrative vector system combines the cloning vector (gene of interest, ori for
replication in E. coli) and disarmed Ti plasmid in one plasmid via homologous
recombination (Horsch et al. 1985). Therefore, it is larger in size than that of the binary
vector system, and it is generally present as a single copy. The most widely used
plasmids in plant transformation are based on binary vector systems.
b) Binary vectors
The binary vector system consists of two plasmids: the “binary plasmid” and the helper
plasmid. The gene of interest is contained between the T-DNA borders in the small
24
binary plasmid whereas the helper plasmid is a Ti plasmid without the T-region but with
the vir region. The smaller binary plasmids allow them to replicate to higher copy
numbers in E. coli and A. tumefaciens cells.
Since the first binary vector system was developed in 1983 (Hoekema et al. 1983),
many plasmids based on this system have been developed because of their flexibility for
cloning and their ability to be used with more plant species, and for specific purposes
(reviewed by Hellens 2000; Komori et al. 2007). Some of these are described below.
Binary vectors designed to assist A. tumefaciens-mediated plant transformation
with large DNA fragments
The binary bacterial artificial chromosome (BIBAC) vector (Hamilton 1996) and the
transformation-competent bacterial artificial chromosome (TAC) vector (Liu et al.
1999) were developed to facilitate the transfer of a large segment of genomic DNA (at
least 150 kb for BIBAC and 80 kb for TAC) into plant genomes via A. tumefaciens-
mediated plant transformation. These vectors are valuable, for example, for studies on
the expression of plant genes or gene clusters in their native genomic context and might
eliminate site-dependent gene expression, which could be an issue in plant
transformation experiments (Hamilton et al. 1996). Furthermore, large insert
transformation can inform positional cloning in relation to the isolation of genes that
encode complex quantitative traits. In addition, it could accelerate positional cloning by
eliminating the subcloning of many small fragments into a transformation-competent
vector for functional analysis and complementation testing, and enable the transfer of
one or more of these genes to various plant species (Hamilton et al. 1996; Liu et al.
1999).
The BIBAC vector and TAC vector have common components as follows (Shibata and
Liu 2000):
Positive-selection markers active in E. coli (the sacB gene)
Elements for the stable maintenance of foreign DNA in E. coli (the F factor in
BIBAC and P1 phage replication origin in TAC) and in A. tumefaciens (the Ri
replication origin of Agrobaterium rhizogenes in both BIBAC and TAC)
Left and right border sequences
A selectable marker active in plants (hygromycin phosphotransferase in both
vectors)
25
Binary vector systems designed to assist the production of marker-free transgenic
plants
There are several strategies to produce selectable marker-free transgenic plants. The
major strategies are co-transformation, site-specific recombination, transposition system
and homologous recombination, among which co-transformation is used widely (Tuteja
et al. 2012) because of its simplicity comparing to others.
In co-transformation systems, selectable marker genes and target genes are not inserted
between the same pair of T-DNA borders. They are inserted into separate T-DNAs, and
enabled them to integrate into plant genome in different loci, therefore they can
segregate independently in a Mendelian fashion following regeneration (T1), and
transgenic plants with target genes and lacking selectable markers can be selected. The
target gene and selectable marker can be in the same binary vector (two T-DNA binary
vector, Depicker 1985; Komari 1996) or in two different binary vectors (Daley 1998),
and in the same A. tumefaciens cells or in different A. tumefaciens cells (McKnight
1987).
The MAT vector system (Sugita et al. 1999) was designed to enable excision of the
selectable marker gene by employing the Ac transposon of maize. In this system, the
isopentenyl transferase (ipt) gene of A. tumefaciens is used as a selectable marker for
regenerating transgenic cells and selecting marker-free transgenic plants. Isopentenyl
transferase catalyses cytokinin synthesis and causes proliferation of transgenic cells and
differentiation of adventitious shoots. In the vector used in this system, the chimeric ipt
gene with a 35S promoter is inserted into the Ac maize transposable element in order to
remove it from transgenic cells after transformation by transposition. In the
transposition process, about 10% of the excised Ac elements are not reinserted and
disappear or are reinserted into a sister chromatid that is subsequently lost during
somatic segregation (Belzile et al. 1989). This chimeric gene is combined with the site-
specific recombination R/RS system in order to remove it from transgenic cells after
transformation by use of recombinase.
Another site-specific recombinase system exploited in binary vector designs to remove
selectable marker is Cre/loxP of bacteriophage P1 (Odell et al. 1990). In this system,
two types of binary vectors are developed. The Cre recombinase gene and the loxP site
are carried in separate plasmids (Albert et al. 1995; Gleave et al. 1999). The target
plants are transformed with the plasmids carrying T-DNA and loxP-flanked selectable
marker gene. The transgenic lines that contain a single copy of the transgene are
26
selected and then retransformed with another plasmid carrying the Cre recombinase
gene resulting in excision of the loxP-flanked gene from the plant genome. The marker-
free transgenic plants are produced and the ones without the Cre recombinase gene are
selected.
iii) Factors affecting the efficiency of A. tumefaciens-mediated plant
transformation
Agrobacterium tumefaciens-mediated plant transformation is a complicated process
involving interactions between the bacteria and plant cells. Establishment of an
efficient DNA delivery system, stable integration and expression of novel genes in plant
cells depends on the types and developmental stages of the tissues, the composition of
the medium and plant hormone used, plant genotypes, A. tumefaciens strains and
density, the co-cultivation period, selection agents, plant wounding methods, the
addition of phenolic compounds, temperature, selection system, and vector constructs.
Some of them are detailed here.
a) A. tumefaciens strains
Strains of A. tumefaciens used in plant transformation are defined by their chromosomal
background and resident Ti plasmid (Hellens et al. 2000) as shown in Table 1.2. The
ability of A. tumefaciens strains to infect and undergo plant genetic transformation is
host genotype dependent. Wide-host-range (WHR) strains were reported to infect most
of the 93 families of plants tested, whereas the limited-host-range (LHR) infected only a
few families (Hansen and Chilton 1999). As more virulent strains are discovered and
more disarmed Ti plasmids are modified to boost virulence, host ranges have expanded.
The strains EHA101 and EHA105, modified from the hypervirulent strain A281 with a
high level of virG expression, has made A. tumefaciens-mediated transformation of
recalcitrant plants such as monocots, legumes and conifers possible (Rashid et al. 1996;
Saalbach et al. 1994; Humara et al. 1999).
In spite of improvements in A. tumefaciens strains, development of an efficient
transformation protocol for a new target plant species still involves the optimisation of
many parameters, including strain type. For example, strain EHA105 gave better
transformation efficiency than strain LBA4404 in blueberry (Cao et al. 1998), but
LBA4404 gave higher gene transfer efficiency than EHA105 in Brassica rapa
(Kuvshinov et al. 1999).
27
Table 1.2 Some commonly used A. tumefaciens strains and their disarmed Ti plasmids
(Hellens et al. 2000).
A. tumefaciens
strain
Chromosomal Ti plasmid
Opine type Reference Background
Marker
gene
Plasmid
name
Marker
gene
LBA4404
GV2260
C58C1
GV3100
A136
GV3101
GV3850
GV3101::pMP90
GV3101::
pMP90RK
EHA101
EHA105
AGL-1
TiAch5
C58
C58
C58
C58
C58
C58
C58
C58
C58
C58
C58, RecA
rif
rif
-
-
rif, nal
rif
rif
rif
rif
rif
rif
rif, carb
pAL4404
pGV2260
(pTiB6S3T-
DNA)
Cured
Cured
Cured
Cured
PGV3850
(pTiC58onc.
gene)
pMP90
(pTiC58T-
DNA)
pMP90RK
(pTiC58T-
DNA)
pEHA101
(pTiBo542T
-DNA)
pEHA105
(pTiBo542T
-DNA)
pTiBo542T-
DNA)
spec, step
carb
-
-
-
-
carb
gent
gent and
kan
kan
-
-
Octopine
Octopine
Nopaline
Nopaline
Nopaline
Nopaline
Nopaline
Nopaline
Nopaline
Nopaline
Succinamopine
Succinamopine
Hoekema et al.
(1983)
McBride and
Summerfelt (1990)
Deblaere (1985)
Holsters (1980)
Watson (1975)
Holsters (1980)
Zambryski (1983)
Koncz and Schell
(1986)
Koncz and Schell
(1986)
Hood (1986)
Hood et al. (1993)
Lazo (1991)
Abbreviations: rif, rifampicin resistance; gent, gentamicin resistance; nal, nalidixic acid resistance; kan, kanamycin resistance gene
for bacteria (nptI or nptIII); carb, carbenicillin and ampicillin resistance; spec and strep, spectinomycin and streptomycin resistance;
–, no marker gene present.
28
b) Wounding methods
As described above, wounded plants produce the compounds acetosyringone and sugars
that activate virulence genes involved in the gene transfer process by A. tumefaciens.
Furthermore, wounds provide access for A. tumefaciens invasion. Therefore a variety of
wounding methods have been developed to enhance efficiency of A. tumefaciens-
mediated transformation.
Sonication-assisted A. tumefaciens-mediated transformation (SAAT)
Explants used in transformation are wounded by ultrasound to produce large numbers of
microwounds while they are immersed in A. tumefaciens suspension. Sonication was an
early method used to deliver of naked DNA into tobacco protoplasts (Joersbo and
Brunstedt 1992) and seedlings (Zhang et al. 1991). Trick and Finer (1998) used SAAT
with embryogenic suspension cultures of soybean. The size of the SAAT-induced
micro-wounds was reported to range from less than 1 m to over 1 mm. Transgenic
soybean plants (T0) were obtained via this method but they were infertile and were not
able to produce T1 progeny. Although long-term passage of embryogenic suspensions
in culture was suggested as causing loss of fertility in T0 plants, tissue damage caused
by sonication resulting in a decrease in tissue growth was reported. In addition, SAAT
significantly decreased the number of regenerating shoots from soybean cotyledonary
node cultures (Meurer et al. 1998). Plants transformed by this method included
Verbascum xanthophoeniceum (Georgiev et al. 2011), Dendrobium orchids (Zheng et
al. 2011), and chickpea (Pathak and Hamzah 2008).
Shaking with glass beads
This method was developed by Grayburn et al. (1995) to wound young sunflower
seedlings by shaking with glass beads (425–600 m diameter) for 50 seconds before
cultivation in a A. tumefaciens suspension culture for 30–60 minutes. Second
generation transgenic sunflower plants were obtained.
Stab-inoculation
The target tissues (usually apical meristem of embryo axes) are stabbed with a fine
needle (30 G) coated with A. tumefaciens suspension 5 – 15 times to infect the inner cell
layers (L2 and L3). These tissues give rise to further organs including inflorescences on
the fully grown plant (Irish 1991). The chimeric T0 plants are recovered and transgenic
T1 seeds can be produced from transgenic sectors with inflorescenses. This method has
been used successfully to transform peas (Pisum sativum, Davies et al. 1993), narrow-
29
leafed lupins (L. augustifolius, Pigeaire et al. 1997), and yellow lupins (L. luteus, Li et
al. 2000).
Particle bombardment
Particle bombardment is a direct gene transfer technique used to deliver naked DNA
within cells. However, it can also be used to generate wounds so that A. tumefaciens
can gain access to cells, thereby increasing transformation efficiency. Bidney and co-
workers (Bidney et al. 1992) bombarded tobacco leaves and sunflower apical meristems
with 1.8 m diameter tungsten particles as a method of wounding and compared gene
transfer efficiency with scalpel wounding prior to A. tumefaciens co-cultivation. An
enhancement of transformation frequency was reported in both species. Similarly,
success has been repeated with carnation (Zuker et al. 1999), sunflower (Lucas et al.
2000), and gladiolus (Babu and Chawla 2000) but not in the interspecific cross of
grapevine (Mozsar et al. 1998).
Later a method named Agrolistics was developed where the plasmid DNA, together
with plant-expressible forms of virD1 and virD2 were co-delivered to tobacco cells
using a biolistic device, together with the plasmid carrying a selectable marker and gene
of interest flanked by left and righ border sequences. The generation of T-DNA in
planta was created by transient expression of VirD1 and VirD2 proteins (Hansen and
Chilton 1996) and transformation efficiency was enhanced.
Another modification has been reported, in which gold particles were coated with A.
tumefaciens cells and then bombarded into strawberry leaves (de Mesa et al. 2000).
This increased transformation efficiency several fold over the standard wounding
method used.
1.2.2 Direct gene transfer systems
Direct gene transfer methods were developed as researchers attempted to overcome the
recalcitrance of some plant species to A. tumefaciens-mediated transformation and to
avoid patents relating to standard A. tumefaciens transformation. Potrykus et al. (1990)
conducted a series of experiments to determine the limiting events in gene transfer
through plant cell walls and came to conclusion that:
a) the uptake of DNA across cell walls is a very rare event
b) the majority of DNA molecules applied will attach to cell walls before they have
a chance to enter the cells
c) each subsequent cell wall will reduce the chance of further penetration
30
d) DNA does not normally move from cell to cell, thus the competent cells must be
available at the site of transformation events.
By taking these factors into account the methods by which genes are delivered directly
into the cell attempts to overcome the “barriers” posed by plant cell walls.
Direct gene transfer includes the methods of macroinjection, microinjection,
microlasers, electrophoresis, electroporation, silicon carbide whiskers, and biolistic
(microprojectile bombardment). With the exception of biolistics, most of these
techniques have not been widely implemented. The main reason for this is that the
transformation efficiency is low or that the method cannot be applied to a wider cross-
section of species.
i) Macroinjection
In this method, an injection needle with a diameter far wider than the diameter of a cell
is used to deliver DNA into wound sites within plant tissues. To achieve successful
transformation, the DNA has to enter more responsive wounded cells. De la Pena et al.
(1987) used this method to transform the immature floral meristems of rye by
macroinjection of plasmid DNA and T1 transgenic plants were confirmed by Southern
blot. However, apart from this example, there are no other reports of successful
transformation using this method (Potrykus 1990). This method was later modified to
achieve A. tumefaciens-mediated transformation by “stab-inoculation”.
ii) Microinjection
The genes of interest are injected into single cell through a very fine microcapillary
using a micromanipulator under microscopical control. For successful transformation,
the DNA should be delivered to the nucleus. This method has been used mainly with
plant protoplasts (Kost et al. 1995; Holm et al. 2000) but there are reports that describe
its application to whole cells (Neuhaus et al. 1987; Pónya et al. 1999). Microinjection is
both time consuming and inefficient compared with most other approaches.
iii) Laser microbeam
In this method, a laser with a beam of less than 1 m diameter is used to cut openings
into walls of cells placed in a hypertonic buffer for a very short time (a few seconds per
laser shot). The pressure gradient (differential pressure generated between the inside
and outside of cell) facilitates the uptake of foreign DNA into a cell after the laser pulse
is delivered and temporarily opens a hole in the plasma membrane. Successful delivery
of plasmids carrying the gus reporter gene into hypocotyl cells and pollen grains of
Brassica napus by this method was reported (Weber et al. 1988a; Weber et al. 1988b).
31
More recently this method has been used as a means of wounding before A.
tumefaciens-mediated transformation (Zhang et al. 1999).
iv) Electrophoresis
A special electrophoresis chamber was designed by Ahokas (1989) with a pipette
containing plasmids carrying gus as reporter gene connected to the cathode and another
pipette containing buffer connected to the anode. A barley embryo was punctured with
the cathode pipette while a basal portion of the embryo was attached to the anode
pipette. GUS-positive results were obtained. Griesbach and Hammond (1993) reported
that orchid embryos were also transformed by this method and transformation was
confirmed by PCR on T1 seedlings.
v) Electroporation
In this method, the foreign DNA is electrically transferred into either protoplasts,
partially digested cells, intact cells or tissues. An electric pulse released from a
capacitor passes across a cell population leading to transient openings in the plasma
membrane while cells are immersed in DNA solution. Several plant species are
reported to have been transformed by this approach, including maize (Zea mays,
Pescitelli and Sukhapinda 1995) and sugarcane (Arencibia et al. 1995).
vi) Silicon carbide fiber (whisker)-mediated transformation
Microscopic needle-like silicon carbide whiskers (approximately 0.6 m in diameter
and 5-80 m in length) are shaken with plant cells or tissues together with DNA of the
gene of interest, either by vortex mixer or shaker. Damage by the whiskers creates
small openings in plant cell walls and membranes and provides an opportunity for
foreign DNA to enter the damaged plant cells. This method has been used to transform
monocot plants that are recalcitrant to A. tumefaciens-mediated transformation such as
Zea mays (Kaeppler et al. 1990; Frame et al. 1994; Petolino et al. 2000); Lolium
multiflorum, L. perenne, Festuca arundinacea, Agrostis stolonifera (Dalton et al. 1997);
Oryza sativa (Nagatani et al. 1997); Triticum aestivum (Serik et al. 1996), and the dicot
Nicotiana tabacum (Kaeppler et al. 1992).
vii) Particle bombardment transformation (Biolistics)
Particle bombardment transformation utilises fine particles of heavy metal such as
tungsten or gold, coated with DNA and accelerated by different methods into the target
tissues. This method was originally developed from the technique that plant virologist
used to infect plants with viruses using high velocity particles to wound plant tissues
and enable entry of viral particles or nucleic acids (MacKenzie et al. 1966). Sanford
32
and co-workers (Sanford et al. 1987) developed the first device that was able to
accelerate tungsten particles coated with TMV-RNA sufficiently to penetrate onion
epidermal cells, and named this method “biolistics” (Sanford 1988). Since then it has
been used widely to transform more than 30 plant species (Birch and Bower 1994)
including monocot and dicot plants that are recalcitrant to A. tumefaciens-mediated
transformation or regeneration from protoplasts. Details of principles involved and
factors influencing the success of using particle bombardment to transform plants will
be discussed in more detail in the chapter devoted to experiments on particle
bombardment transformation of lupins.
viii) Poly (amidoamine) dendrimer for direct DNA delivery to plant cells
Dendrimers are nano-sized polymer particles with a highly symmetric structure. They
possess a central core, and generations (layers) of branches stemming from the central
core, using stepwise chemistry (Helms and Meijer 2006). These particles have a
hydrophobic interior and hydrophilic exterior that enables the encapsulation of
amphiphilic ‘guest’ molecules such as nucleic acid and proteins. This property has also
attracted the development of dendrimer as a vector in drug delivery (Svenson 2009).
Poly-amidoamine (PAMAM) dendrimers have been trialed as a vector for direct gene
transfer to plant cells (Pasupathy et al. 2008). Callus cells of creeping bentgrass
(Agrostis stolonifera L., cv. Penn-A-4) initiated from mature seeds were incubated with
PAMAM-DNA complexes containing a plant expression vector harbouring gfp with a
constitutive promoter on a shaker for 3 days. The green fluorescence of GFP was
observed inside plant cells by confocal microscope, which shows that dendrimers can
deliver DNA into cells across plant cell walls.
1.3 Legume transformation
The Leguminosae is a large and diverse family ranging from herbaceous annuals to
woody perennials. The aims of transformation of legumes are both to improve
economic traits and to understand their biology through functional genomic studies. To
date many legume crop species have been transformed (reviewed by Somers et al. 2003
and Eapen 2008) as shown in Table 1.3. Although highly efficient transformation
systems have been achieved in some legumes, especially forage species such as
Medicago truncatula (more than 20%, Chabaud et al. 2003), the majority of transgenic
legumes are still generated using transformation protocols based on tissue culture
33
methods that are genotype-independent, time-consuming and laborious. One paper
reported a highly efficient in planta transformation method for M. truncatula (Trieu et
al. 2000), however it has since become clear that the reported efficiency cannot be
repeated either by the original authors or by other research groups (Somers et al. 2003).
An efficient transformation system for legumes without tissue culture would be a great
advance toward routine generation of transgenic plants, and for studies on functional
genomics.
34
Table 1.3 Summary of transgenic legumes and their methods of generation (Somers et
al. 2003 and Eapen 2008).
Species, Genotype DNA Delivery Explant
Selection
Citation
Marker Agent
Pasture and forage species
Chinese milk vetch
(Astragalus sinicus)
Japan Bird’s foot trefoil
(Lotus corniculatus)
L. japonicus Gifu
Barrel medic
(Medicago truncatula)
R108-1
R108-1 (C3)
R108-1 (C3), Jemalong
J5
R108-1 (C3)
Jemalong
Ar (DC-AR2)
At (LBA4404)
At (LBA4404,
C58C1, GV2260)
Ar (9402,
AR10)
At (AGL1)
At (A281,GV2260)
At (EHA105,
GV3101)
At (EHA105)
At (EHA105)
At (LBA4404)
At (EHA105, ASE1,
GV3101)
Seedlings (O)
Leaves (O)
Hypocotyls (O)
Seedlings (O)
Hypocotyls(O)
Leaves (E)
Leaves (E)
Floral organs
(E)
Leaves
Cotyledons (O)
Flowers,
seedlings
nptII
aphIV
nptII, hpt
nptII,
bar
nptII, hph
nptII, hph
nptII
bar, nptII
bar
bar
Kan
Hyg
Kan, Hyg
Kan
Phosphino
thricin (PPT)
Kan, Hyg
Kan, Hyg
Kan
PPT, Kan
PPT
PPT
Cho et al. (1998)
Webb et al. (1996)
Handberg and
Stougaard (1992)
Stiller et al. (1997)
Lohar et al. (2001)
Hoffmann et al.
(1997)
Trinh et al. (1998)
Kamate et al.
(2000)
Scholte et al.
(2002)
Trieu and Harrison
(1996)
Trieu et al. (2000)
White clover (Trifolium
repens)
Red clover (Trifolium
pretense) NEWRC
germplasm
At (LBA4404,
GV3850)
At (EHA101, A208)
Internodes (O)
Petiole pieces
(O)
nptII
nptII
Kan
Kan
Derek et al. (1987)
Sullivan and
Quesenberry
(2006)
Grains, pulses and other
seed crops
Peanut
(Arachis hypogaea)
Florunner/MARC-
1/Georgia Runner
MB
Embryogenic
cultures (E)
hph
Hyg
Wang et al. (1998)
Gajah and NC-7 MB Somatic
embryos (E)
hph Hyg Livingstone and
Birch (1999)
AT120/ VC1 MB Embryogenic
cultures (E)
hph Hyg Magbanua et al.
(2000)
JL-24 At (C58) Cotyledons (O) nptII Kan Sharma and
Anjaiah (2000)
TMV-2 At (LBA4404) Embryo axes
non-tissue
culture
gusA Visual Rohini and Rao
(2000)
Pigeon pea (Cajanus cajan L.
Millsp.)
N
Hyderabad
At (GV2260)
At (EHA105)
Embryonic axes
(O, C)
Embryo axes
and
cotyledonary
nodes (O)
nptII
nptII
Kan
Kan
Lawrence et al.
(2001)
Satyavathi et al.
(2003)
Chickpea
(Cicer arietinum)
PG1/PG12/Chafa/
Turkey
At (C58C1/
EHA101)
Embryonic axes
(O)
pat, nptII PPT, Kan Krishnamurthy et
al. (2000)
35
Species, Genotype DNA Delivery Explant Selection
Citation Marker Agent
Guar (Cyamopsis
tetragonoloba) Lewis/
Santa Cruz
At (LBA4404)
Cotyledons
(O)
nptII
Kan
Joersbo et al.
(1999)
Soyabean
Jack MB Immature
embryos (E)
hph Hyg Santarem and
Finer (1999)
A3237 At (EHA101, 105) Cotyledonary
node (O)
bar PPT Zhang et al. (1999)
Jack At (EHA105) Cotyledonary
node (O)
hpt Hyg Yan et al. (2000)
BR-16/DokoPC/
BR-19/Conquista
MB Embryonic axis
(O)
ahas imazapyr Aragao et al.
(2000)
Bert At (EHA101) Cotyledonary
node (O)
hph Hyg Olhoft et al.
(2003)
Lentil (Lens culinaris
Medik)
Laird/CDC599-23 MB Cotyledonary
node (O)
als Chlorsul
-furon
Gulati, Schryer,
and McHughen
(2002)
Lupin
(Lupinus angustifolius)
Unicrop/Merrit
At (AGLO)
Axillary shoot
embryonic axis
(O)
bar
PPT
Pigeaire et al.
(1997)
Yellow lupin
(Lupinus luteus)
Woodjil/Popiel/
Teo/Juno
At (AGLO) Apical
meristem
(O)
bar PPT Li et al. (2000)
Tepary bean
(Phaseolus acutifolius
A. Gray)
NI576 At (C58C1RifR) Bud explants
(O, C)
nptII G418 De Clercq et al.
(2002)
Bean
(Phaseolus vulgaris)
Olathe/Carioca MB Embryonic axes
(O)
bar PTT Aragao FJL et al.
(2002)
Pea (Pisum sativum)
94-A26/Bolero/
Hadlee/Crown/
Courier/89T46.UK
At (AGL1) Immature
cotyledons (O)
nptII Kan Grant et al. (1998)
Laser, Heiga At (EHA105,
C58C1/LBA4404)
Cotyledons (O) nptII,
bar
Kan,
PTT
Nadolska-Orczyk
and Orczyk (2000)
Greenfeast/
CDC Vienna/
S2-90-25E/93-4-
18G/MP1338/
MP1382/AWPNZ66/
AWP1512
At (EHA105)
Embryonic axis
(O)
bar, nptII
PPT, Hyg
Polowick et al.
(2000)
Faba bean (Vicia faba)
Mythos
At (EHA101,105)
Epicotyls (O,C)
nptII
Kan
Bottinger et al.
(2001)
Internodal stem,
Narbon bean
(Vicia narbonensis)
Var. narbonensis
At (EHA101)
epicotyls and
shoot tips (E)
nptII G418 Czihal et al.
(1999)
Moth bean
(Vigna aconitifolia)
At
Protoplasts
nptII
Kan
Eapen et al. (1987)
Azuki bean
(Vigna angularis Willd.
Ohwi/Ohashi)
Beni-dainagon
At (EHA105)
Elongated
epicotyls (O,C)
nptII
Kan
Yamada et al.
(2001)
Black mung bean
(Vigna mungo)
At
Cotyledonary
nodes
nptII
Kan
Saini et al. (2003)
36
Species, Genotype DNA Delivery Explant Selection
Citation Marker Agent
Mung bean
(Vigna radiate L. Wilczek)
K-851
N
At (LBA4404)
At (EHA 105)
Cotyledonary
node (O)
Cotyledonary
node (O)
nptII
bar
Kan
PTT
Jaiwal et al. (2001)
Sonia et al. (2007)
Asparagus bean
(Vigna sesquipedalis)
Koern
At (EHA101)
Cotyledonary
node (O)
bar, nptII
PPT,
Kan
Ignacimuthu et al.
(2000)
Indian cowpea
(Vigna unguiculata L. Walp)
At (EHA 105) Cotyledonary
node
nptII Kan Chaudhury et al.
(2007)
Poison bean
(Sesbania drummondii
(Rydb.) Cory)
At (EHA101)
Cotyledonary
node
hptII
Hyg
Padmanabhan and
Sahi (2009)
Stylo
(Stylosanthes guianensis)
CIAT 184
At (LBA4404)
Leaf (O)
nptII
Kan
Segenet et al.
(2005)
Tree species
Acacia mangium
N
At (LBA4404)
Rejuvenated
shoots (O)
nptII
G418
Xie and Hong
(2002)
Acacia sinuata At (EHA105) Hypocotyls bar PPT Vengadesan et al.
(2006)
Black locust
(Robinia pseudoacacia)
N
At (AGL1)
Cotyledon (O)
bar
PPT
Zaragozá et al.
(2004)
N At (GV3101) Stem and leaf
segments (O)
hpt Hyg Igasaki et al.
(2000)
N, Not identified; At, A. tumefaciens; Ar, A. rhizogenes; MB, microprojectile
bombardment. A. tumefaciens strain and tissue culture type: O, organogenesis; E,
embryogenesis; and C, callus are indicated in parentheses.
1.4 Lupin genetic transformation
Genetic engineering has advantages over traditional breeding to produce new elite
cultivars, especially, if a key prerequisite of successful traditional plant breeding which
is the availability of genetic diversity does not exist. And when the traditional crossing
is limited by sexual incompatability of many interspecific and intergeneric crosses.
Genetic engineering provides a substantially broadened gene pool by allowing gene
transfer between unrelated species and even different organisms (De Block, 1993).
Furthermore, it potentially reduces long period required for traditional breeding
programs.
37
Lupin production in Australia especially in Western Australia has been declined
significantly in the recent decade, two principal factors in this decline are pest and
disease, and herbicide resistant weeds in lupins (Agtrans Research, 2012). In narrow-
leafed lupin, genetic manipulation works had been cerried out towards adding
agronomic traits that do not exist in narrow-leafed lupin germplasm such as the virus
resistance (Bean Yellow Mosaic Virus (BYMV) and Cucumber Mosaic Virus (CMV),
Wylie et al. (1998)), necrotrophic fungal resistance (Wijayanto et al., 2009), herbicide
tolerance (Basta®, Pigeaire et al. (1997)) and the value-added trait such as improved
protein quality and content by adding sunflower seed albumin gene (Molvig et al.,
1997). The transformation protocol used in these works was based on Pigeaire et al.
(1997) method which is inoculating A. tumefaciens suspension while stabbing apical
area of lupin cotyledons with fine needle. The protocol also was used to generate
Basta® tolerlance yellow lupins (L. luteus, Li et al. (2000)). This protocol involved
laborious and time consuming (5-9 months) tissue culture procedure and relatively low
efficiency (0-6%).
1.5 Current status of genetically modified crops in Australia
Since the first fertile transgenic plants were obtained in the 1980s (Horsch et al. 1985),
genetically modified (GM) crops have now been grown commercially on 160 million
hectares in 2011 which accounts for more than 10% of the 1.5 billion ha of the total
agricultural land in the world (James 2011).
GM crops grown in Australia are regulated under the Gene Technology Act 2000 by the
Office of the Gene Technology Regulator (OGTR). Public surveys conducted by
government agency ‘Biotechnology Australia’ showed an increase in public acceptance
of the role GM crops in countering drought and pollution, and acceptance grew from
46% in 2005 to 73% in 2007 (www.gmo-compass.org). From the 2008 season, GM
canola has been commercially grown in New South Wales and Victoria. By 2010, only
South Australia and Tasmania still declare moratorium against growing commercially
GM crops (Cormick 2011). In Western Australia, the ban is still in place but an
exemption order to permit commercial planting of GM canola and GM cotton in WA
has been issued. Approximately 700 ha GM cotton was grown in the Ord River
Irrigation Area in 2011 and about 120,000 ha of GM canola has been grown across the
state in 2012 (www.agric.wa.gov.au).
38
1.6 Future of genetically modified crops
The overall aim of this work was to increase the efficiency of generating transgenic
lupin plants, and to understand the limiting factors involved in the process. Hence, this
is set in context with the current implementation of transgenic crop plants worldwide.
The first transgenic crop grown in Australia was Bt cotton with resistance to caterpillars
of the cotton bollworm (Helicoverpa spp). Bt cotton has been grown since 1996, and
now 95% of the cotton grown in Australia is transgenic.
Bt cotton has been described as a “win-win-win” transgenic plant in the World
Development Report 2008 by the World Bank because it reduces yield losses, increases
farmers profit, and greatly reduces pesticide applications, and is used by millions small
landholders in developing countries. For example, more than nine million small holder
farmers now grow Bt cotton in India and China. The remarkable effectiveness of Bt
cotton is that bollworms have still not developed significant resistance to Bt cotton 17
years since its deployment in 1996. There is a problem of emerging secondary pests
that are not targeted by Bt cotton because no broad-spectrum insecticide is used in Bt
cotton field. However, this is the problem of farm practice, and is not due to the
bollworm developing resistance to Bt cotton (www.news.cornell.edu/stories/ July06/
Bt.cotton.China.ssl.html).
Bt cotton is a good example of the contribution to productivity and sustainability from
GM technology. As the world population reached 7 billion in 2011 and continues to
rapidly expand, the world will require 70% more food by 2050 (ISAAA;
www.ISAAA.org). In developing countries where 2.5 billion small resource-poor
farmers are dependent on agriculture for their livelihood, food production needs to
double by 2050. GM crops have increased productivity and economic benefits
sustainably at the farmer level. During 1996 to 2010, GM/biotech crops generated
economic gains at the farm level of ~US$78 billion globally, of which 40% were due to
reduced production costs and 60% were due to substantial yield gains of 276 million
tons. This saved 91 million hectares of tropical forests from being cleared to grow
conventional crops to produce the same tonnage as GM crops produced (Brookes and
Barfoot 2012). Furthermore, GM crops contribute to reducing the agricultural footprint
(especially reducing pesticide use) and increase efficiency of water usage (drought
tolerant GM corn will be commercialised in the US by 2013 (Brookes and Barfoot
2012).
39
A summary of the current status of GM crops by the International Service for the
Acquisition of Agri-biotech Applications (ISAAA; www.ISAAA.org) reports that the
global area on which GM crops are grown has increased consistently at 10-15%
compound growth per annum since introduction in 1996. In 2011, the area of GM crops
worldwide was 160 million hectares with more than 15 million farmers from 29
countries (19 were developing and 10 were industrial countries) growing GM crops,
with cotton, soybean, corn and canola as the major crops. An additional 31 countries
have granted regulatory approvals for GM crops for food and feed use and for release
into the environment since 1996, including Japan which does not currently plant GM
crops.
In this summary of ISAAA, the outlook for GM crops in the remaining 4 years of the
second decade of commercialisation, 2012 to 2015, is assessed as cautiously optimistic.
And the adaptation of GM crops will be dependent on three factors:
1) The timely implementation of appropriate, responsible and cost/time-effective
regulatory systems.
2) Strong political will and enabling financial and material support.
3) A continuing wave of improved GM/biotech crops that will meet the priorities
of industrial countries and developing countries in Asia, Latin America and
Africa.
By 2015, another 10 countries are likely to adopt biotech crops for the first time, these
include countries in Asia and in sub-Saharan Africa and possibly some additional
countries in Latin/Central America and Western/Eastern Europe. However, Western
Europe is more influenced by ideological views of activist groups against the
consumption of GM food products, issues about GM crops is rather political than
science and technology consideration.
Despite the success of being the fastest adopted crop technology in recent history, input
traits largely benefit farmers rather than directly benefit consumers. There is some
public concern about safety of GM crops, and environmental issues. A consumer
survey in the US showed that 81 percent of consumers would eat vegetables that have
an extra gene from the same vegetable, but only 14 percent of consumers would eat
vegetables with a gene introduced from a virus (Lusk and Sullivan 2002). This public
attention resulted in a new trend for genetically modified crops. Nielsen (2003)
proposed the categorisation (Table 6.1) for genetically modified products based on the
sources of genetic changes introduced, which more accurately reflected its nature than
40
the general term as transgenic or genetic modified based on the process, and believed
that it would help to differentiate the perception of public and increase public
acceptance of the products.
Table 6.1 The proposed categories for organisms currently designated as ‘transgenic’ or
‘genetically modified’ (Nielsen 2003).
Categories Source of genetic modification Genetic variability via
conventional breeding
Genetic
distance
Intragenic
Famigenic
Linegenic
Transgenic
Xenogenic
Within genomea
Species in the same familyb
Species in the same lineagec
Unrelated speciesd
Laboratory designed genese
Possible
Possible
Impossible
Impossible
Impossible
Low
High
aFrom directed mutations or recombinations; the extent of modification also reflects
those arising in classical, selection-based breeding. bTaxonomic family; the extent of modification also reflects those arising from applying
cellular techniques in classical breeding. cPhylogenetic lineage; recombination of genetic material beyond what can be achieved
by classical breeding methods. dContains recombined DNA from unrelated organisms. Reflects the genetic composition
of most GMOs commercialised today. eFor which no naturally evolved genetic counterpart can be found or expected (for
example, synthetic genes and novel combinations of protein domains from various
species).
Rommens et al. (2004) introduced intragenic transformation using plant-derived transfer
DNA fragment (P-DNA) from the genome of sexually compatible potato accessions.
The isolated P-DNA shared most homology with the left border of nopaline strains (21
of 25 bp) and the right border of octopine strains (22 of 25 bp) of A. tumefaciens. The
vector construct contained P-DNA and nptII cassette was used to transform potato and
tobacco with the same construct but with normal T-DNA as control. The results
showed the construct with P-DNA had higher transformation frequency in both plant
species comparing to construct with T-DNA. Rommens further demonstrated the
application of this concept of an all native plant-derived transformation vector to
produce black spot bruise-tolerant potato. He constructed the all potato expression
cassette of polyphenol oxidases (PPOs) in sense and antisense form driven by granule
bound starch synthase (GBSS) promoter and Ubiquitin3 terminator isolated from potato
and placed between P-DNA. The 7 lines of transformed potato that contained silencing
41
construct of PPOs effectively controlled enzymatic browning of harvested mature
potatoes.
As plant genomics and functional genomics research progresses, much more
information is becoming available that will enable plant-derived vectors that could
increase consumer confidence in GM food.
Environmental contamination with transgene mainly through flow of transgenic pollens
is another main concern that has set GM technology back. The likelihood of transgene
escape into the non-GM environment can be reduced by physical containment or genetic
containment (Lee and Natesan 2006). The physical method is to keep transgenic pollen
from physically interacting with compatible non-GM plants by following physical
confinement procedures. Another alternative containment strategy is the use of
molecular strategies to create genetic containment. The molecular strategies are based
on maternal inheritance, male sterility, seed sterility, apomixis (asexual seed formation),
cleistogamy (self-fertilisation within the unopened flower, such as occurs in L.
angustifolius), temporal and tissue-specific control via inducible promoters and
transgenic mitigation (transgenes that compromise the fitness in the hybrid, Daniell et
al. 2002). The most promising approach is probably based on maternal inheritance by
chloroplast (plastid) engineering. Crops that were produced by this approach have
entered field trials and commercial development (Daniell 2007) whereas some other
approaches have drawbacks that make them less commercially viable at present. In
fact, many researches found a low to rare leakage rate of paternal chloroplast genes
inherited to progenies. In tobacco alone leakage rate reported varied from 2.86x10-6
(Ruf et al. 2007) to 0.025 (Medgyesy et al. 1986). To reduce the leakage rate, the use of
two containment strategies for one transgene was suggested. For example, using a
mitigation gene in the chloroplast genome inserted together with the transgene of
interest, then the leakage rate would be less than 10-6. By linking the Bt gene to a
mitigation gene, such as Δgai (encodes a constitutively active repressor protein that
blocks growth stimulation by the hormone gibberellic acid and causes dwarfism in
plants), the average escape time increases from three generations (without mitigation
gene) to more than 25,000 generations for sunflower and at least 3000 generations for
rice (Lee and Natesan 2006).
42
1.7 Aims of project
Lupin transformation is genotype-dependent, reported at the rate of 1-6% of first
generation explants for one genotype when using A. tumefaciens to transform wounded
explants derived from the hypocotyl of germinating seeds (Pigeaire et al. 1997). The
overall aim of this work was to increase the efficiency of generating transgenic lupin
plants, and to understand the limiting factors involved in the process.
The main approaches tested were:
particle bombardment with purified plasmid DNA, and
vacuum-assisted infiltration of lupin flowers and seedlings with A. tumefaciens
cells containing selectable marker genes.
factors limiting efficient transfer of novel genes to lupins were investigated by
comparing a lupin cultivar that showed high transformability with one that was
recalcitrant to transformation.
43
Chapter 2: General materials and methods
2.1 Plant materials
Narrow-leafed lupin (Lupinus angustifolius) cultivars Unicrop, Merrit and Quillinock
were used in all experiments. Seeds were obtained from Bevan Buirchell of Department
of Agriculture and Food, Western Australia (DAFWA) in 2000-2004.
2.1.1 In vitro cultures
In vitro cultures of lupins were grown and maintained in a plant tissue culture room
with a 12 h photoperiod (50 µE m-2 s-1) at 22oC. The basal medium used for lupins
explants was MS (Murashige and Skoog 1962), unless described otherwise. Where
supplements were added, these are detailed in the appropriate Chapter. Explants were
sub-cultured to fresh medium every two weeks.
2.1.2 Lupins in the glasshouse
In the glasshouse, lupins were grown in a sand and rotted bark potting mix at
approximately 22oC daytime temperature. The soil mixture was prepared by mixing 40
L potting mix with 60 g lime, 60 g dolomite and 40 g Yates slow-release NPK fertilizer,
and pasteurized by steam at 90oC for 2 h prior to use.
2.1.3 Surface-sterilisation of seeds
Surface-sterilisation of lupin seeds was carried out by washing with a water based
solution containing 1.25% (w/v) NaOCl with a few drops of Tween 80 in water, shaking
thoroughly for 10 min then repeating with a fresh solution for another 5 min. The seeds
were washed four times for 3 min each with sterile water and were ready for
germination or storage in a sterile container at room temperature after drying in a
laminar flow cabinet.
2.1.4 Embryonic axes isolation
Lupins seeds were surface-sterilised (2.1.3) and imbibed overnight with sterile distilled
water (~20 mL per Petri dish containing ~30 seeds). The seed coat was peeled off and
the cotyledons removed from the embryonic axis by forceps. The isolated embryonic
axis was kept moist on wet sterile filter paper in a covered plate until ready for use.
44
2.2 A. tumefaciens
Agrobacterium tumefaciens strain AGLO (An et al. 1985) was used because of its
reported relatively higher efficiency in transformation of narrow-leafed lupins
(Hoffmann 1999; Li et al. 2000). The strain carries a non-oncogenic pTiBo542 as the
helper plasmid which allows AGLO to transform some higher plants 10 X more
efficiently than most other Ti plasmids.
2.2.1 Storage
The A. tumefaciens cultures were stored in 15% (v/v) glycerol at -80oC. The stock was
made by mixing bacterial culture grown overnight (OD600 ~1.2-1.7) in LB medium (10
g NaCl, 10 g Bacto tryptone and 5 g yeast extract in 1 L water, pH 7) with 30% (v/v)
sterile glycerol solution in ratio of 1:1, the bacteria were then snap-frozen in liquid
nitrogen and stored at -80oC.
2.2.2 Inoculum preparation
The inoculum of A. tumefaciens cells was cultured by first streaking frozen cells from a
glycerol stock onto an LB medium agar plate containing 20 mg/L rifampicin (for
stabilising the Ti plasmid) and the appropriate antibiotic according to the selectable
marker gene in the binary plasmid in the bacteria, and then incubated at 28oC overnight.
A colony of bacteria was transferred to a 5 mL liquid LB medium containing the same
antibiotics and shaken at 220 rpm at 28oC overnight. Agar plate cultures were sealed
with Parafilm, kept at 4oC and subcultured every month.
2.2.3 Preparation of Electro-Competent cells
A colony of A. tumefaciens from culture grown on LB agar plate containing 20 mg/L
rifampicin was inoculated into 5 mL of LB medium containing the same antibiotic and
grown overnight at 28oC, 220 rpm. One mL of the culture was added to 100 mL of
modified LB medium (1 g NaCl, 10 g Bacto tryptone and 5 g yeast extract in water to 1
L, pH 7) and grown under the same conditions until the culture reached an OD600 of 0.4-
0.5. Cells were chilled on ice for 1 h and centrifuged at 2795 x g (10 cm rotor radius)
for 10 min at 4oC. The pellet was then washed three times with cold 10% (v/v) glycerol
by gentle resuspension and centrifugation. The volume of 10% (v/v) glycerol added to
45
resuspend the cells was reduced each time from 100 mL to 50 mL, to 2 mL and finally
cells were resuspended in 1 mL. Aliquots of 100 μL of cell suspension were snap
frozen in liquid nitrogen and stored at -80oC.
2.2.4 Electroporation of electro-competent A. tumefaciens cells
To transfer purified plasmid DNA into A. tumefaciens cells, electro-competent cells
were taken from -86oC storage and slowly thawed on ice. A 50 μL aliquot of cells was
mixed gently with 1 μL of plasmid DNA (suspended in pure water) containing 1-10 ng
of DNA and left on ice for 1-2 min. The mixture was pipetted into a chilled 0.1 cm
electroporation cuvette (Bio-Rad) and tapped few times to ensure that the cells were at
the bottom of cuvette before placing it into a Bio-Rad Gene Pulser™. Electroporation
was performed at 1.8 kV, 2.5 µFD and 200 Ω for one pulse. One mL of LB medium
was added to the cuvette immediately after electroporation and the mixture was gently
transferred into a 10 mL sterile tube and incubated on its side at 28oC for 1 h on a rotary
shaker set at 220 rpm. The cells were recovered by centrifugation at 2795 x g (10 cm
rotor radius) for 30 s. The pellet was resuspended in 100 µL of LB medium before
being spread onto an LB agar plate containing the appropriate antibiotic. The culture
grew in an incubator set to 28oC until the colonies became visible (2-3 days).
2.2.5 A. tumefaciens culture preparation for plant transformation
Solutions
Modified LB medium
Bacto tryptone 10 g/L
NaCl 1 g/L
Bacto yeast extract 5 g/L
10 mM filtered sterile glucose (added after medium autoclaved)
Adjusted to pH 7 and autoclaved 20 min.
MGL medium
Mannitol 5 g/L L-Glutamic acid 1 g/L
KH2PO4 0.25 g/L NaCl 0.1 g/L
MgSO4.7H20 0.1 g/L Biotin (0.001g/10mL) 10 µL/L
Tryptone 5 g/L Yeast extract 2.5 g/L
Adjusted to pH 7 and autoclaved 20 min.
Acetosyringone and D-glucose solution
46
-20 µM Acetosyringone (or 3,5-dimethoxy-4-hydroxyacetophenone- prepared as
100 mM stock by dissolving 0.196 g in 100 µL DMSO then made up to 10 mL with
distilled water, filtered sterile and stored at 4oC)
-10 mM D-glucose (prepared as 1 M stock, filtered sterile and stored at 4oC)
-MS salts (1 sachet, 4.4 g) MS salts (Sigma) dissolved in 1 L distilled water,
adjusted to pH 5.7 and autoclaved 20 min)
To induce virulence of A. tumefaciens cells, two main methods were used, and
modifications to these are discussed in respective Chapters.
A. tumefaciens induction method I
This method was based on that of Li et al. (2000) and Hoffmann (1999). A loop of A.
tumefaciens cells from solid agar culture prepared as described in 2.2.2 was resuspended
in 10 mL of modified LB medium with appropriate antibiotics. The bacteria were
incubated on a shaker (220 ppm) overnight at 28oC. Then, 100µL of the culture was
added to 10 mL of fresh medium with 100 µM acetosyringone and no antibiotics and
incubated on a shaker until the OD600 had reached 0.4-0.5. The cells were then ready to
use in the transformation procedure.
A. tumefaciens induction method II
The second method was based on that of Pigeaire et al. (1997). The inoculum was
prepared by resuspending a loop of A. tumefaciens cells from solid agar (MGL medium)
culture prepared as described in 2.2.2 in 5 mL of MGL medium with appropriate
antibiotics and incubated on a shaker (220 ppm) overnight at 28oC. Then 1 mL of
inoculum was added to 10 mL of fresh MGL medium with antibiotics and incubated on
a shaker (220 ppm) at 28oC until the OD550 reached 0.4-0.8 (about 4-6 h). To induce
virulence of A. tumefaciens cells, the amount of inoculum to make up 5x108 cells/mL
culture (prepared by adding 462 µL of the inoculum read at 0.5 OD550 to make up 1 mL
of culture) was spun down and resuspended in acetosyringone and D-glucose solution
and ready to use in the transformation procedure.
2.3 Plant expression vectors
Plant expression vectors used herein were binary vector constructs harbouring a
selectable marker gene and a reporter gene under a CaMV35S promoter for constitutive
expression, and nos or ocs terminators.
pCAMBIA3201
47
The vector pCAMBIA3201 was obtained under licence from the Centre for Applied
Molecular Biology in Agriculture (CAMBIA), Canberra. It carried a bar gene as a
selectable marker gene and the gus gene with a chloramphenicol acetyl transferase
(CAT) intron inserted as a reporter gene. The intron prevented the gus gene from
expressing within prokaryotic (eg. A. tumefaciens) cells.
pCGP1258
The vector pCGP1258 was obtained from Dr Penny Smith (Department of Botany,
University of Western Australia). It harbours bar and gus genes and lacks an intron
inserted in gus sequence. Unlike pCAMBIA3201, GUS is expressed strongly in
bacterial cells and therefore it can be used to locate A. tumefaciens cells in plant tissues.
2.4 Plant DNA extraction
Two methods were used to extract total plant DNA: a miniprep method and the Easy
DNA High Speed Extraction method developed by Centre for High-throughput
Agricultural Genetic Analysis (CHAGA), Murdoch University, Western Australia.
DNA extracted by the former method was used for both PCR and Southern blot analysis
whereas DNA extracted from the latter method was used for PCR analysis only.
2.4.1 Miniprep method
Solutions
DNA extraction buffer
4% (w/v) Sarkosyl
100 mM Tris-HCl
100 mM NaCl
10 mM EDTA
pH 8.5
Phenol/ chloroform/ isoamyl alcohol at 25:24:1 (Sigma)
Chloroform/ isoamyl alcohol at 49:1
3 M Sodium acetate pH 5.2
Dissolved 246.09 g of sodium acetate∙ in 800 mL water, adjusted pH to
5.2 with glacial acetic acid and made up volume to 1 L.
R40
48
Dissolved 40 μg/mL RNAse A in water, made to aliquots of 0.1 mL and
kept at -20oC.
Two young leaflets (approx 50 mg) from lupin plants were collected and placed in a 1.5
mL Eppendorf tube. Leaves were crushed with a micro pestle to a fine powder after
they were snap frozen in liquid nitrogen. 600 μL of DNA extraction buffer was added
and the material homogenized before adding 600 μL phenol/ chloroform/ isoamyl
alcohol and extracted 5 min or alternately shaken vigorously by hand for 20-30 s. The
tube was placed in a rack for partial phase separation before centrifuged for 5 min. The
upper aqueous phase was transferred to a new 1.5 mL centrifuge tube by pipetting, and
the extraction was repeated once more with phenol/ chloroform/ isoamyl alcohol as
above and then further extracted with 600 μL of chloroform/ isoamyl alcohol to remove
traces of phenol. To precipitate DNA from the extract, 75 μL of 3 M sodium acetate pH
5.2 and 600 μL isopropanol was added, the solution was mixed thoroughly by inverting
the capped tube and allowed the precipitation to occur at room temperature for one min.
DNA was pelleted by centrifuging for 10 min at 4oC, supernatant was poured off
without dislodging the pellet. One mL of 70% ethanol was added to wash the pellet by
gently inverting the capped tube. Then the supernatant was discarded and the pellet was
dried under vacuum. To remove RNA, the pellet was resuspended in 50 μL of R40
solution and incubated at 4oC overnight.
2.4.2 Easy DNA High Speed Extraction method (for plant materials)
A 5 mm diameter disc of lupin leaf was placed in a 1.5 mL centrifuge tube together with
a 1/8 inch stainless steel ball with 64 μL of solution 1A and 16 μL of solution 1B
(solution 1A and 1B provided in the kit). The tube was shaken in a GenoGrinder set to
500 rpm for 30 s. Twenty μL of solution 2 was added and mixed after the tube was
incubated at 95oC for 10 min. The DNA was now ready for PCR or storage at -20oC.
2.5 Analysis of transgenic plant material
2.5.1 Spraying with Phosphinothricin
Putative transgenic seeds were collected and grown in a 96-well tray in a glasshouse.
The seedlings were sprayed with the herbicide Phosphinothricin (PPT) solution, the
active ingredient of the herbicide BASTA, when they were 2-3 weeks old for primary
screening of expression of the bar gene. The bar gene encodes phosphinothricin
49
acetyltransferase (PAT), an enzyme that acetylates the free NH2 group of PPT,
preventing PPT causing ammonia accumulation in transformed plants (De Block et al.
1987). The PPT solution contained 80 mg/L PPT (Basta ®, AgrEvo) and 0.02% Silwet-
77 in water. Dried burnt leaves caused by herbicide susceptibility were apparent 2-3
days after spraying. The survivors were repotted and grown for further analysis to
confirm the presence of transgenes.
2.5.2 Polymerase chain reaction
Polymerase chain reaction (PCR) was used to identify the presence of transgenes in
plant genomic DNA and to detect contamination in plant DNA by A. tumefaciens DNA.
In this work, the bar gene, the gus gene, the 35sCaMV promoter, all located within the
T-DNA, and the picA and the virA genes located within the Ti plasmid (and therefore
not transferred to the plant genome), were the targets for PCR amplification. Their
primer sequences are shown in Figure 2.1.
Target Name Sequence (5'>3')
bar gene Shbar1 TCTGCACCATCGTCAACCAC
Shbar1R ACTTCAGCAGGTGGGTGT
gus gene GUSintL CTGATAGCGCGTGACAAAAA
GUSintR GGCACAGCACATCAAAGAGA
picA gene PicA1 ATGCGCATGAGGCTCGTCTTCGAG
PicA2 GACGCAACGCATCCTCGATCAGCT
virA gene VirA1 TCTACGGTCATGGTCCACTAGACG
VirA2 TGCTGCTCAACTGCTACGCCAGCT
35sCaMV 35S-CRM CGTCAGTGGAGATATCACATCAA
promoter 35S1b AAGACCAAAGGGCTATTGAGAC
Figure 2.1 Sequences of oligonucleotide primers used for transgenic plant analysis.
PCR was done in 0.2 mL tubes (Treff) with a Perkin Elmer PCR System 2400 Thermal
Cycler. The reagents used were DNA polymerase (Tth+ or Taq), 5x DNA
polymerisation buffer containing dNTPs and 25 mM MgCl2 all from Fisher Biotech
(Perth). The amplification was carried out in a 20 μL reaction volume containing target
DNA up to 100 ng, DNA polymerase 0.5 units, 0.15 pmol of each primer, 2.5 mM
50
MgCl2 and 1x polymerisation buffer. PCR conditions for all primers mentioned above
were as follows, except that the annealing temperature for the primers of the 35sCaMV
promoter was 60 oC.
Cycles Denaturation Annealing Extension
1x 3 min at 94 oC - -
30x 30 s at 94 oC 30 s at 55 oC 1 min at 72 oC
1x - - 10 min at 72 oC
Gel electrophoresis
Mini-Sub™ cells or Wide Mini-Sub™ cells (Bio-Rad) were used for gel
electrophoresis. One percent agarose in TAE buffer (Sambrook et al. 1989) was used to
separate the PCR products. An aliquot of 15 μL of PCR product was mixed with 3 μL
of glycerol-based 6X loading buffer (Sambrook et al.1989) and loaded into the well of
agarose gel beside 8 μL of a 100 bp or 1 kb ladder molecular weight marker (Fisher
Biotech). The DNA fragments were electrophoresed then the gel was stained in TAE
buffer containing 1 μg/mL ethidium bromide. The DNA fragments were viewed under
UV light and the image was taken by UVP video imager and digitally recorded via
Molecular Analyst software (Bio-Rad Corp).
2.5.3 Histochemical GUS assay
Histochemical GUS assays were used to determine expression of the GUS reporter
gene. Target plant tissue was submerged in the GUS staining solution containing 0.5
mg/mL X-gluc, 50 mM Na2HPO4 buffer at pH 7.0 and 20% (v/v) methanol in water,
incubated at 37oC overnight. Pigments of tissue were extracted with 70% (v/v) ethanol
and the blue stain of ClBr-indigo was examined under a microscope.
2.6 Histology
2.6.1 Paraffin wax embedded plant tissues
Plant tissues either fresh or kept in 70% (v/v) ethanol were dehydrated and slowly
infiltrated with warm wax in an auto tissue processing cycler (Leica TP1020). To do
this, tissues were dehydrated by transferring them through a series of solvents as
follows: 2 times in 70% (v/v) ethanol for 2 h each, 2 times in 90% (v/v) ethanol for 1
51
and 2 h and 2 times in absolute ethanol for 1 and 2 h. Then chloroform was used to
remove ethanol (clearing) by passing tissues through chloroform twice for 3 h each.
After the clearing process, the tissues were placed in molten wax (55oC) 2 times for 3 h
each with low vacuum pressure applied so that they gradually become infiltrated with
the wax. The wax-impregnated tissue was set into a solid block of wax for sectioning.
The tissues were placed on a warming plate while the base of a stainless steel mould of
suitable size was filled with the small volume of warm wax. Then in the desired
orientation the warm tissue was placed onto the mould facing the bottom of mould, and
immediately the base of the plastic cassette was placed on top edge of mould and filled
up with wax. The mould was then placed on an ice block and left to solidify. When the
wax was cold it was removed from the mould and the block was ready for use or
storage.
The block of wax-embedded tissue was sectioned using a microtome (Spencer 082) at
10 μm sections. The sections were transferred using a fine hair brush and floated on a
water bath set at 45-50oC with 1-2 mL of horse serum (to keep fix the section on a slide)
for flattening. The floating section was picked by dipping part of a glass slide in the
water under the section and ‘skimming’ it onto the slide, which was then placed on a
slide drier to remove excess water, then transferred to an oven (60oC) to melt the wax.
The latter was removed by passing through 100% xylene three times for 2 min each, the
excess xylene was removed with tissue paper and the slide was ready for staining or
mounting.
The slide with the fixed tissue was mounted by dropping DPX (a clear synthetic resin)
near the tissue and a cover glass was placed on an angle to the slide surface on the DPX
and slowly pressed toward the DPX to prevent bubbles occurred, until the tissue was
covered. The tissue was then ready for examination.
2.6.2 Dissection of plant tissues by hand
In this method a block of carrot root tissue was used to hold the test tissue for
sectioning. A large carrot root was cut into ~5 cm blocks and submerged in 70%
ethanol for a few days until it was soft. Fresh plant tissues were collected and fixed in
70% ethanol at least 24 h. A carrot block was trimmed to a square shape and cut
vertically to make a ~1 cm channel to hold the tissue. The tissue was placed the
required side up into the carrot block channel and it was held tightly between the carrot
52
tissues pressed toward to each other. The tissue was then sectioned manually by cutting
through the carrot tissue with a sharp thin blade. Thin sections were floated on the
water to separate them from carrot tissue and picked by a fine hair brush to attach them
on a slide. The tissue was now ready for microscopic examination.
53
Chapter 3. Lupin transformation via particle bombardment
3.1 Introduction
Particle bombardment is a direct gene transfer method developed to transform plants
that are recalcitrant to A. tumefaciens-mediated transformation. Here, dense particles
such as tungsten, gold or platinum are coated with DNA and propelled by high pressure
directly through cell walls and cell membranes into the cytoplasm or nucleus of target
cells. Evidence of its efficiency to deliver foreign genes into plant cells was shown in
suspension cultures of tobacco cells where more than 90% of cells received the gus gene
in their nucleus after particle bombardment (Yamashita et al. 1991). Transgenic crops
generated by this method include barley, wheat, cotton, maize, soybean, sugarcane, rice,
alfalfa, and papaya (Table 3.1).
3.1.1 The significance of particle bombardment transformation
Particle bombardment can be a relatively high efficiency genetic transformation tool for
some plant species, especially for those recalcitrant to other direct gene transfer or A.
tumefaciens-based methods. For example, a comparison of methods of direct gene
transfer into immature embryos and type II callus of maize showed that particle
bombardment was the most efficient method, followed by tissue electroporation, silicon
carbide whiskers, and tissue electrophoresis respectively as determined by highest mean
number of gus expression units per sample (Southgate et al. 1998). Although 7%
transformation efficiency for rice was obtained via A. tumefaciens, this was increased to
22% with particle bombardment (Dai et al. 2001).
Advances in A. tumefaciens-mediated transformation enabled genetic modification of
cereals, conifers and legumes, some of which were recalcitrant to A. tumefaciens, or
were genotype-dependent, with some varieties being less susceptible to A. tumefaciens.
In those cases in which susceptible varieties are not of agronomic importance, obtaining
commercially useful lines requires backcrossing to introduce the transgenes into more
competitive germplasm. On the other hand, particle bombardment can offer genotype-
independent transformation that can be applied to the most advanced germplasm
without the need for backcrossing (Christou et al. 1990).
54
In addition to transformation of the nuclear genome of some species, particle
bombardment can also be used to transform the chloroplast genome (Bellucci et al.
2003; Chin et al. 2003; Cho et al. 1999; Dix and Kavanagh 1995; Doetsch et al. 2001;
Huang et al. 2002; Kang et al. 2004; Maenpaa et al. 1999), an option not normally
available through A. tumefaciens-based methods, because of the specific nuclear
targeting properties of the A. tumefaciens-derived proteins accompanying the T-DNA
(De Block et al. 1985). Chloroplast transformation has become of interest because
transgenic plastids are not normally transferred via pollen, since chloroplasts are
inherited maternally in most species, thereby preventing ‘escape’ of the transgene
through cross pollination to other genotypes. Furthermore, chloroplasts provide a more
productive system for secondary metabolite production than does nuclear
transformation, because there are many chloroplasts per cell in green tissues, and each
chloroplast has many copies of the chloroplast genome (eg ~10,000 copies of the
chloroplast genome per cell in tobacco, Bendich 1987) whereas there is only one copy
of the nuclear genome.
Another possible advantage that particle bombardment presents over A. tumefaciens-
based T-DNA transformation is that T-DNA favours certain transcriptionally active
regions, whereas insertion of transgenes through bombardment is more random,
potentially providing more sites of insertion and so a wider range of trangene expression
phenotypes.
55
Table 3.1 Examples of plant species transformed by particle bombardment.
Plants Target tissue Reference
Monocots
Asparagus
Barley
Corn
Garlic
Oat
Oil palm
Orchid (Dendobium)
Pearl millet
Pineapple
Rice
Rhodes grass
Ryegrass
Wheat
Sorghum
Sugarcane
Tall fescue
Turf grass
Turmeric
Dicots
Alfalfa
Arabidopsis
Bean
Cabbage
Cassava
Castor
Chrysanthemum
Cotton
Cranberry
Hop
Hypericum perforatum
Lathyrus sativus
Papaya
Peanut
Petunia
Poplar
Rose
Soybean
Spruce
Sugar beet
Sunflower
Tobacco
Tomato
Cell suspension
Microspores
Cell suspension
Callus
Callus
Embryogenic suspension
Embryogenic callus
Callus
Immature embryos
Leaf bases
Callus
Multiple-shoot clump
Callus
Immature embryos
Immature inflorescences
Embryogenic callus
Callus
Callus
Callus
Callus
Pollen
Root sections
Protoplasts
Leaf cells
Somatic cotyledons
Embryonic axis
Callus
Suspension
Stem sections
Petioles and green organogenic
nodular clusters
Organogenic cell suspension
Somatic embryos
Zygotic/somatic embryos
Embryonic axes
Meristem
Cell suspension, nodule, stem
Embryogenic suspension
Embryogenic callus
Immature embryos
Embryogenic callus
Leaves
Apical meristems
Leaves
Li and Wolyn (1997)
Yao et al. (1997)
Gordon-Kamm et al. (1990)
Fromm et al. (1990)
Sawahel (2002)
Somers et al. (1992)
Parveez et al. (1997)
Men et al. (2003)
O'Kennedy et al. (2004)
Sripaoraya et al. (2001)
Fu et al. (1998)
Gondo et al. (2009)
Altpeter et al. (2000)
Wright et al. (2001)
Casas et al. (1997)
Bower and Birch (1992)
Gao et al. (2008)
Altpeter and Xu (2000)
Shirgurkar et al. (2006)
Pereira and Erickson (1995)
Ramaiah and Skinner (1997)
Seki et al. (1991)
Aragao et al. (1996)
Liu et al. (2007)
Zhang et al. (2000)
Sailaja et al. (2008)
Yepes et al. (1995)
Finer and McMullen (1990)
Serres et al. (1992)
Batista et al. (2008)
Franklin et al. (2007)
Barna and Mehta (1995)
Fitch et al. (1990)
Brar et al. (1994)
Zubkot et al. (2004)
McCown et al. (1991)
Marchant et al. (1998)
Christou et al. (1989)
Ellis et al. (1993)
Ivic-Haymes and Smigocki (2005)
Bidney et al. (1992)
Tomes et al. (1990)
Vaneck et al. (1995)
56
3.1.2 Particle bombardment devices
The original “Biolistic” method used DNA-coated tungsten particles loaded on a plastic
macrocarrier that was driven down a barrel by pressure generated from firing a
gunpowder cartridge (Sanford et al. 1987), in which the macrocarrier was stopped by a
‘stopping plate’ with a hole in the middle, through which the microparticles passed to
enter the tissues. The chamber had to be evacuated otherwise the air present would
slow down particles. Since then there have been several improvements on this design.
a) Helium-modified bombardment device (Sanford et al. 1991)
This device is a modification of the original device by replacing gunpowder with helium
as a source of pressure to accelerate the macrocarrier. The helium pressure builds
continually in a reservoir and is released via a “rupture disc” which is designed to burst
when subjected to a predetermined pressure. The resulting shockwave drives a
macrocarrier disc containing DNA coated particles into a stopping screen which retains
the macrocarrier while the particles travel on to the target. The strength of the
shockwave and the related particle velocity can be adjusted by using rupture discs that
are made to rupture at different pressures. Model PDS-1000/He is licensed to BioRad
under DuPont and is used widely.
b) Particle accelerator (Christou et al. 1990) or Accel particle gun (McCabe and
Christou 1993)
In this device, a shockwave is generated by discharging a high voltage between two
electrodes to vaporise a 10 l water droplet. Vaporisation of the water generates
pressure, which hits the carrier sheet supporting DNA coated particles that are driven
passed the retaining screen into target tissues.
c) Microtargeting device (Sautter et al. 1991)
This device is designed for precise delivery of particles into shoot apical meristems,
which can be as little as 0.15 mm in diameter. The particles are suspended in DNA
solution instead of being coated with DNA. A small aliquot (20 μl) of the mixture is
ruptured by a high-pressure pulse into a mist of micron-sized droplets to a restriction
tube where droplets and particles are accelerated in a focused stream that is forced to
move faster as the tube narrows. The procedure is done under partial vacuum and
without a macrocarrier.
d) Particle inflow gun (Finer et al. 1992)
This simple and inexpensive device is based on acceleration of DNA-coated tungsten or
gold particles directly by a pulse of helium under partial vacuum. Particles are
57
supported on a membrane in a reusable syringe filter unit and propelled by a burst of
low-pressure helium released from a solenoid controlled by a timer relay. A nylon
mesh is placed above the target tissue to reduce the localized impact of the particles and
to increase dispersal.
e) Helios gene gun (BioRad, Hercules, CA)
This hand-held device utilises low-pressure helium to accelerate DNA coated particles
from the interior of a small plastic cartridge towards the target tissue (Finer et al. 1999).
The tip of the gun is spaced to maintain the optimal target distance and to reduce cell
damage by venting the helium gas away from the tissue. This device can be used in
transformation of animal and plant cells.
3.1.3 Parameters influencing transformation success
Several parameters must be addressed to obtain stable transformed plants by particle
bombardment, the major ones being apparatus design, ballistic parameters, particle
properties, form of DNA, target explants, pre- and post-treatment of target explants and
osmoticum in support media. Transient expression of reporter genes is normally used,
for convenience, to determine success of gene delivery in optimisation of these
parameters. A high level of transient expression is desirable but it may not correlate
with rates of stable transformation to obtain transgenic plants if cells with particles can
not be regenerated to plants. In the order of 102-103 transiently expressing cells per
bombardment in regenerable tissues need to be achieved to obtain transgenic plants in
most reported stable transformations (Birch and Bower 1994).
a) Apparatus design: Biolistic particle accelerators are available in many designs (see
above). Some are designed to deliver particles specifically into desired target explants
eg shoot apical meristems, some are designed for ease of use and to be cost effective eg
particle inflow guns, which can be home-built. However, the device must be able to
accelerate the DNA-coated particles to velocities of around 300 m/s in order to
penetrate intact plant cell walls (Birch and Bower 1994), they must be safe to operate,
and they should produce consistent results. Furthermore, they should be able to allow
substantial variations in key ballistic parameters such as particle velocity and target
distance for optimisation experiments.
b) Ballistic parameters: Ballistics parameters include particle velocity and target
distance. They are varied for different target tissues depending on cell wall thickness
58
and the required penetration. These need to be optimised to suit each explant type and
species.
c) Particle properties: Particles should be of high density to achieve the momentum
required for cell wall penetration, they should be chemically inert to reduce damage to
cells and to prevent chemical reactions with DNA solutions. Tungsten and gold
particles meet these requirements and are used widely. A 1 μm diameter particle size is
commonly used for plant cells. Tungsten was reported to be more toxic than gold in
tobacco, resulting in 4-fold lower transformation efficiency (Russell et al. 1992).
d) Form of DNA: In general, there are no special requirements for the form of DNA to
be transferred by particle bombardment. DNA in linearised form or as a supercoil
plasmid, large plasmid (> 10 kbp), viral sequence or mini-chromosome of 7-190 kbp
(Carlson et al. 2007) have all been successfully utilised. Some studies show no effect
between linear or supercoiled plasmid for transformation (Klein et al. 1988; Armaleo et
al. 1990), but others (Sautter et al. 1991) found linearised plasmid gave a higher
transformation frequency. Large plasmids may be subject to fragmentation during
bombardment resulting in lower expression rates and co-transformation frequencies
(Fitch et al. 1990; Mendel et al. 1989). Impurities from DNA degradation or salts from
DNA preparation may prevent expression in transformed cells (Birch and Bower 1994).
For commercial application, purified linear construct DNA is preferred to prevent
integration of ‘non-target’ plasmid DNA sequences.
e) Target explants: Explants should ideally be highly regenerable and readily
penetrated by particles. Different target cells or tissues yield different transient and
stable transformation frequencies. Cells with large vacuoles were found to suffer more
damage due to disruption of cellular compartments. The desirable target explants
should be actively growing, with a high proportion of cells near mitosis. These
characteristics can be manipulated by culture conditions (pre- and/or post-treatment)
including optimising plant growth regulators to stimulate active growth and the cell
cycle.
f) Pre-and post-treatment of explants: Culture conditions before bombardment may
effect transformation efficiency, depending on the plant species and the target explant.
The main treatments used are plant hormones or/and increasing the concentration of the
carbon source (Casas et al. 1997; Folling and Olesen 2001; Hunold et al. 1995; Watad et
al. 1998; Wijayanto and McHughen 1999). Iida (1991) found that pre-and/or post-
treatments that enhanced the cell growth cycle influenced transformation efficiency by
59
particle bombardment. During mitosis, the cell cytoplasm becomes dense, there are
fewer vacuoles and the nuclear membrane dissociates for a brief period, and this
enabled transgenes to enter the nucleus without a barrier (Bower and Birch 1990).
More transient expression was observed in cells with a dense cytoplasm, such as the
embryogenic region of callus, than in the vacuolated cells present in the soft regions of
callus. A possible reason is that cells with large vacuoles are more subject to damage
by bombardment through disruption of cellular compartments (Franks and Birch 1991a)
or that their metabolic activities are lower. In microscopic examinations, DNA-coated
particles delivered to the nucleus had 45 times more transient expression than if
delivered to the cytosol, and it was over 900 times higher than if delivered to the
vacuole (Yamashita et al. 1991). Furthermore, enhancement of the cell growth cycle
during pre-/post-treatment with plant hormones caused expansion of cell walls and
explant tissues to soften, which was beneficial for deeper penetration of particles.
In some plants, specific conditions must be met before foreign DNA can integrate. For
example in garlic, calli had to be treated with aurintricarboxylic acid as an endogenous
nuclease inhibitor before bombardment (Sawahel 2002).
g) Osmoticum in support media: Sorbitol and mannitol are widely used as osmotic
agents to minimise damage to cells undergoing bombardment. The concentrations used
reduce vacuole volume and turgor, and this enhances particle penetration and protects
loss of cell contents before the cell membrane re-seals. The optimal concentration of
osmoticum used in support media for particle bombardment varies between 0.25 M and
1.75 M in different species (Birch and Bower 1994). Optimising concentration and
duration of exposure of explants to osmotic treatment resulted in a 6.8-fold increase in
stable transformation rate in maize (Vain et al. 1993).
3.1.4 Transgene integration
Transgenes delivered by particle bombardment can be found integrated in host plant
genomes in various copy numbers and arrangements. In general, single copies of the
transgene are rarer than multiple copies and complex arrangements are found (Klein et
al.1989; Weeks et al. 1993; Register et al. 1994; Emani et al. 2002). Transgene
integration into the plant genome is thought to occur through ‘illegitimate
recombination’ via a double-stranded DNA break-repair mechanism. Illegitimate
recombination junctions have either deletion of nucleotides at one or both of the
recombining ends and/or microhomology between the recombining ends, involving up
60
to nine nucleotides, and/ or the presence of additional DNA known as filler DNA at the
junction (Sargent et al. 1997). A study of transgene organisation in seven lines of rice
engineered through particle bombardment showed a cluster of transgene copies being
cointegrated into a single locus with no interspersed plant genome sequences, this
suggested a two-phase integration mechanism (Kohli et al. 1998); a pre-integration
phase where introduced genes were spliced together and rearranged, then that cluster of
transgenes was subsequently integrated into a site in the plant genome as a single locus.
As the particle bombardment technique has not been used in genetic transformation for
lupins before, therefore, experiments were designed to optimised the parameters that
were basic to bombardment conditions, namely; quality of plasmid DNA through DNA
preparation, helium pressure, target distance (the distance between the injector nozzle
onto the target explants), mannitol concentration, concentration of plasmid DNA,
particle load per shot. Then optimised parameters were combined to bombard a large
number of explants. The results will be used for further optimisation, namely; pre-/post
treatment and number of bombardment.
3.2 Materials and Methods
3.2.1 Plant material and culture conditions
a) Plant material
Embryonic axes of L. angustifolius cultivar Unicrop were used. Seeds were obtained
from DAFWA. Seed sterilisation, germination and the isolation of embryonic axes
procedure are as described in 2.1.3-4.
b) Culture media
MS (Murashige and Skoog) medium was used as a basal medium and modified to create
other media. They were supplemented with B5 vitamins and 3% sucrose, solidified
with 0.7% agar and adjusted to pH 5.8 prior to autoclaving. Supplements to this basal
medium are listed in Table 3.2.
61
Table 3.2 Supplements to basal (MS) media used in particle bombardment experiments.
Medium name Supplementation
Osmoticum 0.3 M mannitol instead of sucrose
Pre- and post-treatment 5 mg/L BAP and 0.5 mg/L NAA
Selection media
Multiple shoot induction
Elongation
1 mg/L BAP, 0.1 mg/L NAA
and 10 or 5 mg/L PPT
2 mg/L PPT
Root induction 3 mg/L IBA
c) Culture condition
In vitro cultures of L. angustifolius were grown at 22oC in a culture room with a 12 h
photoperiod (50 E m-2 s-1). Explants were transferred to fresh medium every two
weeks. Plants that survived on selection media were transferred to a glasshouse (2.1.2).
3.2.2 Plasmid preparation
Plasmid pCGP1258, which carries bar and gus genes as selectable and reporter genes,
respectively, under the control of a 35S CaMV promoter, was maintained in
Escherichia coli strain DH5.
a) E. coli growth conditions and storage
Glycerol stocks of E. coli with pCGP1258 were prepared using a same protocol as
described for A. tumefaciens (2.2.1). A loop of this glycerol stock was streaked on LB
(2.2.1) agar plate with tetracycline 50 μg/mL (from stock solution at 12.5 mg/mL
tetracycline (Progen) in methanol stored at -20oC) a few times and incubated at 37oC
overnight. A colony of E. coli growing on the agar plate was inoculated into 5 mL LB
liquid medium with the same antibiotic on a rotary shaker at 220 rpm overnight at 37oC.
Then 100 μL of inoculum was added to 50 mL of LB liquid medium with the same
antibiotic at 37oC on rotary shaker at 220 rpm overnight.
b) Plasmid extraction from E. coli culture
Plasmid was extracted using QIAGEN Plasmid Midi kit (QIAGEN) otherwise
mentioned elsewhere. A 50 mL of overnight grown E. coli culture was centrifuged at
2795 x g for 10 min and the pellet was resuspended in 4 mL of buffer P1 (supplied with
62
the kit). The following steps were as described in QIAGEN Plasmid Midi kit
handbook. In the final step, plasmid was eluted with PCR water (Promega) to make up
1 g/L. Aliquots of plasmid (1 g/L) were stored at –20oC.
3.2.3 Microprojectile bombardment
a) Preparation of particles
Sterilisation
Tungsten or gold particles (~1 m diameter, BioRad) were used. A stock of sterile
particles was prepared at a concentration of 500 g/L by weighing 250 mg of particles
placed in a sterile 1.5 mL tube with 0.5 mL of 100% ethanol and vortexed at high speed
for 1-2 min then centrifuged to collect the particles. The supernatant was removed and
the pellet washed free of the remaining ethanol by adding 0.5 mL of sterile distilled
water, vortexing and spinning down. This step was repeated and the particles were
resuspended in 0.5 mL of sterile distilled water and stored at 4oC.
Coating tungsten and gold particles with DNA
This preparation was to yield 20 L of particle suspension at 125 μg particles/ L with
coating of 4 ng DNA/ μg particles.
The following were added in order under continuous vortexing.
50 L of sterile particle solution (50 μg/L)
10 L of plasmid solution (1 g/L)
50 L of CaCl2 (2.5 M)
20 L of 0.1 M spermidine (200 L aliquots were kept at –20oC and used only
once.)
The coated particles were allowed to settle to the bottom of the tube on ice, then 110 L
of the supernatant was removed. The particles were resuspended by gently vortexing
before loading to the gun for shooting.
b) Preparation of target tissues
Surface-sterile lupin seeds (20-30 seeds per Petri dish) were germinated overnight in
sterile distilled water. Explants were prepared from embryonic axes by removing the
seed coat and both cotyledons. The pair of leaves present in the plumule was carefully
excised without damaging the proximate meristematic tissue (target tissue). The
excised meristematic tissue was placed onto osmoticum medium so that the cut surface
63
was in contact with the medium and the meristem faced upwards and out of the
medium. The explants were incubated like this for at least 4 h before bombardment.
Explants (20-25/treatment) were placed closely together in the centre of each Petri dish
(~3 cm diameter circle), so that they would be exposed to the spread of the particles.
c) Bombardment
The chamber of a particle inflow gun (manufactured by CSIRO, Australia) was
sterilised by spraying with 100% ethanol and dried. Bombardments were done in sterile
conditions under vacuum (28 mm Hg). Once the target tissues were shot, the vacuum
was released immediately. The standard target distance used (the distance between the
injector nozzle onto the target explants) was 10 cm otherwise stated therein.
3.2.4 Selection procedure for putative transformants
After bombardment, embryonic axes were allowed to recover on the same osmoticum
plates for another 4-8 h before being transferred to MS basal medium overnight for full
recovery, then transferred to multiple shoot induction medium (Table 3.2) supplemented
with 10 mg/L PPT for one month. Plants that survived the first selection were
transferred to multiple shoot induction medium supplemented with 5 mg/L PPT for
another month. The survivors were then placed on elongation medium (Table 3.2) for
one month. Elongated shoots were grown individually and then were rooted (3.2.5).
Plants were subcultured to fresh medium every two weeks through out the procedure.
3.2.5 Rooting
Two methods were used; root induction with plant growth regulators and grafting to
rootstocks in vitro.
Method one – root induction. Putatively transformed shoots were transferred to the
root induction medium (Table 3.2) and subcultured to fresh medium every two weeks.
Method two - grafting. Rootstocks were grown in vitro from sterile seeds in MS basal
medium (3.2.1 (b)) for two weeks. Then the shoot tip of the rootstock was excised
about 1 cm above the cotyledons. The stem was incised vertically for about 0.5 cm and
the base of putatively transformed shoot was trimmed to obtain a wedge shape. The
shoot was then inserted into the stem of the rootstock.
64
3.2.6 Data analysis
Presence of blue spots of GUS in the apical area of embryonic axes two days after
bombardment was used to quantify transient expression. PCR was also used to confirm
presence of transgenes. At least three replicates per treatment (20-25 explants per
treatment) were used for each experiment and experiments were repeated unless
otherwise stated. Statistic analyses were carried out using one-way ANOVA (Analysis
of variance) with Tukey HSD test for paired comparison.
3.3 Results
3.3.1 Optimisation
At this stage, experiments were undertaken to optimise the main parameters important
for successful bombardment transformation.
i) Plasmid preparation
Plasmid DNA used for coating particles (as described in 3.2.3(a)) was prepared by two
methods: an alkaline lysis plasmid preparation method described by Sambrook et al.
(1989) and a proprietary method with QIAGEN spin columns. A plate of 20 explants
was shot with 2.5 μg DNA coated on tungsten particles (5 μl load) at 200 psi of helium
pressure and target distance at 10 cm. Plasmids prepared by the alkaline lysis method
gave poor GUS expression as shown by very few blue spots – 0 to 5 per explant (Fig.
3.1a), whereas plasmids prepared by spin columns gave strong expression – 50-100
spots per explant (Fig. 3.1b). Thus, plasmids prepared by the spin column method were
used in subsequent optimisation experiments.
ii) Helium pressure
To deliver plasmid DNA to the target tissues efficiently, helium pressures of 100, 150,
200, 250 and 300 psi were investigated. All other parameters (DNA concentration,
particle type, target distance) were kept constant. Pressures of 200-300 psi gave better
transient expression of GUS (as measured by average of blue spots per explant) than did
lower pressures, although there was no statistical significance between treatments (Fig.
3.2).
65
Figure 3.1 Transient expression of GUS after bombardment of lupin meristems with 2.5
μg DNA plasmid prepared by (a) Alkaline lysis method (Sambrook et al. 1989) and (b)
Qiagen spin column. Bar is 1 mm.
Figure 3.2 The effect of helium pressure applied in bombardment to transient
expression of GUS in lupin meristem explants determined by mean of number of blue
spots per explant. Bars present mean values. The same letter (e.g. a, b) means their
mean values are different significantly at the 0.05 level determined using one-way
ANOVA with Tukey HSD.
Explants one week after bombardment at 300 psi were treated with GUS substrate (X-
Gluc) and processed for wax embedded sectioning with a microtome to visualise
0
5
10
15
20
25
30
0
(control) 100 150 200 250 300
Helium pressure (psi)
No.
of
blu
e sp
ots
per
exp
lan
t
a, b
a b
a, b, c, d
c
d
66
penetration patterns of plasmid-coated particles. Sections showed the presence of blue
spots located at leaf tissue of emerging shoots (arrowed). The reason for this pattern
might be that coated particles had not penetrated to the LII and LIII tissue layers of the
embryonic axis (Fig. 3.3); layers that give rise to organs including inflorescences in
mature plants (Irish 1991).
67
a)
b)
c)
Figure 3.3 Sections of one week old embryonic axes after bombardment at 300 psi
showing distribution of blue spots of GUS staining on the leaf tissues (arrowed) of
emerging shoots (a and b) at 4X magnification, bars are 500 µm. Penetration of coated
particles (indicated by location of blue spots) within cells of leaf tissues at 40X
magnification (c), bar is 50 µm.
68
iii) Effect of Helium Pressure and Target Distance
Helium pressure experiments (3.3.1 (ii)) showed that when particles were accelerated at
100, 150, 200, 250 and 300 psi, they might not penetrate deep enough to generate
transformed shoots. In order to position the plasmid-coated particles in the LII cell
layer of the target tissues where floral bud initiation occurs, helium pressures of 350 psi
and 400 psi were applied. Pressures higher than these were not applied because 400 psi
is approaching the maximum capacity of the particle accelerator used. Together with
increased pressure, the target distance was also decreased. A target distance of 7 cm was
combined with helium pressures of 300-400 psi to create higher bombarding impact.
Two days after bombardment, explants were vacuum infiltrated with GUS staining
solution (2.5.3) at 28 mmHg for 1 min then incubated overnight. After blue spots were
counted and analysed, it was shown that helium pressure greater that 200 psi and
decreasing the target distance did not significantly increase spot number (Fig 3.4).
Figure 3.4 Transient expression of GUS in embryogenic axes affected by helium
pressures 100-400 psi applied with two target distances: 10 and 7 cm. Bars represent
mean values. Treatments labelled same letter (e.g. a, b) mean their mean values are
significantly different at the 0.05 level determined using one-way ANOVA with Tukey
HSD. Numbers shown in parentheses indicate target distance (cm) used.
0
5
10
15
20
25
30
35
100 (10) 200 (10) 300 (10) 350 (10) 400 (10) 300 (7) 350 (7) 400 (7)
Helium pressure (psi)
a, b, c, d, f
a, e b, e c
d f
e
No.
of
blu
e sp
ots
per
ex
pla
nt
69
The shorter target distance at 7 cm with 300, 350 and 400 psi helium pressure resulted
in no significant difference to the treatment at the same pressure with the 10 cm target
distance (Fig 3.4) in transient GUS expression. However preliminary experiments of
the same treatments showed that explants that were bombarded with higher pressure and
shorter flight distance (300, 350, and 400 psi with 7 cm target distance) had more blue
spots with vacuum infiltration of GUS staining solution prior to incubation than for the
normal staining procedure. This might be due to the deeper penetration caused by
higher pressure and shorter target distance. Therefore helium pressure at 400 psi with 7
cm target distance was chosen for the investigation into optimum mannitol
concentration. Vacuum infiltration was added to GUS staining procedures from this
time.
iv) Mannitol concentration
Mannitol was used to partially plasmolyse the explants so that cell turgor pressure was
reduced and the cells remained intact during bombardment. The mannitol
concentrations used were 0.1, 0.3 (control), 0.5, 0.7 and 1 M. Helium pressure at 400
psi with a 7 cm flight distance was used. With 0.1 and 1 M of mannitol in the
osmoticum medium there was significantly less GUS expression, whereas at 0.3, 0.5
and 0.7 M there were no significant differences in GUS expression (Fig 3.5). Explants
at a mannitol concentration higher than or equal to 0.7 M later became vitreous and did
not grow normally. A concentration of 0.3 M of mannitol was chosen for further
experiments to minimize the effect of mannitol on explants after subsequent culture.
70
Figure 3.5 The effect of varying mannitol concentrations in osmoticum medium on
transient GUS expression as measured by blue spot number per explant. A
bombardment pressure of 400 psi was used with 7 cm target distance. Bars represent
mean values. Treatments labelled same letter (e.g. a, b) mean their mean values are
significantly different at the 0.05 level determined using one-way ANOVA with Tukey
HSD.
v) Shoot regeneration versus bombardment pressure
This experiment was undertaken to study whether or not the damage caused by
bombardment with various pressures affected shoot regeneration. Explants were
bombarded with particles at pressures of 300, 350, 400 and 400 psi with 7 cm target
distance, and non-bombarded explants as controls. Shoot number was counted 3 weeks
after explants were transferred to shoot regeneration medium. The results (Table 3.3)
showed no effect of pressure on shoot regeneration.
vi) Concentration of plasmid DNA
The concentration of plasmid DNA precipitated onto particles is one of the main
parameters for success in stable transformation by bombardment. Explants were
bombarded with particles treated with plasmid DNA at concentrations of 0.2, 1, 2 and 4
(control) ng/μg. Plasmid DNA at 5 ng/μg and higher caused aggregation of particles.
Bombardments were carried out at 400 psi with a 7 cm flight distance. A concentration
of 2 ng/μg gave the best transient expression of GUS (Fig. 3.6) and was used for
subsequent experiments.
0
5
10
15
20
25
0.1 0.3 0.5 0.7 1
Mannitol (M)
(concentration (M)
No.
of
blu
e sp
ots
per
exp
lan
t
a
a, b
b
a, b a, b
71
Table 3.3 The number of shoots regenerated from explants at 3 weeks in regeneration
medium after being bombarded with particles at different helium pressures. N =
number of explants per treatment. There was no significant difference among variations
as determined by one-way ANOVA with Tukey HSD at the 0.05 level.
Helium
pressure
(psi)
Target distance
(cm)
Number of shoots per explant
N Mean Std. Error Std. dev.
Control
300
0
10
20
19
2.05
2.21
0.15
0.19
0.69
0.85
350 10 17 2.18 0.19 0.81
400 10 19 2.05 0.19 0.85
400 7 21 1.95 0.18 0.86
Figure 3.6 Transient expression of GUS in the apical region of explants bombarded at
400 psi and 7 cm target distance with particles coated in four concentrations of plasmid
DNA. Bars represent mean values. Treatments labelled same letter (e.g. a, b) mean
their mean values are significantly different at the 0.05 level determined using one-way
ANOVA with Tukey HSD.
vii) Particle load
The particle load (amount of DNA-coated particles loaded on the injector before
bombarding) varied from 5 (control), 10 and 15 μL per shot. The results showed 10 μL
0
2
4
6
8
10
12
14
0.2 1 2 4
Plasmid per tungsten (ng/μg)
No.o
f b
lue
spots
per
exp
lan
t
a
a
72
of particle load gave the best transient expression of GUS (Fig. 3.7) therefore it was
used for the next experiment.
Figure 3.7 Transient expression of GUS in the apices of explants bombarded with three
particle loads at 400 psi with 7 cm target distance. Bars represent mean values. There
was no significant difference among variations as determined by one-way ANOVA with
Tukey HSD.
viii) Combining parameters to effect stable transformation
The findings from the optimisation experiments above were combined to generate a
protocol for transformation of lupin embryonic axes via particle bombardment. The
conditions used were:
Explants were placed on 0.3 M mannitol osmoticum plates 4 h before bombardment.
Bombardment was carried out at a pressure of 400 psi with 7 cm target distance, 2
ng/μg plasmid DNA/ particles and 10 μL particle load.
Four hours after bombardment, 312 explants were transferred to MS basal medium
overnight for recovery then transferred to multiple shoot induction medium
supplemented with 10 mg/L PPT for two weeks. Twenty-two % of explants survived
and produced shoots. Shoots from each surviving explants were separated individually
0
2
4
6
8
10
12
14
16
18
20
5 10 15
Particle amount ( μL) per shot
No.
of
blu
e sp
ots
per
exp
lan
t
73
and placed in selection medium for another 2 weeks. No shoots survived this step of
selection.
ix) Pre- and post-treatment of explants
Lupin embryonic axes were isolated and placed onto MS medium containing 5.0 mg/L
BAP and 0.5 mg/L NAA (the pre-/post-treatment medium), at ~20 explants per plate.
Explants were cultured in the dark at 25oC for 3 days prior to being bombarded. 307
explants were bombarded with the conditions described in 3.3.1 (viii). Only 302
explants were left and placed in MS medium overnight for recovery before they were
transferred to the pre-/post-treatment medium and cultured in the dark for another 3
days. Then explants were transferred to selection medium (multiple shoot induction
with 10 mg/L PTT) together with 100 untreated explants as controls, placed in the light
and subcultured every 2 weeks. During the selection period, some explants were taken
for GUS staining, where gus expression was observed over different growth stages (Fig.
3.8). After 8 weeks, only 4 of 302 explants (1.3%) had survived and producing a single
shoot per explant whereas all control plants died. The survivors were transferred to
fresh multiple shoot induction medium with 5.0 mg/L PPT for another 4 weeks with 2
weeks subculture. Two of them died and one of the survivors produced another two
shoots. Shoots were separated and grown in elongation medium for another 2 weeks for
PCR analysis. DNA of leaves from three shoots obtained from two survivors were
extracted and amplified with gus primers (described in 2.5.2). Only one shoot gave a
positive result (a 218 bp band) as shown in Fig. 3.9. The shoot was then transferred to
root induction medium (3.2.5) and subcultured every two weeks. It did not root, but it
did flower three weeks after transfer to root-induction medium. The flower was
removed to prevent further development, which would be to set a pod and then die.
Unfortunately, the shoot died 2 weeks after its flower was removed.
74
(a)
(b)
Figure 3.8 GUS stained images of leaves of explants produced from pre-/post-treatment
of particle bombardment experiment (3.3.1 (ix)). (a) One in five embryonic axes shown
blue stained of GUS expression in new shoots initiated 1 week after transfer to selection
media (bar is 500 µm), (b) An upper leaf of 8 week old explant surviving in selection
medium (bar is 5 mm).
75
Figure 3.9 PCR amplification of gus gene from genomic DNA of putative transgenic
lupins using primers GUSintL and GUSintR in 1.2% agarose gel. Lane 1: 1kb ladder,
Lane 2: negative control (water), Lane 3: positive control (pCGP1258), Lane 4: negative
plant control (non-transgenic lupin), Lane 5: positive plant control (transgenic lentil
with gus gene), Lane 6-8: putative transgenic lupins transformed via particle
bombardment experiment in 3.3.1 (ix).
x) Number of bombardments
The effect of number of bombardments was examined. After pre-treatment embryonic
axes were shot once (control), twice and thrice with the treatment optimised above (He
pressure at 400 psi with 7 cm target distance, 10 μL particles load with 2 ng DNA/μg
tungsten particles per bombardment). Explants bombarded two times gave more
transient expression than one or three times (Fig. 3.10). Explants bombarded three
times were visibly damaged: the tissues turned dark brown two days after bombardment
and GUS expression was rarely observed. A treatment of two bombardments was
chosen for the next experiment.
76
Figure 3.10 Transient expression of GUS in the apices of explants bombarded with
different numbers of bombardments at 400 psi with 7 cm target distance. Bars represent
mean values. Treatments labelled same letter (e.g. a, b) mean their mean values are
significantly different at the 0.05 level determined using one-way ANOVA with Tukey
HSD.
xi) DNA fragment length
Plasmid pCGP1258 was digested with PstI restriction enzyme to yield a band of 2.5 kb
comprising the gus expression cassette. The cassette was separated from the plasmid
backbone by gel electrophoresis and purified from the gel using a Gel Extraction
MinElute kit (Qiagen). Forty embryonic axes were shot with this construct to test the
protocol. The bombarded axes gave very poor transient expression compared to the
whole plasmid as a control. The mean number of blue spots generated with the gus
cassette was 5.97 ± 0.62, whereas mean number of blue spots generated from shooting
with the whole plasmid was 17.2 ± 2.23.
The bar expression cassette was generated by PCR amplification with the primers
designed to anneal at right and left border sequences of T-DNA in plasmid pPZB101
containing only the bar expression cassette. The bar expression fragments were
separated from PCR products by a Qiagen MinElute kit, then were shot into explants.
No surviving explants were obtained from 305 bombarded explants after four weeks on
selection media containing PPT.
0
5
10
15
20
25
30
One Two Three
No. of
blu
e sp
ots
per
exp
lan
t
No. of bombardments
a
a
a
77
3.3.2 Using the optimised protocol to generate transformants
The optimised protocol was as follows:
Embryonic axes used as explants were pre-treated in MS medium supplemented
with 5 mg/L BAP and 0.5 mg/L NAA, 3% sucrose and 0.7% agar for 3 days in the dark
at 25oC.
Pre-treated explants were placed onto MS medium with 0.3 M mannitol 4 h
prior to bombardment.
The bombardment procedure was carried out by:
Precipitation protocol described in 3.2.2 (a) using plasmid DNA prepared by
Qiagen spin column, 2 ng plasmid DNA per μg tungsten particles (10 L of 0.5 g/L
plasmid DNA and 50 L of 50 g/L tungsten particles in precipitation mix).
Bombardment was carried out at 400 psi with 7 cm target distance
Bombardment was performed twice with 10 L coated particle load each time.
Bombarded explants were kept on osmoticum medium (MS medium with 0.3 M
mannitol) for another 4 hours then transferred to pre-/post-treatment medium for post-
treatment for another 3 days in the dark at 25oC.
After post-treatment, explants were transferred to selection medium (MS
medium with 1 mg/L BAP and 0.1 mg/L NAA, 3% sucrose, 0.7% agar and 10 mg/L
PPT) for 8 weeks with subculture every two weeks. Survivors were transferred to
rooting medium and analysed for presence of the transgene by PCR.
1487 explants were treated and of these 50 survived for eight weeks to produce 57
shoots (Fig. 3.11). Shoots were separated, trimmed of old tissues and placed on root
induction medium. Only one shoot generated roots (1.75%). After two weeks in
rooting medium PCR analysis was done on all 57 shoots using primers to amplify a
fragment from the gus gene (described in 2.5.2). Seven shoots from six explants
contained the gus gene (Fig. 3.12) yielding 0.4% transformation efficiency which was a
0.08% improvement after the number of bombardments was optimised. No roots were
generated on transformed shoots after four weeks. Shoots were then grafted to
rootstocks in vitro (described 3.2.5), however none survived the grafting process.
78
(a)
(b)
Figure 3.11 Putative lupin transformants from experiment 3.3.2. (a) Shoots growing in
selection medium (containing 10 mg/L PPT) at one month after bombardment. (b)
Shoots in selection medium (containing 5 mg/L PTT) at six weeks. Bar is 1 cm.
79
Figure 3.12 PCR amplification of the gus gene from genomic DNA extracted from
putative transgenic lupins using gus-intron primers in 1.2% agarose gel. Lane 1: 1kb
ladder, Lane 2: negative control (water), Lane 3: positive control (pCGP1258), Lane 4:
negative plant control (non-transgenic lupin), Lane 5: positive plant control (transgenic
lentil with gus gene), Lane 6: putative transformant from experiment 3.3.1 (ix) (repeat),
Lane 7-13: putative transgenic lupins transformed via particle bombardment in
Experiment 3.3.2.
3.4 Discussion
There is no established method for particle bombardment for narrow-leafed lupin. A
particle bombardment protocol for lupin transformation would be valuable where
transformation efficiency was increased and where the observed position effects of T-
DNA transformation in lupin (Wylie 1996; Hoffmann 1999) were overcome.
There were two reasons why embryonic axes were chosen as the target for
transformation in this project. First, there was an established regeneration and selection
protocol already available for this explant. Second, the adventitious shoots were
regenerated directly from the apical meristem of explants without going through a callus
stage that may result in undesirable somaclonal variation and sterility (Hadi et al. 1996).
In addition, the embryonic axis has been the target explants of transformation in other
legume species, for example soybean (Aragao et al. 2000; McCabe et al. 1988), bean
(Ritala et al. 1994; Russell et al. 1993) and peanut (Brar et al. 1994).
3.4.1 Optimisation
Although particle bombardment is widely used and routine in some crop plant species,
the bombardment parameters are species- and tissue-specific and need to be optimised
according to the nature of the explant. This chapter describes experiments to investigate
10000bp
250bp
1000bp
3000bp
Lane
1 2 3 4 5 6 7 8 9 10 11 12
13 14 15
80
the potential of particle bombardment as a method to transform L. angustifolius
embryonic axis (shoot apical meristems). Since a number of optimisation experiments
were carried out, these are discussed under subheadings.
a) Plasmid preparation method
A large quantity of DNA is required for the methods described for particle
bombardment. The alkaline lysis method was used because it was potentially a less
expensive alternative to large-scale DNA preparation than propriatory plasmid
preparation kits. However, explants shot with plasmid DNA purified by the alkaline
lysis method gave much poorer transient GUS expression compared to plasmid DNA
prepared by spin columns. The difference was probably caused by impurities such as
salts and proteins in the preparation that were filtered out when columns were used.
b) Helium pressure and target distance
A potential problem with using shoot apical meristem explants for bombardment is that
the target tissue within the meristem can be a few layers deep and therefore difficult to
penetrate by particles (McCabe et al. 1988). In addition, the optimal pressure should be
sufficient to penetrate the particles into the target cells or tissues but not to cause
excessive damage.
In this project, there was no significant difference between expression of the reporter
gene over the range of pressures tested (200-400 psi). Penetration to the target
meristematic tissue within the LII tissue layer was not achieved at a pressure of 300 psi.
Explants bombarded at 300 psi and higher with 7 cm target distances with vacuum
infiltration of GUS staining solution showed more transient expression that might
indicate deeper penetration and these caused no significant difference in shoot
regeneration comparing to non-bombarded explants as a control. The bombardment
pressure at 400 psi and 7 cm target distance was chosen for a maximum bombardment
impact without causing significant detriment to shoot regeneration to optimise other
parameters.
c) Concentration of mannitol in osmoticum medium
The purpose of using osmoticum in pre- and post-treatment of explants before
bombardment is to reduce vacuolar volume and turgor pressure to allow particles to
penetrate cells without bursting them. A suitable concentration of osmoticum to create
81
hypertonic not hypotonic environment can be various between 0.25 M and 1.75 M
(Birch and Bower 1994) depending on the type of explant and species. In soybean,
immature cotyledon explants were pre-conditioned on media containing 0.4 M mannitol
for 3 h before bombardment to produce transgenic plants (Li et al. 2004) while
proliferating embryonic tissues that were desiccated in a laminar flow for 15 min before
bombardment gave better transient expression than those incubated on osmoticum
media containing 0.2 M mannitol and 0.2 M sorbitol (Santarem and Finer 1999). Here,
both mannitol concentrations of 0.3 M and 0.5 M (3.3.1iv) provided a hypertonic
environment but 0.3 M was chosen to minimise the effect of plasmolysis on explants
during the 10 h period of pre-, post-treatment and bombardment.
d) Concentration of DNA
In this project, as the increment of DNA coated on particles increased, transient gus
expression increased up to 2 ng/μg of tungsten particles and declined at 4 ng/μg
particles. An excess amount of DNA on the particles might cause aggregation of
particles and affect DNA transient expression (Klein et al. 1988). A range of DNA
concentrations coated on particles between 2-4 ng/μg was used for particle
bombardment (Birch and Bower 1994). In potato (Romano et al. 2001) and conifer
(Humara et al. 1999), increasing the amount of DNA coated on particles did not affect
transient expression, while in Dendrobium orchids an increase in amount of DNA
coated on particles led to increase in transient expression until an optimum was reached
(Tee and Maziah 2005).
e) Particle volume loaded
The optimal particle volume per shot to achieve the highest transient expression of gus
was 10 μL. Expression was reduced when 20 μL was applied, possibly because of cell
damage (Klein et al. 1988). The volume of particles per shot is reported to influence
DNA transient expression. In maize, the highest gus transient expression was achieved
when small particle volumes (1.2 to 2.5 μL) were loaded, whereas volumes of 5 - 10 μL
led to a 3-fold reduction in expression (Klein et al. 1988).
f) Combining optimised parameters
A process of stepwise optimisation of parameters that have been reported to influence
transformation efficiency by particle bombardment was undertaken. The basis on which
82
each parameter was selected was the highest level of transient expression of the reporter
gene (gus) used. Despite this, when we combined optimised steps into a lupin
transformation procedure, no explants survived after selection. Therefore, transient
transgene expression might not be the best way to determine the potential efficiency of
each step of the procedure, especially with explants where only a small proportion of
total cells are regenerable, as in this case with lupin embryonic axes. Sautter et al.
(1991) overcame this difficulty by using a micro-targeting device that was specially
designed to directly deliver the particles into the specific regenerable area of the
explant, such as the apical meristem in shoot tips. Successful stable transformation was
achieved with a lower amount of apparent transient expression. The estimates of
conversion rate from transient expression to stable transformation range from 0.9-9.0%
(Finer and McMullen 1990; Russell et al. 1992). Other factors that contribute to the
integration of introduced genes into the plant genome cannot be determined by transient
expression. These include genotype-dependence (Iser et al. 1999; Moore et al. 1994),
the response of the explant to the regeneration protocol (Takumi and Shimada 1997)
and tissue type (Tao et al. 2000). It is desirable for the success of the protocol to use the
optimised procedures along with other considerations, apart from those mentioned
above, such as the particle penetration efficiency into the target cells/tissues and the
synchronisation of the cell cycle of the explant prior to bombardment may lead to the
success of transformation. In experiments described below, pre- /post-treatments of
explants to synchronise cell growth cycle before and after bombardment were
undertaken to optimise transformation efficiency.
g) Pre- and post-treatment of explants
Pre- and post-treatment of explants prior to bombardment on medium containing 5
mg/L BAP and 0.5 mg/L NAA for three days before bombardment and another three
days after bombardment (at 400 psi with 7 cm target distance) in the dark resulted in 1.3
% of explants surviving for eight weeks in selection medium. Leaves from survivors
showed strong gus expression suggesting that pre- and post-treatment with plant
hormones may be the most effective method to generate transformants in this
experiment. The total pre- /post-treatment period was six days, which was reported to
be the optimal length of co-cultivation period for lupin embryonic axis with A.
tumefaciens in a medium containing high cytokinins (as used in this experiment) to
achieve the highest survival rate in selection media (Hoffmann 1999). The co-
83
cultivation step in the A. tumefaciens-mediated transformation systems fulfills the same
function in pre- /post treatments for particle bombardment; to stimulate target cells to be
meiotically active, where more frequent DNA synthesis and replication occurs, favoring
uptake and integration of foreign genes.
After 12 weeks, one lupin shoot showed strong GUS expression, and was shown by
PCR analysis with gus gene primers to be transgenic, giving 0.32% transformation
efficiency. The transformed shoot could not be rooted in vitro and it flowered and then
died. The root induction success rate using rooting media containing IBA ranged from
0–80% in lupins (Hoffmann 1999; Li et al. 2000). Grafting transformed shoots onto
non-transgenic rootstock was an option but the percent of grafted shoots surviving until
transfer to hydroponics ex vitro was low (0-5%) in narrow-leafed lupin (Hoffmann
1999). To generate transgenic lupin plants with roots, a large number of transformed
shoots had to be produced. Therefore, two further optimisation experiments were done
to improve transformation efficiency.
h) The number of bombardments
Increasing the number of times a tissue was bombarded increased transformation
efficiency in soybean embryonic tissues (Santarem and Finer 1999), cotton
embryogenic cell suspension (Rajasekaran et al. 2000) and various tissue types of
Indian mulberry (Bhatnagar et al. 2002), while it had no significant effect on transient
expression of gus in oil palm embryogenic calli (Parveez et al. 1997).
In this experiment, increasing the number of bombardments to two times, one after the
another, increased gus transient expression, but three bombardments led to damage
visible as brown and dead tissue two days after bombardment and transient expression
decreased.
i) DNA fragment size
Some researchers have found the plasmid backbone was integrated together with
transgenes in transgenic plants produced from direct gene transfer, and others showed
multiple copies of integrated transgenes (Kohli et al. 1999) and rearrangements
(Pawlowski and Somers 1996; Pawlowski and Somers 1998), which caused transgene
silencing induced by multiple copies of transgenes presented in genome (Jorgensen et
al. 1996; Matzke et al. 1994). Transgene clusters as large as megabases have been
found associating in plant chromosome breakage or rearrangement (Svitashev et al.
84
2000). Moreover, presence of the plasmid backbone means that unnecessary genetic
elements are added to transgenic plants, often complicating intellectual property and
issues associated with field release.
Production of transgenic rice plants with low transgene copy numbers and simple
integration patterns by bombardment of linear DNA fragments without plasmid
backbone was reported (Fu et al. 2000). Hence, to avoid integrating the plasmid
backbone, the GUS transgene was separated from its plasmid backbone and bombarded
into lupin explants under the same conditions as whole plasmids. Transient expression
of gus in explants bombarded with gus cassette fragments was significantly lower than
when bombarded with whole plasmids. No surviving explants were obtained from 305
explants bombarded with bar cassette fragments. This might have been due to
concentration of the fragments used because with shorter DNA fragments higher
concentrations of DNA might be needed for effectively coating particles. Zhao et al.
(2003) found that increasing the DNA concentration gave more transformation
frequency when bombarding rice tissue with linear gene cassettes with cecropin B gene
expression cassettes and bar cassette separately. They showed that the sequences of the
gene constructs may play an important role on the variation of transformation efficiency
between different rice varieties. Transgenic rice with a low copy number of the
transgene and simple integration was not achieved by bombardment with linear cassette
of bar, but was generated by bombardment with cecropin B gene expression cassettes.
3.4.2 Developing an optimised protocol
Optimisation of parameters did increase transient expression but did not result in
recovery of stable transformants. After pre- and post-treatment of explants with high
cytokinins levels, a transformed shoot was obtained which died after it failed to produce
roots. Because of the need to generate a large number of transformed shoots, further
optimisation to increase transformation efficiency was carried out. Two consecutive
bombardments did not improve transformation efficiency much (0.32% to 0.4%),
resulting in seven transformed shoots. In this study, embryonic axes were used and the
target tissues were apical meristems. Unlike cultured cells, the shoot apical meristem
has been reported to give lower transformation efficiency or no transformants. Sato et
al. (1993) bombarded two types of explants; shoot apices and embryogenic cell
suspensions of soybean. Embryogenic suspensions yielded a high transformation
frequency while shoot tips yielded no transgenic plants. The paper also provided
85
histological analysis indicating that shoot organogenesis appeared to involve more than
the first two superficial cell layers of a shoot tip, while somatic embryo proliferation
occurred from the first cell layer of existing somatic embryos. The different
transformation results obtained with these two systems appeared to be directly related to
differences in the cell types which were responsible for regeneration and their
accessibility to particle penetration.
A constraint to success with lupin embryonic axes transformation was lack of access to
a suitable high pressure particle delivery system. After experiment 3.3.2, access to a
machine capable of bombarding particles at 400 psi was withdrawn by the commercial
owners of the machine previously used. Another 1125 explants were bombarded using
a lower powered machine at a helium pressure of 300 psi. No transformants were
obtained at the lower pressure.
Another factor that may have limited the success rate was inefficient induction of roots
of transformed shoots. In experiment 3.3.1 (ix), the single transformant was not
successfully induced to generate roots. The reason might be the length of period in
vitro culture because the putative transformants were transferred to elongation medium
for another two weeks before confirming with PCR analysis and then were transferred
to rooting medium. Roots were not induced but the transformed shoot flowered and
died. Exposure to phytohormones for excessive periods has been reported to prevent
root formation in pea (Bohmer et al. 1995). Since then, the putative transformants
obtained from experiment 3.3.2 which survived the selection regime were directly
transferred to rooting medium and grown there for PCR analysis. Nonetheless rooting
efficiency was low (1.75%) comparing to that observed elsewhere where the same
rooting protocol was adopted and achieved up to 80% success. Following grafting of
transformed shoots to rootstocks, callus formed between the shoots and the rootstocks
but a stable union was not formed and shoots died. A possible reason for this is that the
transformed shoots may have been too old (about four months old by the time of
grafting). The need for large numbers of transformed shoots generated from
bombardment is obvious for post-bombardment optimisation.
There was also a high percentage of explant escapes that survived the selection regime
and so gave negative PCR results for a transgene (86%). High escape frequency has
often been reported; as high as 83.6% in wheat (Rasco-Gaunt et al. 2001). High
selection pressure is the main factor to minimise non-transgenic escapes and to gain
more transformants. In narrow-leafed lupin, the concentration of the selective agent,
86
PTT, from 2 mg/L killed non-transformed embryonic axes within four weeks
(Hoffmann 1999). In the experiments described here 10 mg/L was observed to allow
more explants to survive than 20 mg/L but killed non-transformed control plants within
four weeks. To apply a strong selection agent from the start of the selection period
could be disadvantageous. Rajasekaran et al. (2000) found that a 2.5 fold increase in
transformation efficiency was achieved when a gradual increase in selection agent was
applied instead of high a concentration applied from the start of selection procedure. In
our experiments, the embryonic axis that was used as the explant has thick non-
regenerable surrounding tissue, some of which might have received introduced DNA
after bombardment and could have survived in media because the basal cells provided
protection for regenerating shoots.
3.5 Conclusion
The parameters for particle bombardment were developed as a potentially useful
transformation method for narrow-leafed lupins, although the transformation efficiency
was low and there was a high percentage of escapes. Nonetheless, these problems could
probably be overcome by further optimisation of bombardment conditions, selection
regime and rooting procedure.
87
Chapter 4 In planta transformation of narrow-leafed lupin
4.1 Introduction
Amongst the first researchers to conceive the idea of transforming an intact plant were
Feldmann and Marks (1987), who developed the ‘in planta’ seed transformation system
for A. thaliana. A primary aim of their research was to overcome the sometimes high
frequency of somaclonal variants generated after long periods in tissue culture
(Feldmann and Marks 1987). In this early work, germinating A. thaliana seeds were
cocultivated with A. tumefaciens and the plants grown to maturity. Since then, this
approach has been widely adopted and adapted, primarily because it is less labour-
intensive and more rapid than other systems.
4.1.1 Types of in planta transformation
i) Pollen transformation
The principle is to transfer foreign genes into developing microspores or pollen grains.
Transformed pollen is then used for in vivo pollination. Seeds from plants thus
transformed are selected by expression of a selectable marker gene. There are several
protocols available for pollen transformation.
Male germ line transformation (Touraev et al. 1997) was developed by bombarding
unicellular tobacco microspores isolated from excised immature anthers with particles
coated with DNA carrying two marker genes. The bombarded pollen grains were
matured in vitro for six days and then used for in vivo pollination. The transgenic
nature of progenies derived from seeds was confirmed by Southern blot and expression
analysis.
Pollen transformation by vacuum infiltration with A. tumefaciens was reported to
produce transgenic Petunia hybrida (Tjokrokusumo et al. 2000). Pollen was collected
from P. hybrida flowers with recently dehisced anthers and mixed with A. tumefaciens
suspended in pollen germination medium. The mixture was placed in a vacuum
chamber and the vacuum was drawn to -80 Pa for 20 min then slowly released. The
suspension was centrifuged and the pellet was used for in vivo pollination. Transgenic
T1 plants were confirmed by Southern analysis.
88
ii) “Clip’n Squirt”
Reproductive inflorescences were clipped off, a suspension of A. tumefaciens was
applied to the centre of the plant rosette containing immature inflorescences. A few
days later emerging inflorescences were removed and a suspension of A. tumefaciens
was re-applied and plants were then allowed to develop and set seed. Success using this
technique was reported in A. thaliana (Katavic et al. 1994; Chang et al. 1994).
iii) Seed transformation
Imbibed seeds were co-cultivated with A. tumefaciens and the plants grown to maturity.
Seeds were harvested, grown and screened for transformants. More than 14,000
independent transformants of A. thaliana were generated and more than 2,500 mutants
with phenotypes ranging from albinism to late flowering were obtained for functional
genomic analyses (Feldmann 1995; Feldmann and Marks 1987).
iv) Vacuum infiltration
Plant materials of germinating seeds [soybean, de Ronde et al. 2001], seedlings
[Medicago truncatula, Trieu et al. 2000] or mature plants with inflorescences [A.
thaliana, Bechtold et al. 1993, Medicago truncatula, Trieu et al. 2000, B. napus, Wang
et al. 2003] were submerged in an A. tumefaciens suspension whilst a vacuum was
applied. The transformants were selected from T1 seedlings. So far this method has
been used routinely for A. thaliana only. Trials of this method conducted in wheat
(Amoah et al. 2001) and lentil (Mahmoudian et al. 2002) resulted in transient expression
only of the reporter gene gus.
v) Floral dip or spray
This is a simplified method developed from Bechtold’s in planta transformation method
that omits the vacuum step (Clough and Bent 1998). Mature A. thaliana plants with
inflorescences were dipped into A. tumefaciens suspension for 3-5 seconds under gentle
agitation and then grown to maturity. T1 seeds were grown and selected for
transformants. This method was also reported a success in transforming Raphanus
sativus (radish) (Curtis and Nam 2001; Curtis et al. 2002).
Floral spray, a simplified in planta transformation method, was developed initially to
examine whether A. tumefaciens can transfer T-DNA to plant cells without wounding
the plants (Escudero and Hohn 1997). The actual transformants from this method were
89
reported in A. thaliana transformed with the superoxide dismutase gene (Chung et al.
2000).
4.1.2 Mechanism of in planta transformation
As in planta transformation has been widely used, especially with A. thaliana, studies
were done to understand the mechanism of transformation (see review by Bent 2000).
Transformants obtained from this method usually carried independent hemizygous T-
DNA insertion events, suggesting that transformation occurred after the divergence of
individual pollen or egg cell lineages within a flower. To narrow down whether the
male or female germ-line was the primary cellular target of transformation,
transformants were produced by out-crossing after A. tumefaciens inoculation of only
the pollen donor or pollen recipient. No transformant was obtained from the inoculation
of pollen donor and some transformants were obtained from the inoculation of pollen
recipient (Desfeux et al. 2000; Ye et al. 1999). This indicated that the female germ-line
is the target of transformation. The ACT11 promoter which enables gus to express in
gametophyte tissue was used to locate the site of delivery of T-DNA and showed that
the ovules were the target (Desfeux et al. 2000). Additionally, genetic linkage analysis
with a marked chromosome showed that most of transformants (25 of 26 tested) carried
T-DNA on the maternally derived chromosome set (Bechtold et al. 2000).
4.1.3 Factors influencing successful in planta transformation
i) Explants: stages and genotypes
The stage of flower development is crucial to transformation efficiency in A. thaliana.
Transformants generated by in planta infiltration with A. tumefaciens were obtained
only if the gynoecium was ‘open’, in the period greater than five days before anthesis
(Desfeux et al. 2000).
Using A. tumefaciens infiltration, Tague (2001) experimented with four taxa in the
Brassicaceae: A. griffithiana, A. lasiocarpa, A. petraea, and Capsella bursa-pastoris.
Only A. lasiocarpa was successfully transformed. The author suggested that the failure
with the other species may be due to the nature of those species, for example, C. bursa-
pastoris is a low level seed production plant, dipping or vacuum infiltration with A.
tumefaciens solution depressed further seed production as it is extremely sensitive to
submersion of flowers. Also A. petraea produced few viable seeds and this made the
90
detection of rare transformation events difficult. Therefore, a standard protocol utilising
this technique is not generally applicable to many plant species.
Curtis and Nam (2001) found the stage of the developing flower bolt determined
transformation efficiency in R. sativus by floral-dip. Flower development stage was
defined by the inflorescence height as 3-9 cm (primary bolt), 10-15 cm (secondary bolt)
and 16-24 cm (tertiary bolt). No transformants were obtained from the tertiary bolt
regardless of the type and concentration of surfactants used, while the highest efficiency
was achieved from the primary bolt, seven times more efficient than from flowers of the
secondary bolt under the same experimental conditions.
ii) Components of infiltration and inoculation media
The presence of a surfactant and sucrose in infiltration and inoculation media are crucial
to in planta transformation success. In floral dip transformation, increasing the
concentration of the surfactant Silwet L-77 from 0.005% to 0.02% - 0.1%, gave 20-fold
greater transformation efficiency. Sucrose as a source of carbon in the inoculation
medium gave a higher transformation efficiency than glucose, and mannose in the
medium killed explants (Clough and Bent 1998).
The type and concentration of surfactant affected transformation efficiency in R. sativus
transformation by floral-dip. Silwet L-77 at 0.05% gave the highest transformation
efficiency when compared to Pluronic F-68 and Tween 20 (Curtis and Nam 2001).
iii) Conditions of treatment
The incubation temperature from days 1 - 30 post infiltration influenced the in planta
transformation efficiency of A. thaliana plants. At 29oC more GUS expression was
observed than at 25oC (Rakousky et al. 1998).
To investigate this technique as the potential alternative genetic transformation method
for lupins, the experiments were divided into 2 sections according to types of explant
used: seedlings transformation and flowers transformation. For seedlings transformation
the experiments were designed to optimise the essential parameters for success, namely;
infiltration time and sonication time using toluidine dye (more economical),
Agrobacterium growth phase and composition of infiltrated media. For flower
transformation the experiments were designed to optimise the essential parameters for
success, namely; type and concentration of wetting agents, a presence of cytokinin BAP
91
and infiltration time. Then the optimised parameters were combined to transform a
large number of lupin explants. Further investigations were added to explain the
outcomes of the experiments such as viability of Agrobacterium versus gene transfer
rate and the study of lupin flower morphology at the different stages.
4.2 Materials and Methods
4.2.1 Plant materials
a) Narrow-leafed lupin
Narrow-leafed lupin (L. angustifolius) cv Unicrop was used. Seed was obtained from
DAFWA. Plants were grown as described in 2.1.2. In a temperature-controlled
glasshouse, plants were grown at a density of five lupin plants per 600 mL pot for
flower transformations and ten plants per 600 mL pot for seedling transformations.
b) A. thaliana
Arabidopsis thaliana cv Columbia seed was used. Seeds were surface-sterilised by
shaking in absolute ethanol for 2 min, then shaking twice with 1.25% (w/v) of NaOCl
plus 0.01% Tween 80 in water for 10 min, following by washing with sterile water four
times. Sterile seeds were germinated in germination media plates containing half-
strength MS salts (Sigma). Plates were placed at 4oC for four days for vernalisation.
Plantlets were transferred to potting mix as described in section 2.1.2 and grown in a
glasshouse.
4.2.2 Transformation of lupins using vacuum infiltration
This transformation method was based on one described for Medicago truncatula via A.
tumefaciens through infiltration of seedlings or flowers (Trieu et al. 2000). The
experiment was done with both lupin flowers and seedlings. Lupins were grown to the
stage where the raceme had flowers ranging from small buds to open flowers.
Seedlings at 14-21 days post-germination were used for seedling transformation. Half
strength MS liquid medium was used as the basal medium in these experiments.
Optimisation was done using pCG1258, which contains a gus reporter gene, to
determine the penetration of A. tumefaciens and pCAMBIA3201 was used to determine
the [transient] transformation efficiency. A. tumefaciens cultures were prepared
following method I described in 2.2.5. Thirty flowering plants and seedlings were
infiltrated per treatment unless specified.
92
Vacuum infiltration was carried out using vacuum-proof chamber specially built to the
size that was able to handle plants growing in pots. To infiltrate plants, the pot was
inverted and the top two-thirds of the plant was dipped into a suspension of A.
tumefaciens in infiltration medium. A vacuum of 25 mm Hg was applied, held for 3
min and released. Application of vacuum was repeated twice more. After infiltration,
plants were taken out from the A. tumefaciens suspension and laid horizontally to drain
so that bacteria did not enter the soil, and allowed to dry overnight. Plants were then
grown in a growth chamber at 22-29oC and at least 95% humidity for six days and
transferred to a glasshouse to complete their life cycle. Seeds were harvested from them
and grown in 96-well trays until the second leaves were fully expanded and then
sprayed with solution containing 50 mg/L PTT and a drop of Silwet L-77 (wetting
agent) for selection of transformants. The survivors were transferred to pots and grown
in a glasshouse.
4.2.3 Wounding explants with sonication
Seedlings were sonicated before infiltration with A. tumefaciens, as described above.
Seedlings 2-3 weeks old were trimmed of leaves to expose young shoots. The pot
containing the plant was inverted and the top two-thirds of the seedling submerged into
distilled water inside a water bath sonicator for the required period.
4.2.4 Isolation of A. tumefaciens cells from infiltrated lupin seedlings and 3-
ketolactose test for A. tumefaciens cells
Solution for 3-ketolactose test
- Benedict reagent
173 g/L Na-citrate
100 g/L NaCO3
17.3 g/L CuSO4
- Lactose medium
10 g/L lactose
1 g/L yeast extract
20 g/L agar
This procedure was to determine viable A. tumefaciens cells overtime post-infiltration
of lupin seedlings. 3-ketolactose test (Bernaerts and De Ley 1963) was used to ensure
colonies grown on medium were the A. tumefaciens colonies. A. tumefaciens, grown on
93
lactose-containing medium, produces 3-ketolactose, which reacts with Benedict reagent
and resulted in a distinct yellow ring of Cu2O around the A. tumefaciens colony.
The Benedict reagent was prepared by dissolving Na-citrate and NaCO3 in 600 mL of
deionised water under heating. If a precipitate occurred, the solution was filtered using
filter paper. CuSO4 was dissolved separately in 150 mL deionised water and slowly
added to the previous solution with stirring and a final volume of 1 L was made.
Shoot tips (2 cm from apex and leaves trimmed to the stem) of infiltrated lupin seedling
were collected (5 shoot tips per replicate and 2 replicates per collection) at 0, 2, 4 and 6
days after infiltration with A. tumefaciens suspension. Shoot tips were homogenised
with 50 mL sterile deionised water in the blender for 2 min then diluted for plating. A
50 µL aliquot of the dilute lysate was plated onto sterile solid lactose medium
containing the antibiotic corresponding to the antibiotic resistance gene in the plasmid
(2 replicates per diluted lysate) and incubated for 2 days at 28oC. Then the colonies
grown on medium were flooded with a shallow layer of the Benedict reagent and left at
room temperature. For A. tumefaciens cells, yellow rings developed around the
colonies, usually within 1 h.
4.2.5 Sample preparation for scanning electron microscopy (SEM)
Before the explants were examined by SEM, they were fixed, dehydrated, dried to the
critical point and sputter-coated with gold. Explants were fixed in 3% glutaraldehyde in
0.025 M phosphate buffer (pH 7.0) overnight at 4C. If the explants did not sink
immediately when placed in this fixative, the lid was removed and the vials were placed
in a desiccator where a slight vacuum was applied. After 15–20 min, air was allowed to
enter the desiccator. If the specimens still did not sink, the vacuum process was
repeated. After an overnight incubation in fixative, explants were washed in several
changes of 0.025 M phosphate buffer. If required, they were post-fixed in 1% osmium
tetroxide in 0.025 M phosphate buffer pH 7.0 for 2 h at room temperature, then washed
in several changes of buffer in a fume cupboard.
After fixation the explants were dehydrated through two changes of each of 30%, 50%,
70%, 90% and 100% ethanol, each of 15 min. The 100% ethanol was replaced with two
changes of 100% amyl acetate for 15 min each.
The explants were then dried in a critical point drier (Balzers Union; Model FL-9496).
After attaching the explants to a SEM specimen holder (stub) with conductive carbon
paste or carbon tape, explants were sputter coated with gold particles with a sputter
94
device (Balzers Union). The explants were then ready for examination with SEM
(Philips SEM XL20, Veterinary School, Murdoch University).
4.2.6 In planta transformation of A. thaliana
An in planta transformation procedure was done with the infiltration medium optimised
for lupin. The transformation procedure used in this experiment was based on a method
for in planta transformation with vacuum infiltration (Bechtold et al. 1993).
Arabidopsis thaliana plants (4.2.1b) were used approximately 6 days before flowers
opened. Pots were inverted and plants submerged so that two-thirds of the whole plant,
including flowers, were in the A. tumefaciens solution (4.2.2). Vacuum pressure of 25
mm Hg was applied for 10 min in a vacuum chamber as described above. The vacuum
was then released. Plants were allowed to drain in a horizontal position overnight and
grown in a plastic tent in a glasshouse to maintain the humidity above 95% and the
temperature at 26-29oC for 6 days. They were then removed from the tent and allowed
to grow in the glasshouse (20-25oC) to set seed.
Seeds were sterilised by shaking with 100% ethanol for 2 min, following with 1.25%
(w/v) NaOCl solution and 0.01% Tween 80 for 10 min with two changes of sterilizing
solution, followed by four rinses in sterile distilled water. Sterile seeds were mixed
with MS agar media (3% sucrose and 0.7% agar) containing 10 mg/L PTT and 0.1 mg/L
NAA while it was still in liquid stage (~40 oC; touchable by the back of hand) and
plated out. Plates were sealed with parafilm and placed at 4oC for four days for
vernalisation then grown in a tissue-culture room for selection of transformants for 14
days. Transformants were subcultured to selection medium twice for a total of 28 days
and transgenic seedlings were planted in pot with soil mix and transferred to the
glasshouse.
4.3 Results
4.3.1 Vacuum infiltration transformation of lupin seedlings
i) Infiltration time and sonication time
Preliminary experiments were done to determine an effective infiltration time for A.
tumefaciens cells into shoot tips of L. angustifolius seedlings. Experiments were done
by infiltrating tips with 1% Toluidine Blue and 0.02% Silwet L-77 for 3 min repeated
twice, at 10 min, 20 min and 30 min. Toluidine Blue acts as a visual indicator of
95
infiltration depth in the tissue. Figure 4.1 shows that dye only penetrated the apical area
after 30 min treatment. A further experiment was done with the addition of a 5 min
sonication treatment prior to 10 min infiltration. Sonication before infiltration allowed
greater penetration of tissue at the apical area (Fig. 4.2).
Figure 4.1 The effect of different infiltration times on penetration of L. angustifolius
shoot tips by 1% Toluidine Blue dye solution is shown with a typical shoot tip for each
treatment. A: at 3 min repeated twice, B: at 10 min, C: at 20 min and D: at 30 min
showing penetration (arrowed) of cells in the apical region. Bar is 500 µm.
96
Figure 4.2 Shoot tip of L. angustifolius infiltrated with 1% Toluidine Blue after 5 min
sonication then 10 min infiltration, showing penetration of the dye into cells around the
meristematic region. Bar is 250 µm.
The dye infiltration experiments were preliminary to A. tumefaciens-infiltration
experiments with the gus gene marker. The percentage of shoots that stained blue from
transient gus-intron expression after each treatment was used to evaluate transformation
efficiency instead of the number of blue regions per plant because the latter were of
variable size and normally appeared as generalised areas rather than described loci. The
sonication treatment was applied for 0-17 min with 10 min infiltration with A.
tumefaciens, and the appearance of blue regions (GUS) recorded at Day 6 after
infiltration. No infiltration was observed with shoots sonicated at 0 and 5 min (Fig.
4.3). Only in shoots subjected to 15 min sonication was there a significant difference in
the percentage of shoots showing GUS stained regions compared to the control (no
sonication), while there was no significant difference in the survival rate of shoots after
any of the sonication treatments. Sonication treatments of 15 min with 10 min
infiltration gave the best outcome of shoots expressing GUS, therefore this treatment
was used to optimise infiltration times.
97
Figure 4.3 The effect of sonication time on L. angustifolius shoot survival and
penetration of A. tumefaciens cells as determined by gus gene expression at 2 weeks
post treatment. The means bars that have the same letter are significantly different at
the 0.05 level analysed by using one-way ANOVA with Tukey HSD.
At 15 min sonication treatment, shoots that were not subjected to infiltration had no
GUS stained regions, while the percentage of shoots showing GUS expression increased
as infiltration time increased from 5-15 min, although this was not statistically
significant (Fig. 4.4). The survival rate of treated shoots was negatively correlated with
increasing infiltration time. All shoots sonicated for 15 min but without infiltration
treatment survived, whereas survival was reduced when shoots were infiltrated for
longer times. Shoots infiltrated for 20 min appeared vitreous after treatment and
quickly browned. At Day 6 when shoots were stained, all of these shoots were dead.
The 10 min infiltration time was selected because 12.22% (±2.22%) of shoots showed
GUS expression and 65% of explants survived. This was chosen over 15 min
infiltration because it gave a better percentage of shoots expressing GUS at 25.83%
(±14.29%) but no surviving shoots were obtained after 6 days.
0
20
40
60
80
100
120
0 5 10 13 15 17
Perc
en
tag
e
Sonication Time (min)
a b
a,b
% of shoots showing GUS stained regions % of shoots surviving after treatment
98
Figure 4.4 The effect of infiltration time after 15 min sonication treatment on the
percentage of L. angustifolius shoots showing gus gene expression and the survival rate
of shoots after treatment. The mean bars which have the same letter labelled have
significant difference at the 0.05 level analysed by using one-way ANOVA with Tukey
HSD.
ii) A. tumefaciens growth phase
Three different stages during the exponential growth phase of A. tumefaciens were
tested, namely early, mid and late exponential (Table 4.1). The final concentration of A.
tumefaciens used in this optimisation was O.D.1.8-1.9. The percentage of shoots
showing GUS expression obtained from the three stages was not significantly different.
However, the intensity of gus-intron expression obtained from shoots inoculated with
early exponential grown A. tumefaciens strain AGLO was stronger as determined by the
intensity of blue colour from X-gluc staining. The viability of early exponentially
grown A. tumefaciens was slightly less than with late exponentially grown A.
tumefaciens after six infiltrations within 3 h. Since early exponential growth phase gave
stronger gus-intron transient expression, it was used for further experiments.
0
20
40
60
80
100
120
0 5 10 15 20
Perc
en
tag
e
Infiltration Time (min)
ab
a, b a, b
% of shoots showing GUS stained regions % of shoots surviving after treatment
99
Table 4.1 The effect of A. tumefaciens (AGLO) growth phase to percentage of L.
angustifolius shoots showing GUS expression containing the gus-intron construct and
its intensity.
A. tumefaciens growth
phase
Shoots
expressing GUS
(%)
Intensity of GUS
expression
Viability of A.
tumefaciens
after
infiltration
(%)*
Early exponential
growth phase
(OD~0.5-0.6)
Mid exponential
growth phase
(OD~1-1.2)
Late exponential
growth phase
(OD~1.8-1.9)
13.30±3.33
10
13.30±8.81
+++
++
++
72.03
Not assayed
93.60
*determined by plating on agar containing selective agent for A. tumefaciens
iii) Composition of infiltration medium and gus-intron transient expression
There were two stages of optimisation to obtain the optimal infiltration medium
compositions for the best transformation of narrow-leafed lupin seedlings, as
determined by transient expression of the gus-intron gene. First, a study of five
different media compositions (Medium 1-5) was carried out to find the best base
medium. Then, three components of infiltration medium that were reported to have
impact on transformation efficiency and vitality of infiltrated explants were optimised
(Table 4.2) with the selected base medium. These were: the sucrose and glucose
concentrations, and presence or absence of sodium thiosulfate.
There was no significant difference between 5 base media in the first stage optimisation.
Transient expression of the gus-intron gene was least in Medium 2 used in A. thaliana
vacuum infiltration transformation, while Medium 1 used for Medicago seedling
vacuum infiltration transformation gave better transient GUS expression. Multiple
shoot induction Medium 3 was a MS-based medium that was used in in vitro lupin
transformation after co-cultivation with A. tumefaciens (Pigeaire et al. 1997). Modified
LB Medium 5 was used to induce the A. tumefaciens virulence in Method I and also
applied directly to wounded apical area of embryogenic axes of lupins prior to co-
cultivation in in vitro lupin transformation (Hoffman 1999). The medium that gave the
highest percentage of shoots showing gus-intron transient expression was Medium 4,
which was the MS basal medium used for virulence induction and resuspension of A.
100
tumefaciens in the A. tumefaciens virulence induction Method II (2.2.5). However, the
modified LB medium gave stronger gus-intron transient expression and one of the
shoots showed strong transient expression of GUS; the whole embryonic axis strongly
stained blue (Fig. 4.5E). Hence, modified LB medium was used in further optimisation.
The use of sodium thiosulfate to enhance the surviving rate of infiltrated shoots along
with various glucose concentrations was studied (Medium 6-11). The percentage of
shoots showing GUS expression decreased as the concentration of sodium thiosulfate
was increased (Medium 6, 7 and 10). Numbers of shoots per plant were counted for 30
plants each at Day 7 post-infiltration with and without 1 mM sodium thiosulfate. The
infiltration medium without sodium thiosulfate gave an average of 1.67±0.31 shoots per
plant, significantly higher than the medium with sodium thiosulfate. At 1 mM sodium
thiosulfate, the number of shoots showing GUS expression was decreased when the
increment of glucose concentration was increased (Medium 7, 8 and 9). However, the
last experiment in media composition optimisation (Medium 11) in which 30 g/L
glucose was added with no sodium thiosulfate gave a much improved percent of shoots
showing GUS expression at 35±5, which was significantly higher than for those
infiltrated with Medium 1 (used for Medicago transformation) and Medium 2 (used for
A. thaliana transformation) at 0.05 level Tukey HSD. Medium 11 was used to
transform 50 lupin seedlings by vacuum infiltration for 10 min after 15 min sonication.
101
Table 4.2 Effect of infiltration media composition on gus-intron transient expression
from A. tumefaciens as determined by the number of infiltrated L. angustifolius shoots
showing GUS expression. The media types with the same letter label are significantly
different in % of shoots showing GUS staining regions at the 0.05 level, analysed by
using one-way ANOVA with Tukey HSD.
Medium Infiltration Media Sucrose
(g/L) Glucose
Sodium
thiosulfate
(mM)
% of shoots
showing GUS
expression
Number of
shoots/plant at
Day 7 post-
infiltration
1a Medicago seedling
infiltration medium
(Trieu et al. 2000)
10 0 0 11.25±1.25 N/A
2b A. thaliana
infiltration media
(Bechtold and
Bouchez 1995)
50 0 0 5±5 N/A
3 Multiple shoot
induction medium
for lupins (Pigeaire
et al. 1997)
25 5g/L 0 16.25±3.75 N/A
4 MS with AGLO
virulence induction
method II (2.2.5)
0 10mM 0 20 N/A
5 Modified LB
medium (2.2.5)
0 10mM 0 18.33±1.67 N/A
6 Modified LB
medium
0 10mM 0 20 1.67±0.31*
7c Modified LB
medium
0 10 mM 1 11.55±3.85 0.83±0.17*
8d Modified LB
medium
0 100 mM 1 10.55±0.55 N/A
9e Modified LB
medium
0 200 mM 1 4.17±4.17 N/A
10f Modified LB
medium
0 10 mM 5 6.25±6.25 N/A
11a,b,c,d,e,f Modified LB
medium
0 30g/L (166.7
mM)
0 35±5 N/A
Numbers labelled with* means they have significant difference at the 0.05 level
analysed by one-way ANOVA with Tukey HSD.
iv) Transformation of lupin seedlings by sonication and infiltration
A total of 1720 plants tested during optimisation experiments were grown to produce
seeds. Of these seeds, 32 were from 50 seedlings treated under optimised conditions
102
and medium were screened for expression of the bar gene by the application of 50 mg/L
phosphinothicin (PPT) to the leaves. All the seedlings died, as did the controls, despite
the significant improvement in A. tumefaciens infection and gus-intron transient
expression by sonication and infiltration (Fig. 4.5).
Figure 4.5 Infiltrated L. angustifolius shoots before and following optimisation of
sonication and infiltration times and media compositions. a: Treated shoots before
optimisation showing A. tumefaciens cells attached as determined by transient GUS
expression. b: Treated shoots after optimisation showing A. tumefaciens cells attached
as determined by GUS expression. c: Treated shoots before optimisation showing no
gene transfer as determined by gus-intron transient expression. d: Treated shoots after
optimisation showing gene transfer as determined by gus-intron transient expression
(indicated by arrow). e: Treated shoots after optimisation showing whole embryogenic
axis stained with gus-intron transient expression (indicated by arrow). Bar is 1 cm.
v) Viability of A. tumefaciens after infiltration versus gene transfer rate (in vitro)
The viability of A. tumefaciens cells over time on the lupin seedlings following
infiltration was determined to test if bacterial cells were dying before they could transfer
103
T-DNA to the seedlings. GUS expression on explants in vitro as determined by the
number of shoots showing blue regions showed that T-DNA transfer began at Day 2 of
the co-cultivation period, then increased rapidly to a maximum by Day 6 (Fig. 4.6). The
viability of A. tumefaciens cells in planta was examined by counting the numbers of
viable cells on the treated seedlings over time post-inoculation. A. tumefaciens cells
were isolated from seedlings (4.2.4) and plated on medium containing lactose as a
carbon source. The presence of purple-blue 3-ketolactose deposits in rings around
colonies indicated that they were, in fact, A. tumefaciens colonies, and not another
species of contaminating bacteria. The assay showed that A. tumefaciens cells had a
very low rate of survival on the seedlings, and that by Day 4, when T-DNA transfer in
vitro was approaching maximum efficiency, survival of A. tumefaciens cells on the
plant was very low (Table 4.3), about 103 times less than routinely used for successful
transformation of lupins with the in vitro lupin transformation method (Pigeaire et al.
1997).
Figure 4.6 T-DNA transfer to L. angustifolius seedlings during a six-day co-cultivation
period in vitro as determined by gus gene expression in [T0] shoots.
0
10
20
30
40
50
60
70
80
90
0 2 4 6
% o
f sh
oots
sh
ow
ing G
US
regio
ns
Post-inoculated time (days)
104
Table 4.3 The viability of A. tumefaciens cells on lupin seedlings in planta during 6
days post-inoculation as determined by the number of A. tumefaciens colonies counted
on the medium containing lactose as a carbon source.
Post-inoculated time (days) No. of colonies/ g fresh weight
(x106) ± S.E
0
2
4
6
82±3.8
52±1.2
0.18±0.012
0.03±0.001
4.3.2 Vacuum infiltration transformation of L. angustifolius flowers
i) Effect of wetting agent and BAP in infiltration medium
Tween 80 and Silwet-L77 were compared as wetting agents to reduce surface tension
and to ensure intimate contact of A. tumefaciens cells with the plant tissue. The two
wetting agents were compared to determine their impact on flowers in vacuum
infiltration transformation experiments (Table 4.4 A). Both compounds were used at
0.02% (v/v) in the basal infiltration media (4.2.2). Toxicity was calculated as
percentage of pods that developed per treatment (% pod set), compared to control plants
treated in the same way, but without surfactant (control 2) and without infiltration and
surfactant (control 1). An indirect measure of effectiveness of the compounds was to
stain treated plant tissue with X-gluc to visualise expression of the gus gene in A.
tumefaciens cells [pCGP1258 was used (not gus-intron)]. There was no significant
difference between Silwet L-77 and Tween 80 in ability to help A. tumefaciens cells to
penetrate through the infiltrated flowers. Hand cross sections of infiltrated flowers after
treatment with both compounds showed similar depth of penetration, as determined by
GUS expression. However the toxicity of detergents determined by the percentage of
pod set showed that treatment with Tween 80 caused flowers to abort slightly more
often than Silwet L-77 (Table 4.4 A), therefore Silwet L-77 was used in further
experiments.
To determine the optimum concentration of Silwet L-77 for flower infiltration, various
concentrations were compared. Controls had no wetting agent in the infiltration
medium (Table 4.4 B). Higher Silwet L-77 concentrations caused a significant
reduction in pod set and toxicity could be seen in deteriorated flower morphology (Fig.
105
4.7). Silwet L-77 at 0.01% gave the highest pod set, which was not significantly
different from the control (less toxic than other treatments), therefore it was used in later
experiments. In addition, to determine the effect of the plant growth regulator, the
cytokinin BAP, as used in the Medicago flower vacuum infiltration method of Trieu et
al. (2000), 0.04 μM BAP was added to infiltration media containing 0.02% and 0.05%
Silwet L-77. The percentage of pod set obtained from these experiments showed that
the hormone did not improve the vitality of flowers so this hormone was omitted from
the infiltration media in further experiments.
Table 4.4 Effect of surfactant type and concentration and combination with 0.04 μM
BAP on pod set in L. angustifolius flower spikes. The treatments labelled with the same
letter have significant differences in % pod set at the 0.05 level by one-way ANOVA
with Tukey HSD.
Experiment Treatment
Number
of plants
tested
Number of
flowers
per plant*
Number
of pods
per
plant*
% Pod set*
(A) Type of
wetting agent (at
0.02%)
Control 1
Control 2
Silwet L-77
Tween 80
23
24
27
27
3.69±0.32
7.25±0.75
7.22±0.69
7.03±0.67
1.86±0.20
2.75±0.22
1.89±0.26
1.56±0.17
63.01±9.93
50.80±7.83
37.79±7.90
34.19±7.60 (B)
Concentration of
Silwet L-77 and
0.04μM BAP
Controla, b, c, d
0.01%
0.02%a
0.02%+BAPb
0.05%c
0.05%+BAPd
13
17
20
21
12
18
5.00±0.67
7.35±0.85
6.85±0.60
6.43±0.47
5.08±0.59
4.89±0.29
2.23±0.26
2.06±0.28
1.55±0.21
1.52±0.27
1.00±0.65
0.50±0.19
53.17±7.28
32.05±4.04
26.33±4.54
24.65±5.11
19.18±11.22
10.89±4.44
*values are mean±S.E
106
Figure 4.7 Morphology of flowers (3 days after infiltration) affected by application of
the surfactant Silwet L-77 at different concentrations. Bars are 5 cm.
ii) Effect of infiltration time
To determine the optimum infiltration time, the treatments shown in Table 4.5 were
done. Silwet L-77 at 0.01% was added to infiltration media in all treatments except the
control. Two infiltrations of 3 min each gave the highest percentage pod collected,
while the increased infiltration time caused more flowers to abort. Flowers that were
infiltrated longer than 10 min all aborted. At 10 min infiltration time, only one pod was
set on one treated plant. When, one week later, the treatment of two infiltrations of 3
min each was repeated, fertilised flowers wilted and there were fewer pods set than after
only one treatment.
107
Table 4.5 Effect of infiltration time to the percentage of lupin pod collected. There was
no significant difference between treatments in % pod collected set at 0.05 level
analysed by one-way ANOVA with Tukey HSD.
Treatment Number
of plants
tested
Number of
flowers per
plant*
Number of
pods
collected
per plant*
% pod
collected*
Two infiltrations for 3
min each with no
Silwet L-77 (control)
Two infiltrations for 3
min each
Two infiltrations for 3
min each, then
treatment repeated
again after one week
10 min infiltration
15 min infiltration
20 min infiltration
5
5
5
5
5
5
5.6±1.8
4.4±0.87
6.2±1.24
7.0±0.63
4.8±1.46
5.4±0.87
2.2±0.66
0.8±0.2
0.8±0.2
0.2±0.2
0
0
40.67±12.49
19.52±6.32
16.52±5.81
4±4
0
0
*values are mean±S.E
iii) Flower infiltration with optimum media and conditions
After optimising the important parameters to maximize the delivery of A. tumefaciens
with minimum damages to flowers, and the outcomes from seedling infiltration media
optimisation to maximize the transformation efficiency, ten plants were infiltrated twice
for 3 min each with Medium 11 (Table 4.2) containing 0.01% Silwet L-77 and A.
tumefaciens cells from early exponential stage were concentrated to a density of OD
1.87. After infiltration flowers looked sick and vitreous. The young flowers did not
open or develop and eventually they wilted and fell off. The flowers lost their petals,
little pods were seen but wilted and died a week after infiltration. Not surprisingly, no
pods were obtained. To test if the high glucose concentration and composition of LB
medium in Medium 11 caused flower damage, the infiltration medium was changed to
108
Medium 4 which was MS basal with less glucose [10 mM in Medium 4 and 166.7 mM
in Medium 11], and which gave the second best transformation efficiency in seedling
infiltration. Thirty flowering plants were infiltrated using the same conditions as used
with Medium 11. The percentage of pod collected was 10.82. Five immature pods
were collected at 4 weeks after infiltration for staining with X-gluc. These pods were
opened, submerged and vacuum infiltrated in X-gluc solution to let the solution
penetrate into the seeds. One of the pods had seeds that stained blue, indicating GUS
expression (Fig. 4.8 a). Seeds were sectioned and seed coats removed. This revealed
that most of the GUS expression was in the seed coat (Fig. 4.9). In this experiment,
pCGP1258 was used (not gus-intron), therefore it is not clear whether GUS expression
was from adhering A. tumefaciens cells or from transformation of the seed coat. To
determine the cause, DNA was extracted from this pod and primers for genes picA and
virA within A. tumefaciens and the bar gene within its plasmid were used to amplify
them. A portion of the bar and pic A genes were amplified from seed coat DNA (Figs
4.10 and 4.11) but not from pods or seeds where the coat was excluded. Although virA
was not amplified, even where A. tumefaciens cells were used as a positive control, the
amplified fragment of picA was an adequate indication that the GUS expression was
possibly from A. tumefaciens cells.
109
Figure 4.8 Immature L. angustifolius seeds from randomly sampled pods collected at 4
weeks after infiltration transformation of flowers with A. tumefaciens. Seeds from
infiltrated (a) and non-infiltrated (b) flowers. Both were stained with X-gluc. Petri-
dish diameter is 90 mm.
a)
b)
110
a)
b)
Figure 4.9 Seed coat from X-gluc staining immature seed (a) and seed after coat
removed (b). Bar is 0.5 cm.
111
Figure 4.10 Gel electrophoresis of amplicons produced by using Shbar1 and Shbar1R
primers (2.5.2) to amplify a portion of bar gene with DNA extracted from samples
indicated by location in gel lanes. Lane M: 1 kb Marker, Lane 1: water, Lane 2:
pCGP1258, Lane 3: lupin leaf, Lane 4: transgenic lentil leaf containing gus and bar,
Lane 5: lupin pod, Lane 6: pod from infiltrated lupin flower, Lane 7: transgenic lentil
geminated seed (seed coat excluded), Lane 8: seed (seed coat excluded) from infiltrated
lupin flower (no DNA dilution), Lane 9: seed coat from transgenic lentil, Lane 10: seed
coat from infiltrated lupin flower (no DNA dilution), Lane 11: seed coat from infiltrated
lupin flower (1:5 DNA dilution), Lane 12: seed coat from infiltrated lupin flower (1:10
DNA dilution), Lane 13: seed coat from infiltrated lupin flower (1:20 DNA dilution),
Lane 14: seed (seed coat excluded) from infiltrated lupin flower (1:5 DNA dilution),
Lane 15: seed (seed coat excluded) from infiltrated lupin flower (1:10 DNA dilution).
Arrows indicate a portion of bar gene amplified from DNA extracted from seed coat of
seed from infiltrated lupin flower.
Seed coat from infiltrated
lupin flowers
112
Figure 4.11 Gel electrophoresis of amplicons produced using primers (2.5.2) to amplify
a portion of picA (Lane 1-10) and virA (Lane 11-20) with DNA extracted from samples
indicated by their location in gel lanes. Lane M: 1 kb Marker, Lane 1: water, Lane 2: A.
tumefaciens stain AGLO, Lane 3: lupin leaf, Lane 4: transgenic lentil leaf containing
gus, Lane 5: seed coat from infiltrated lupin flower (no DNA dilution) arrowed, Lane 6:
pod from infiltrated lupin flower (no DNA dilution), Lane 7: seed (seed coat excluded)
from infiltrated lupin flower (no DNA dilution), Lane 8: seed coat from infiltrated lupin
flower (1:5 DNA dilution), Lane 9: pod from infiltrated lupin flower (1:5 DNA
dilution), Lane 10: seed (seed coat excluded) from infiltrated lupin flower (1:5 DNA
dilution), Lane 11: water, Lane 12: A. tumefaciens stain AGLO, Lane 13: lupin leaf,
Lane 14: transgenic lentil leaf containing gus, Lane 15: seed coat from infiltrated lupin
flower (no DNA dilution), Lane 16: pod from infiltrated lupin flower (no DNA
dilution), Lane 17: seed (seed coat excluded) from infiltrated lupin flower (no DNA
dilution), Lane 18: seed coat from infiltrated lupin flower (1:5 DNA dilution), Lane 19:
pod from infiltrated lupin flower (1:5 DNA dilution), Lane 20: seed (seed coat
excluded) from infiltrated lupin flower (1:5 DNA dilution).
iv) Mechanism of A. tumefaciens delivery to flowers.
When GUS expression was discovered in seeds (Fig. 4.8) flower morphology was
studied to investigate the route that A. tumefaciens cells took to enter the ovule. The
studies were undertaken using SEM and sectioned materials (Fig. 4.12). Lupin flowers
from the dome to anthesis stages were processed for investigation under a scanning
electron microscope (SEM) (4.2.4). At the dome stage, the initiation of carpel and
anthers could be observed (b) and early carpel development (c) where its margins were
not yet fused. At this stage, the initiation of ovules was not seen (d). At the hooded
stage, the carpel was enclosed and ovules were already initiated inside the gynoecium
Seed coat from
infiltrated lupin flower
113
(h) with the stigma already developed. The stigma was sectioned and sealed channels
were observed (g). The stigma at the anthesis stage elongated further and that made it
more difficult to deliver A. tumefaciens cells by mechanical means without damage to
the flower. Furthermore, the gynoecium was enclosed securely by many layers of petals
(i), probably preventing access of A. tumefaciens cells. This may be the reason why
flowers collapsed after infiltration.
a) Dome stage flower sample before SEM processed.
b) Carpel and stamen initiated.
c) Early carpel development.
1 mm
Unfused
carpel
margins
114
d) Cross-section of early carpel stained with Safranin O showing open carpel
(arrowed) with no ovules initiated (bar is 100 μm).
e) Hooded stage flower sample before SEM process.
f) Carpel with stigma already developed at hooded stage.
1mm
115
g) Section of style showing absence of any channel within it.
h) Cross-section of hooded stage flower stained with Safranin O showing enclosed
ovules (arrowed). Bar is 200 μm.
i) Gynoecium enclosed securely by many layers of petals (arrowed). Bar is 200 μm.
Figure 4.12 L. angustifolius flower morphology at different stages of development.
116
4.3.3 A. thaliana in planta transformation
A. thaliana (cv Columbia) was used as a positive plant control in transformation [with
the base medium and with the medium developed after optimisation]. Three
experiments were done as described previously (4.2.6). The base infiltration medium
(Trieu et al. 2000) was used in the first experiment and the developed infiltration
medium (Medium 11 in Table 4.2) was used in the second and the third experiments. In
addition, in the third experiment, plants were subjected to a second vacuum infiltration a
week after first infiltration. Seeds were collected as a pool per pot and seedlings were
screened for transformants under selection (10 mg/L PPT) (4.2.6) in the medium in
which they grew. The number of seeds was estimated by weight. Three samples of 30
mg were counted and the average number of seeds per 100 mg was calculated to be
3902 seeds. The surviving plants were analysed by PCR to confirm the presence of
transgenes using GUSintL&R primers (2.5.2). Transformation efficiency increased
35.6% when the developed infiltration medium was used and it increased five fold when
plants were subjected to two infiltrations one week apart. Some transformants were
stained with X-gluc to view GUS expression (Fig. 4.13).
Table 4.6 Transformation efficiency of A. thaliana in planta transformation with
infiltration medium before and after modification.
Experiment No. of
plants/pot
Seed weight
(mg)
No. of
seeds
No. of
transformants
%
transformation
efficiency
1 3 682 26611 50 0.188
2 2 466 18183 41 0.255
3 2 295 11511 109 0.947
117
a) Transformant surviving in selection media.
b) A. thaliana transformant stained with X-gluc showing gus expression.
Figure 4.13 Transgenic A. thaliana plants obtained from infiltrated plants with Medium
11. Bar is 1 cm.
4.4 Discussion
4.4.1 Vacuum infiltration of lupin seedlings
In in planta seedling transformation, the target tissues were apical meristems. Delivery
of A. tumefaciens cells to meristems where gene transfer could take place was the
primary objective of the experiments. The secondary objective was to enhance A.
tumefaciens virulence to increase transformation efficiency. To deliver A. tumefaciens
cells to meristems more effectively, open access for A. tumefaciens cells to come into
contact with target tissues must be created. Wounding explants by sonication was
effective. In this wounding method, the ultrasound produces uniform micro-fissures
and channels throughout the subjected tissue allowing the A. tumefaciens to penetrate
meristematic tissue buried under several cell layers (Trick and Finer 1997), and
metabolites released from wounded plants may induce A. tumefaciens virulence genes.
It increased A. tumefaciens cell delivery to the internal plant tissues. Levels of 100-
1400-fold increase in transient GUS expression have been demonstrated by others in
various tissues of soybean, Ohio buckeye, cowpea, white spruce, wheat and maize
Non-transformed
A. thaliana
Transformed A. thaliana
118
(Trick and Finer 1997). A combination of vacuum and sonication to assist A.
tumefaciens to penetrate target tissues is a technique that other research groups have
used successfully to transform orange (de Oliveira et al. 2009), wheat (Wu et al. 2003),
soybean (Trick and Finer 1997), but only germinated radish seeds were successfully
transformed in planta by this method (Park et al. 2005). In our experiments with lupin
seedlings (4.3.1 (i)), seedlings infiltrated under vacuum alone showed no Toluidine
Blue dye penetration of the apical meristem area, whereas seedlings sonicated before
vacuum was applied had dye within the tissues of the apical meristem.
Sonication time must be minimised so that plants can recover from the damage it
causes. In germinated radish seeds subjected to longer than 5 min sonication and 5 min
vacuum infiltration, transformation was decreased. Lower survival of explants was
correlated to increasing sonication and vacuum infiltration time (Park et al. 2005). In
our experiments to find the optimal sonication time for lupin seedlings, they were
sonicated for 0-17 min before vacuum infiltration for 10 min. Surprisingly, survival
rates of shoots were not significantly affected by the duration of sonication. Shoots
subjected to 15 min sonication had a significant increase (0.05 level by Tukey ANOVA)
in the percentage of shoots showing GUS expression compared to no sonication.
Unlike the sonication time, the time of infiltration had a considerable effect on the
survival rate of lupin shoots after treatment. Seedlings were infiltrated with A.
tumefaciens under vacuum for 0-20 min following sonication for 15 min (the selected
optimal sonication time). The percentage of shoots showing transient expression of the
gus-intron gene after each treatment indicated that each increment of infiltration time
lead to increased gene transfer in exponential fashion up to 15 min, but by 20 min all
shoots were dead. As described above, increasing infiltration time under vacuum
resulted in a decline in shoot survival rate with a linear trend. A 15 min sonication
without infiltration, 100% survived whereas at the same sonication time with infiltration
of 15 min or longer, all plants died 6 days or later after treatment. A combination of 15
min sonication and 10 min infiltration time gave the best overall balance of both gene
transfer and survival rate.
After the A. tumefaciens delivery method was optimised, the next step was to enhance
gene transfer efficiency. Success of in planta seedling transformation depends on the
interaction between A. tumefaciens cells and meristematic tissues. In in planta A.
thaliana seed transformation, Feldmann (1995) described a narrow window of time
where exposure of the target tissues to A. tumefaciens cells was crucial for
119
transformation success. During this limited time, apical meristematic competent cells
exposed to A. tumefaciens cells were consistently transformed. Taking this into
account, experiments were designed to induce A. tumefaciens virulence and to maintain
them in a virulent state longer so they would be active when the plant target tissues
were receptive to transformation.
The growth phase of A. tumefaciens has been reported to influence transformation
efficiency in apple (Song et al. 2001). A. tumefaciens at the mid-exponential growth
phase (OD600 0.8-1.2) is commonly used in most in vitro plant transformation methods,
however, stationary phase (OD600 2.0) is normally used for A. thaliana. Clough and
Bent (1998) reported growth phase was not a factor in the success of A. thaliana floral
dip transformation; very late stationary phase (grown for 84 hours) A. tumefaciens gave
a similar transformation rate to early phase cells. To find the best stage of growth phase
for transformation of lupin seedlings, three different stages of exponential growth phase,
namely early (OD600 0.5-0.6), mid (OD600 1-1.2), and late (OD600 1.8-1.9) were assessed
by GUS expression (4.3.1(ii)). The number of shoots expressing GUS was not
significantly different between treatments but spot intensity after exposure to early
exponential phase cells was visibly higher, although their viability after six infiltrations
within three hours was slightly lower than other phases, therefore an early exponential
growth phase was used in later transformation. This result agreed with the in vitro
yellow lupin transformation protocol developed by Li, et al. (2000) and Pigeaire, et al.
(1997) in which A. tumefaciens is prepared at early exponential stage (OD600 0.4-0.6)
for in vitro transformation. Several factors impacted to growth phase coordinated
virulence. Virulence of several pathogenic bacteria, such as Pseudomonas aeruginosa,
A. tumefaciens, and Erwinia carotovora is regulated through a quorum sensing
mechanism, a cell-to-cell communication mechanism that enables bacteria cells to sense
and respond to a change in their population through released small signal molecules
(Whitehead et al. 2001). The vir gene cluster in A. tumefaciens is located on a Ti
plasmid, therefore maintaining Ti plasmids within a population is essential for
virulence. N-acylhomoserine lactones (AHLs) are found in A. tumefaciens as signal
molecules in quorum sensing for Ti plasmid conjugal transfer (Fuqua et al. 1994).
Agrobacterium tumefaciens donor cells started Ti plasmid transfer to daughter cells
from mid-lag phase, reached a maximum at mid-exponential phase and had stopped by
stationary phase. Zhang et al. (2002) found that AHL-lactonase, which inactivated
120
AHL molecules by hydrolysis of their homoserine lactone ring, was encoded by attM
and controlled by transcription factor of attJ. AHL-lactonase is growth phase-
dependent as it was encoded when A. tumefaciens cells were in the stationary phase, the
enzyme degrades AHL and terminates the Ti plasmid conjugal transfer related-quorum
sensing. attM and attJ were two of 33 genes cluster involved in attachment of A.
tumefaciens (Matthysse et al. 2000). Agrobacterium tumefaciens mutants that lacked 24
att genes were not able to attach to plant cells and decreased virulence.
To induce A. tumefaciens virulence, vir gene-inducing compounds in the media such as
sugar, acetosyringone etc, and the induction method have been manipulated to the
specific needs for different plants. To find the best media and suitable induction
method for in planta transformation of lupin seedlings, five different published media
were trialed (4.3.1 (iii)), two of them came from published protocols. However, media
and induction methods used for A. thaliana transformation (Bechtold and Bouchez
1995) were the least successful in transforming lupin shoots. The published method
used for M. truncatula transformation (Trieu et al. 2000) was also unsuccessful for
lupins. Three methods developed especially for in vitro lupin transformation resulted in
more lupin shoots transiently expressing GUS. This result confirmed that
transformation methods must be tailored for each species. Within the media and
methods developed for in vitro lupin transformation, the media which gave the highest
percentage of shoots showing gus-intron transient expression was Medium 4 which was
the MS basal medium used for virulence induction and resuspension of A. tumefaciens
in the A. tumefaciens virulence induction Method II (2.2.5). However, the modified LB
Medium 5 gave stronger gus-intron transient expression and one of the shoots showing
gus-intron transient expression had the whole apical meristematic axis stained in strong
blue (Fig 4.5e). Infiltration Medium 5 and the induction method used with this
infiltration might be beneficial to A. tumefaciens cells vitality as it was the same media
that promoted bacteria cell growth.
The vitality of A. tumefaciens cells co-cultivated with plant cells is crucial for efficient
in vitro transformation (Dominguez et al. 2000; Manickavasagam et al. 2004; Saalbach
et al. 1995; Sujatha and Sailaja 2005; Voisey et al. 1994; Zimmerman and Scorza 1996).
Unlike in planta transformation of A. thaliana flowers where the target tissues (ovules)
are ready for transformation, apical meristematic tissues in imbibed seeds or seedlings
have a narrow time window where competent plant cells are exposed to A. tumefaciens,
and this is the reason optimum growth conditions for A. tumefaciens are needed.
121
The last section in optimisation of media components was to determine the ideal
concentrations of sodium thiosulfate and sugar in growth media (Media 6-11). Sodium
thiosulfate alone or in a mixture with other thiol groups was used to try to enhance the
viability of plant cells and improve transformation efficiency. The effect is to reduce
enzymatic browning of wounded tissues (Olhoft et al. 2001). In media with the
antioxidant sodium thiosulfate at 1mM, transformation efficiency improved more than
seven times in wounded soybean cotyledonary nodes co-cultivated with A. tumefaciens
compared with the control without sodium thiosulfate (Olhoft et al. 2003). However in
lupin seedlings wounded by sonication followed by vacuum infiltration, addition of
sodium thiosulfate was not helpful for improving transient expression of GUS or in
explant survival. Shoots expressing GUS decreased as the concentration of sodium
thiosulfate increased up to 5 mM. The number of shoots generated per plant was
significantly reduced when infiltration media had 1 mM sodium thiosulfate comparing
with no sodium thiosulfate. Adding sodium thiosulfate in infiltration media did not
reduce the browning that occurred after infiltration.
Sugars were reported to be an essential factor for in planta transformation. Clough et
al. (1998) found that A. thaliana floral dipped in media without sucrose had greatly
reduced transformation efficiency, whereby concentrations of either sucrose or glucose
up to 5% improved transformation efficiency. On the other hand plants dipped in media
containing 5% mannitol with or without A. tumefaciens became vitreous and died.
Mannitol is used as an osmoticum; at 5% it caused ‘hyper-osmosis’ to A. thaliana cells
whereas sucrose and glucose did not. Sugars are osmotic agents for plant cells, and also
supply carbon and act as a virulence inducer for A. tumefaciens. In lupin seedlings,
plants infiltrated in Medium 2 (Table 4.2) containing 5% sucrose became vitreous and
showed low transient GUS expression. Media 1 and 3, which contained 1% and 2.5%
sucrose respectively, gave improved percentages of expressing shoots. At 1 mM
sodium thiosulfate, the number of shoots with blue staining decreased when the
increment of glucose concentrations was up in modified LB media. However when
glucose was increased to 3% in modified LB medium (Medium 11) without sodium
thiosulfate, it gave the highest number of expressing shoots.
The optimised medium and conditions were tested with 50 lupin seedlings treated by
sonication, infiltrated, and left to mature. T1 seedlings were grown and sprayed with
PPT at 50 mg/L. Some seedlings (putative transgenics and controls) remained green
122
after the first application of PPT but after another spray they all died. No transformants
were obtained. During media optimisation, some of shoots that were randomly picked
for GUS expression, including the whole apical area, indicated gene transfer. Explants
grew and some axilliary shoots were generated in the apical dome after seven days.
These were picked and stained with GUS solution; some showed blue spots in parts of
leaves (Fig. 4.5d), indicating stable, chimeric, transformation. Chimeric transgenic
plants occur commonly when chimeric tissues give rise to sexual gametes, which, in
turn, give rise to T1 transformants. If non-reproductive tissue is transformed, progeny
will not be transgenic unless plants are vegetatively propagated from the transgenic
tissue. This chimeric event was evidence that there was an optimum time when
competent plant cells were exposed to A. tumefaciens. It is therefore essential that A.
tumefaciens cells be viable whilst in contact with plant cells over the period when they
are becoming competent. Feldmann (1995) found that one of the limitations in A.
thaliana seed transformation was maintaining A. tumefaciens cells alive on the plant so
that they are able to transform competent plant cells later in development. An
experiment to investigate A. tumefaciens viability and time of gene transfer in lupin
showed that A. tumefaciens cells did not survive for long on the seedlings, and that by
Day 4, when T-DNA transfer in vitro was approaching maximum efficiency, survival of
A. tumefaciens cells on the plant was about 103 times (Table 4.3) less than routinely
used for successful transformation of lupins via the in vitro lupin transformation method
(personal communication with Ms Chappel of CLIMA UWA, 2003). Xu et al. (2008)
found that A. tumefaciens after infiltration survived in the floral organ longer than in
stem or leaf of Pakchoi (Brassica rapa L. spp. chinensis). The researchers suggested
that maintaining a large viable population of A. tumefaciens at the plant target cells until
they became competent for transformation was essential. They determined that viability
of A. tumefaciens cells quickly reduced from the time after infiltration but there were
still 958 x 103 CFUs per gram fresh tissue in the flower nine days after infiltration while
only 9.8 x 103 in the stem and 2.3 x 103 in the leaf. The challenge is to maintain viable
A. tumefaciens cells in seedling shoot tips to increase the possibility of transformation.
One way of improving conditions for A. tumefaciens survival may be to keep the apical
area moist to prevent cells becoming dehydrated. Containing plants in an environment
kept humid with a fogger would provide extra moisture. Besides moisture, other factors
that contribute to vitality of shoot tips such as osmoticum and antioxidant to reduce the
damage occurring during or after treatment with sonication and infiltration should also
123
be explored. Investigations into various types and combinations of sugars, antioxidants
such as L-cysteine, DTT or phenolic-absorbing agent such as PVPP, may prove
valuable in improving efficiency of transformation of lupin seedlings.
4.4.2 Vacuum infiltration of lupin flowers
The first step in transformation is for A. tumefaciens cells to make intimate contact with
cells of the target plant tissue. To reduce surface tension between the bacterial and plant
cells, a wetting agent was used. Because different wetting agents can damage cells, the
type and concentration of wetting agent must be optimised to minimize damage to
plants. Tween 80 and Silwet L-77 are non-ionic surfactants commonly used in
agriculture. At 0.02% in infiltration media for lupin flowers vacuum infiltration
experiment (4.3.2.i), Tween 80 gave slightly more detrimental effect to pod setting than
Silwet L-77.
Silwet L-77 is a surfactant commonly used for in planta transformation though the
optimum concentration differs with plant species. In lupin flowers, the change in
concentration from 0.01% to 0.05% caused significant flower abortion. Toxicity of
Silwet L-77 to flowers and plant tissues has been also reported elsewhere. In infiltration
of A. lasiocarpa flowers, an increase in Silwet L-77 concentration from 0.05% to 0.2%
resulted in a lower transformation rate, increased flower abortion and lower seed set
(Tague 2001). Silwet L-77 concentration in A. tumefaciens suspension beyond 0.02%
caused a significant decrease in survival of sugar beet buds in vitro when they were
infected with the suspension (Yang et al. 2005).
Exogenous BAP was applied to lupin flowers (pedicel and sepals) to prevent flower
abortion on the main stem (Ma et al. 1998). In our investigation, the addition of BAP to
the infiltration media did not improve the survival of lupin flowers. Tague (2001) also
found that adding BAP did not change transformation rate for A. lasiocarpa. It may be
that cytokinins are not at limiting concentrations in lupin flowers, although this has not
been proven experimentally.
Another factor that affects the close contact of A. tumefaciens cells with target tissues is
vacuum infiltration time. Even in the established A. thaliana vacuum infiltration
protocol, the infiltration time and concentration of Silwet L-77 varies from lab to lab
(www.bio.net/bionet/mm/arab-gen/1996-June/004622). Various infiltration times were
applied to lupin flowers, and it was found that infiltration times longer than 10 min
caused all flowers to abort. Flowers infiltrated two times for 3 min each survived more
124
and had the highest percentage of pod set (19.52 ± 6.32). Unlike in planta A. thaliana
flower transformation, a repeat of infiltration at a week apart did not improve
transformation outcome because it caused the fertilized lupin flowers (very tiny pods
were seen) to wilt and abort in some cases. Transformation rate and seed set rate of
Brassica napus in planta transformation of flowers by dipping or infiltration under
vacuum with A. tumefaciens suspension was dependent on the period and times under
vacuum. Therefore, a trade-off between vacuum time, transformation success and
flower pod survival is noted. Without vacuum treatment, seed weight gained per plant
was significantly higher than if subjected to vacuum infiltration, but no transformants
were obtained. Transformants were generated only when the flowers were subjected to
two periods of 5 min or longer under vacuum, either consecutively or a week apart
(Wang et al. 2003). Similarly, dipping lupin flowers into A. tumefaciens suspension
without vacuum resulted in some blue stains from bacteria cells and only superficial
penetration after staining with X-gluc, but there was no stable transformation. On the
other hand, flowers infiltrated under vacuum twice for a period of three min each or
infiltrated at longer period showed that bacteria penetrated the flower gynoecium.
Another factor that affects A. tumefaciens transformation of target tissue is the induction
medium. Medium 11, which was optimised and gave the best transient GUS expression
in vacuum infiltrated seedlings was trialed on flowers. The medium, LB containing
high glucose (166.7 mM) caused the flowers to remain closed and they dried and died.
The infiltration media was then changed to medium 4 (MS with 10 mM of glucose).
The percentage of pod collected was low at 10.82. Five immature pods were randomly
chosen to observe gus expression. One pod had seeds stained blue but after sectioning
it was shown that the only seed coat was stained. Because pCGP1258 was used in the
experiment, the blue stains might have come from gus expression in bacteria cells or
from successfully transformed gus expression in seed coat tissues. This led to
investigation of the source of the blue stains. A PCR amplification of the pic A gene
within the Ti plasmid of A. tumefaciens cells suggests that expression was from GUS
expression inside bacteria cells, and not stable transformation of plant cells. Seeds
collected from thirty infiltrated flowers were grown for 2 weeks and sprayed with PPT
solution, but none of the seedlings survived.
After investigations, it became apparent that the optimised protocol could deliver
virulent A. tumefaciens cells to inside gynoecium as the immature seed coat was stained
blue with GUS, but it might not provide the conditions necessary to have lupin ovules
125
transformed and later lead to transformed seeds. There are some possible reasons for
this. First, in lupin flowers, there was no channel through the stigma and style to the
ovules, and pollen germinated through the style tissues by enzymatic digestion to reach
the ovules. It is almost impossible that A. tumefaciens cells would be delivered through
stigma and style tissues by mechanical forces as the style in lupin was long and dense
(personal communication with Prof. Kuo, University of Western Australia, 2003). In
this case, if A. tumefaciens cells were vacuum infiltrated through the channels digested
by pollen, they still could not reach the ovules as the integument would be sealed after
fertilization occurred. Therefore A. tumefaciens cells would stop at the integument,
which later develops to become the seed coat. Second, A. tumefaciens cells were
vacuum infiltrated through the flower carpels. Some hand sections of carpels showed
that A. tumefaciens cells stained blue in inner layers of carpel tissues.
Tucker et al. (2001) found 26 taxa of Fabaceae had unusual carpels in which ovules
began to initiate while the carpel margins were still open and unfused. If lupin flowers
have this characteristic, it would provide a good exposure for A. tumefaciens cells to
reach ovules. However, lupins do not share this characteristic. Microscopic analysis of
lupin flower development revealed that when carpel margins still unfused at early
development, the ovules did not yet initiate their development. Furthermore, the
sections of wax-embedded young flowers showed that its zygomorphic petal structure
formed an interlock, which would collapse during vacuum infiltration then abort and
fall off. Unlike lupin flowers structure, A. thaliana has a flower structure and carpel
that allows transformation by vacuum infiltration. The disymmetric flower structure
has four free saccate sepals and four clawed free petals staggered with no bract. The
pistil is made up of two fused carpels that has a medial furrow in between which
provides a channel for A. tumefaciens cells to enter the ovules and the style is very
short. This structure may explain the reason why vacuum infiltration of flower
inflorescences to date only works routinely in Brassicaceae.
4.4.3 A. thaliana in planta transformation
Vacuum infiltration of A. thaliana seedlings and flowers is now the standard method to
obtain transgenic A. thaliana plants. The method has been simplified so that dipping or
even spraying inflorescences without vacuum infiltration is successful. For this reason,
vacuum infiltration of A. thaliana flowers was done as a control for the vacuum
procedure, glasshouse conditions, the virulence induction of A. tumefaciens, and media
126
used in lupin experiments. The base infiltration medium (Trieu et al. 2000) was used
and compared to the developed medium (Medium 11). The higher transformation rate
from developed media indicated that the failure to obtain transgenic lupins was not a
problem with the media. A repeat infiltration a week later significantly increased the
transformation rate in A. thaliana, but did not have such an effect in lupin flowers.
4.5 Conclusion
In planta transformation of seedlings and flowers as alternative transformation method
for lupins was investigated. Despite optimisation of the important factors that might be
expected to generate success for this method, no transformed lupin plants were
obtained. A maintenance of a dense and viable A. tumefaciens population in shoot
apical tissues during the time of T-DNA transfer appears to be crucial for success in
lupin seedling in planta transformation. This might be done by spraying a mist of water
regularly to create a high moisture environment on apical shoots. Flower morphology
and carpel development in narrow-leafed lupin are critical factors in relation to lupin
flower in planta transformation. The SEM and histological section images showed that
the structures and developmental process of the flowers were not suitable to allow this
type of transformation for narrow-leafed lupin and therefore other transformation
methods need to be considered to facilitate the development of genetically modified
lupin plants.
127
Chapter 5: Studies on A. tumefaciens and Lupin Interactions
5.1 Introduction
Several important crop species, including corn, soy and cotton have been transformed
using A. tumefaciens with useful novel genes and are now in widespread agricultural
use in many countries. The area of plantings with genetically modified crops has
increased each year and reached a cumulative total of one billion hectares in 2010.
However, transformation is still not routine in many species, and grain legumes such as
lupins are recognised as being ‘intransigent’ to transformation and regeneration of
transgenic plants. A. tumefaciens-mediated transformation is genotype dependent, and
predictable and stable expression of transgenes is often elusive.
In order to achieve and/or improve gene transfer efficiency by A. tumefaciens in a
genotype-independent fashion there must be a basic understanding of the interactions
between the bacterium and the host plant.
5.1.1 Plant and A. tumefaciens interactions
Genetic transformation of plants and other organisms by species of A. tumefaciens
involves an intimate interaction between the two species. There are signals from both
partners that affect the outcome, proteins from each partner are required for transfer and
integration of DNA from A. tumefaciens into the host genome (for details see review by
Gelvin (2000) and Chapter 1 of this thesis). The interaction can be broadly divided into
three stages:
Bacterial colonisation of and attachment to host cells
Transferred-DNA (T-DNA) transport from the bacterium through host
membranes into the host cell’s nucleus
Integration of the bacterial T-DNA within the host’s genome.
It has long been recognised that there is a genetic basis in host plants for susceptibility
to crown gall disease, caused by A. tumefaciens-mediated transformation of plants by
wild-type T-DNAs (Mauro et al. 1995; Nam et al. 1997). In grapes, resistance to crown
gall appears to be controlled by a single dominant gene (Szegedi and Kozma 1984)
whereas in other species, for example soybean, it is a quantitative trait (Mauro et al.
1995). In other species that show genotype variation in susceptibility, the phenotype is
128
transmitted to progeny in self-crosses and reciprocal crosses, confirming that it is a
heritable characteristic.
Screening of A. thaliana mutant populations has revealed mutations in genes that confer
loss of transformability of roots by A. rhizogenes. Experiments with these mutants have
shown that loss of susceptibility to gene transfer occurs in each step of the
transformation process, from colonisation through to integration of the T-DNA in the
host genome. For example, rat1, a plant gene encoding an arabinogalactan protein, and
rat 3, encoding a cell wall protein, have roles in attachment of the bacteria to the cell
wall (Belanger et al. 1995). The gene rat4, encoding a xylan synthase, appears to be
involved in T-DNA entry to the cytoplasm (Nam et al. 1999) and rat5 (encoding a
histone H2A protein) almost certainly has a role in T-DNA integration into the host
genome (Mysore et al. 2000; Nam et al. 1999). Complementation with the wild-type
histone H2A (RAT5) gene restores transformability and its over-expression increases
transformation efficiency two to six times (Gelvin 2003). Other genes may be involved.
For example, in Arabidopsis nuclear import of the T-DNA complex appears to be
assisted by VIP1. VIP1 is a host protein that specifically interacts with the bacterial
protein VirE2 to enter the nucleus via a Karyopherin dependent pathway (Tzfira et al.
2002). Down-regulation by antisense expression of VIP1 inhibited nuclear targeting of
VirE2. Tobacco plants expressing antisense VIP1 were highly recalcitrant to A.
tumefaciens infection. In contrast, transgenic plants that over-expressed VIP1 were
hyper-susceptible to A. tumefaciens transformation (Tzfira and Citovsky 2002). A
tomato gene, DIG3 encodes a 2C serine/threonine protein phosphatase that interacts
directly with the A. tumefaciens VirD2. Over-expression of DIG3 in transfected
tobacco BY-2 cells resulted in decreased nuclear targeting of a GUS-VirD2 NLS fusion
protein. This suggested that phosphorylation of the VirD2 NLS region may also be
involved in nuclear targeting of the VirD2/T-strand complex (Tao et al. 2004).
The outcome of research into the T-DNA transfer process and A. tumefaciens/plant
interactions is knowledge that can assist in enhancing gene transfer efficiency. An
example of exploitation of this knowledge can be seen in the use of extra vir genes, such
as virG, virE, to increase transformation efficiency of recalcitrant plants (Park et al.
2000; Hansen et al. 1994; Ke et al. 2001; van der Fits et al. 2000).
129
5.1.2 Lupin genotype-dependent response to A. tumefaciens
Amongst lupin cultivars, there exists variation in susceptibility to A. tumefaciens-
mediated genetic transformation. Although these observations had not been published
at the time of writing, this variation has been observed over several years of
experiments in the legume transformation group (personal communication with Ms.
Chapple at CLIMA, UWA, 2004). Narrow-leafed lupin cultivar Merrit has an average
transformation efficiency at the T0 generation of 6.5% (Wylie et al. 2002), while a more
recently-released cultivar, Quillinock, has an average transformation efficiency of 1%
(personal communication with Ms. Chapple at CLIMA, UWA, 2004). These data
indicate that there are a plant encoded factor(s) that strongly influence transformation
efficiency.
It is beyond the scope of this project to determine the genes involved in the A.
tumefaciens/lupin interaction. However, we will attempt to determine which of the
three transformation stages is limiting transfer of genes from A. tumefaciens to lupins by
comparing reactions to gene transfer in cultivars Merrit and Quillinock. Specifically,
the attachment of A. tumefaciens will be determined by counting the number of bacterial
cells attached to the explants; T-DNA transport through the cell wall and cell membrane
will be evaluated through protoplast and cell suspension experiments. In addition, it
will be determined whether the presence of an extra virG will increase T-DNA
transport. This will be achieved using the 4-methyumbelliferyl glucuronide (MUG)
assay to measure transient expression of the gus reporter gene.
5.2 Materials and methods
5.2.1 Plant materials, A. tumefaciens and plant expression vector
Seeds of six cultivars of narrow-leafed lupin (Merrit, Quilinock, Belara, Illyarrie, Yorrel
and Danja) were obtained from DAFWA.
Agrobacterium tumefaciens strain AGLO was used because this strain has been used for
lupin transformation and it gives higher efficiency in transformation of yellow and
narrow-leafed lupins (Hoffmann 1999; Li et al. 2000).
Two plant expression vectors were used in this section: pCAMBIA3201 and pAD1339,
both of which contain gus genes containing an intron that prevents bacterial expression
of GUS (as described in 2.3).
130
pAD1339 was obtained from Prof. Anath Das, University of Minnesota. It has an extra
virGN54D gene (mutant virG gene) located outside the Left border of T-DNA cassette
that may promote higher gene transfer activity (Ke et al. 2001). Like pCAMBIA3201, a
gus reporter gene contained in the construct has an intron to prevent expression in
bacterial cells. Also it harbours a kanamycin resistance gene (Kn) as plant selectable
marker. Both gus and Kn genes are under the control of the cauliflower mosaic virus
(CaMV) 35S promoter.
5.2.2 Determination of the number of A. tumefaciens cells attached to lupin
explants (adapted from Matthysse 1987)
Lupins seeds were surface-sterilised (2.1.3) and imbibed overnight with sterile distilled
water (20 ml per plate containing 30 seeds). Embryonic axes were isolated (2.1.4) and
cut vertically at 0.5 cm from the apical tip then cut into in half horizontally. Twenty
explants were used for each replicate with three replicates per treatment. The explants
were shaken with 10 mL A. tumefaciens solution prepared as described in 2.2.5 method
I at 40 rpm, 25oC for 2 h. The explants were separated from A. tumefaciens solution by
filtering through a 100 μm meshed sieve and the explants were rinsed with sterile water
three times to remove cells that were not adhered to the explants. Explants were placed
in 50 mL LB medium and homogenised in a blender for 2 min that had been swabbed
with 100% ethanol to sterilise it. The lysate was diluted and two 50 μL aliquots were
plated (two replicates) each on LB agar plates supplemented with the antibiotic
corresponding to the antibiotic resistance gene in the plasmid. The plates were
incubated at 28oC until A. tumefaciens colonies become visible, after 48 h. The colonies
were counted and the number of A. tumefaciens cells binding per 20 explants was
calculated.
5.2.3 Lupin protoplast culture
Solutions used in this method have been described (Babaoglu 2000(b)).
Protoplast washing solution
g/L
NaH2PO4. 2H2O 0.100
CaCl2. 2H2O 1.480
KNO3 0.101
MES buffer (Sigma) 1
131
Mannitol 90
These compounds were dissolved in distilled water and the pH was adjusted to 5.8. The
solution was filter-sterilised and 10 mL aliquots were kept at 4oC.
Enzyme mixture solution
% (w/v)
Cellulase-RS 1.1
Macerozyme-R10 1.3
Pectolyase Y-23 0.25
These compounds were dissolved in protoplast washing solution, filter-sterilised and 10
ml aliquots were kept at -20oC.
Protoplast isolation and culture
Embryonic axes were cut in half and submerged in protoplast washing solution for pre-
plasmolysis for 1 h before incubating with enzyme mixture solution. One gram of pre-
plasmolysis-treated axes was bruised by maceration with a glass rod and incubated in 10
ml enzyme mixture at 25oC in the dark with gentle rocking for 8 h to release protoplasts.
The incubation mixture was then passed through 2 sieves of 100 and 50 μm pore sizes
respectively. The protoplasts were then washed by centrifuging (28 x g, 10 min) and re-
suspending in a new 3 mL of protoplast washing solution. Protoplasts were further
purified by floating on protoplast washing solution containing 21% sucrose (sucrose
solution) and centrifuging (90 x g, 10 min). This separated protoplasts from cell debris
(the band between protoplast washing solution and sucrose solution after centrifuging),
which were collected by withdrawing with sterile plastic pipettes and then were re-
suspended in 10 mL fresh protoplast washing solution. The washing step was repeated
again before protoplasts were finally resuspended in culture medium.
Examination of protoplast viability
Fluorescein diacetate (FDA) stock solution was prepared by dissolved 5 mg FDA in 1
mL acetone and kept at -20oC. One milliliter of FDA working solution was made by
mixing 20 µL of FDA stock with 980 µL water and used immediately. To stain
protoplasts in order to determine if they were viable, the FDA working solution was
added to the protoplast culture 1:1 ratio by volume. The mixture was left for 5 min
before examination under a fluorescence microscope. The viable protoplasts fluoresced
under UV light. The number of viable protoplasts was calculated as a percentage of the
total number of protoplasts.
132
5.2.4 Cell suspension culture of narrow-leafed lupin
The embryonic axes of narrow-leafed lupins were isolated as described above. They
were cut in half and placed on MS medium supplemented with 1 mL/L B5 vitamin
stock (1000X, Sigma), 0.5 mg/L 2, 4-D, 30 g/L sucrose and solidified with 7 g/L agar at
pH 5.8. The explants were incubated at 25oC in the dark for callus induction. After 7-
10 days, calli were used to initiate cell suspension cultures. Approximately 10 g of
friable calli was shaken in 100 mL of MS liquid media supplemented with 1 mL/L B5
vitamin stock (1000X) and 30 g/L sucrose in 250 mL flask and shaken at 120 rpm for 1
h to loosen callus clumps. The loose cells were passed through 100 µm nylon meshed
sieve and any callus clumps remaining on the sieve were pushed through the sieve with
a glass rod. The suspended cells were cultured on a shaker at 80 rpm, 25oC in the dark
and subcultured every 2 weeks until the cells were used for determination of T-DNA
transfer.
5.2.5 RNA extraction from plant tissue
Total RNA was extracted from 100 mg plant tissue with the RNeasy Plant Mini kit
(Qiagen) as described by the manufacturer. Total RNA was eluted in RNase-free water
and kept at -80oC or used immediately for reverse-transcriptase polymerase chain
reaction (RT-PCR).
5.2.6 Analysis of GUS expression by RT-PCR
RT-PCR was done using a ThermoScript™ RT-PCR system kit (Invitrogen) following
the protocol provided by the manufacturer. Total RNA was treated with DNase before a
cDNA fragment of the gus gene was synthesised from total RNA extracted from
explants (10 pg-5 μg) using GUSintL primer (2.5.2). The mixture of RNA, primer and
dNTP mix was incubated at 65oC for 5 min to denature double-stranded molecules then
placed on ice. Then the denatured RNA mixture was added to reverse transcriptase
master mix containing cDNA synthesis buffer, DTT, RNase inhibitor and reverse
transcriptase and incubated in a thermal cycler at 55oC for 30 min to synthesise cDNA
and 85oC for 5 min to terminate the reaction. One microlitre (2 units) of RNase H
(Promega Corp.) was added to the reaction and incubated at 37oC for 20 min to remove
RNA from RNA/cDNA hybrids. cDNA was used immediately for PCR or kept at -20
oC. The PCR conditions were the same as those described for gus gene amplification
(2.5.2). Each RT-PCR was repeated four times.
133
5.2.7 Fluorimetric assay for β-glucuronidase (MUG assay)
β-glucuronidase (GUS) encoded by the gus gene catalyses hydrolysis of β-glucuronides
into glucuronic acid and another component of moiety. A fluorimetric assay based on
hydrolysis of 4-methyumbelliferyl glucuronide (MUG), a non-fluorescent substrate that
is cleaved by GUS into glucuronic acid and 4-methylumbelliferone (4MU), a
fluorescent product that can be quantified by fluorometry at 455 nm (4MU in buffer pH
7 has excitation wavelength at 380 nm and emission wavelength at 454 nm (Snavely et
al. 1967).
Tissue from explants (100 mg) was placed into a 1.5 mL centrifuge tube and 0.5 mL of
GUS extraction buffer containing 50 mM Na-phosphate buffer pH 7, 10 mM EDTA,
0.1% Triton 100, 0.1% sarkosyl and 10 mM β-mercaptoethanol was added. The tissue
was then homogenised by sonication (model XL 2015, Misonix incorporated) for 10
seconds at 75% per second of the pulsar ‘duty cycle’. The cell debris was pelleted by
centrifugation at 6000 x g for 5 min at 4oC then kept on ice. Extracted lysate (40 μL)
was added to 460 μL of GUS extraction buffer containing 1 mM MUG and incubated at
37oC. Forty microlitres of mixture was withdrawn at time 0 and 140 μL of 0.2 M
Na2CO3 was added to stop enzyme activity. The sample was then ready for fluorimetric
reading. Samples were taken and similarly treated every 30 min for 3 h to determine
enzyme activity over that period.
The amount of fluorescence emitted from a serial dilution of 4-MU treated with the
same conditions as the samples (above) was read and used to plot a standard curve.
From the standard curve, the fluorescence units of samples were converted to
concentration of 4-MU and the specific GUS activity expressed as amount of 4-MU
(μmoles) formed per min per 40 μl of plant extract.
Total proteins from plant extracts were quantified with Bradford’s Reagent (Bradford
1976). Forty microlitres of the remainder of the plant extract was added to 500 μL of
Bradford’s reagent and mixed. The OD of the samples was measured at 595 nm after
15 min incubation at room temperature. A standard curve was plotted from serial
dilutions of BSA read at OD595. The OD595 measurement of the sample was converted
to concentration of protein (mg/mL) using the standard curve and the specific GUS
activity was calculated per mg of protein.
134
5.3 Results
5.3.1 Determination of the number of A. tumefaciens attached to cells of lupin
explants
The number of A. tumefaciens cells attached per 20 half embryonic axes from six
cultivars of narrow-leafed lupin (Merrit, Quilinock, Belara, Illyarrie, Yorrel and Danja)
after 2 h shaking with A. tumefaciens cells (at 7.6x108 cells/mL) was compared and
analysed using ANOVA with Tukey’s honestly significant difference (HSD) test (Table
5.1). The statistical analysis showed no significant difference at the 0.05 level.
Table 5.1 The number of A. tumefaciens cells attached to explants of six cultivars of
lupins. Values are means ± standard errors. There was no significant difference at the
0.05 level by Tukey HSD.
Lupin Cultivars
No. of A. tumefaciens cells
attached per 20 lupin half
embryonic axes (x105)
Quilinock 85.67±15.82
Merrit 132.00±14.86
Belara 136.67±1.67
Illyarrie 154.33±19.92
Yorrel 117.67±17.08
Danja 133.00±13.38
5.3.2 Determination of T-DNA transfer efficiency to cell suspensions and
protoplasts by RT-PCR
The aim of this experiment was to investigate whether the observed lower
transformation efficiency of L. angustifolius cv Quilinock compared to cv Merrit was a
function of T-DNA transfer efficiency and whether there was a difference of T-DNA
transfer between cells with a cell wall and those without cell walls (i.e. protoplasts).
Lupin protoplast viability in different cultivation media was studied before
determination of T-DNA transfer efficiency was carried out. Half-strength MS-based
medium and B5-based medium supplemented with 1mL/L B5 vitamin stock (1000X),
100 mg/L sucrose and 10 mM MES (pH 5.8) and washing solution were used. One
gram of embryonic axes used in protoplast preparation yielded 1-2x105 protoplasts/mL
in 2 mL final resuspension culture medium. After maceration and digestion in the
enzyme mixture, protoplasts could be observed from 4 h of digestion and the complete
digestion occurred between 8 h and overnight incubation. The number of viable
135
protoplasts (Fig 5.1 b) was counted every 2 days for 6 days and at day 10. Half-strength
MS-based medium was chosen for subsequent experiments, although B5-based medium
also gave high cell viability at day 4 (Table 5.3). An advantage of using half-strength
MS-based medium for incubating protoplasts is that it was also used for resuspending A.
tumefaciens cells prior to the transformation procedure.
a)
b)
Figure 5.1 Protoplasts of lupin cv Merrit in washing solution as culture medium at Day
0. a) Before being stained with FDA; b) Viable protoplast cells fluoresced under UV
after being stained with FDA. Bar is 50 μm.
136
Table 5.2 Protoplast viability (%) observed over a period of 10 days in different culture
media. M: lupin cv Merrit; Q: lupin cv Quillinock
Media
Protoplast viability (%)
Day0 Day2 Day4 Day6 Day10
M Q M Q M Q M Q M Q
Washing solution 100 100 100 100 77.08 95.75 55.35 63.25 11.18 12.16
½ MS 100 100 100 100 97.45 100 87.55 88.37 39.76 28.38
B5 100 100 100 100 93.75 96.43 78.25 85.75 23.66 23.43
Lupin cell suspensions and protoplasts of cv Merrit and Quillinock prepared as
described in 5.2.3 and 5.2.4 were inoculated with A. tumefaciens harbouring
pCAMBIA3201 prepared as described in 2.2.5 method I and incubated at 25oC (shaken
at 120 rpm for cell suspension only) in the dark for 4 days before harvesting. Three
milliliters of cell suspensions of each lupin cultivar (to yield ~100 mg cells) were
harvested by centrifugation at 447 x g for 10 min whereas 2 mL of their protoplasts (to
yield > 107 protoplasts) were centrifuged at 28 x g for 10 min. RNA extraction of
samples including cell suspensions and protoplasts of lupin cv Merrit and Quillinock
along with non-transgenic lupin leaf (cv Merrit) as negative control and transgenic lentil
(containing gus gene) seedlings as positive control was performed as described in 5.2.5.
The RNA concentration (ng/µL) from each sample was determined by
spectrophotometer at 260 and 280 nm. 250 ng of total RNA was used to synthesise
cDNA by RT-PCR. RT-PCR amplification of a 228 bp cDNA fragment of the gus gene
from each sample (Fig. 5.2) consistently showed lower gus expression in cell
suspensions of cv Merrit than in cell suspensions of cv Quilinock. This was determined
by the relative intensities of the RT-PCR amplicons. In contrast, there was no
difference in the relative intensities of RT-PCR amplicons of the same gene from
protoplasts.
137
Figure 5.2 A representative RT-PCR amplification of a 228 bp fragment of the gus
gene from RNA obtained from cell suspensions and protoplasts of cvs Merrit and
Quillinock after 4 days inoculation with A. tumefaciens AGLO cells carrying
pCAMBIA3201. Lane M: 1 kb Marker; Lane 1: water control; Lane 2:
pCAMBIA3201; Lane 3: positive control (transgenic lentil containing gus); Lane 4:
cDNA negative control (non-transgenic lupin cv Merrit); Lane 5: cell suspensions of cv
Merrit; Lane 6: cell suspensions of cv Quillinock; Lane 7: protoplasts of cv Merrit;
Lane 8: protoplasts of cv Quillinock.
5.3.3 Determination of T-DNA transfer to lupin cell suspensions by a fluorimetric
assay for β-glucuronidase (MUG assay)
This experiment was to examine whether pAD1339, which harbours an extra virG gene
(virGN54D), would increase T-DNA transfer. This was done by using the sensitive
MUG assay. GUS expression in cell suspension cultures of both cultivars were tested
using the MUG assay. The A. tumefaciens used in inoculation was collected after
harvesting plant suspension cells for the assay. The collected bacteria cells were used in
MUG assay for negative control. The suspension cells of both cultivars without
inoculation were also used in the assay as negative control. Transgenic tobacco
carrying pCAMBIA3201 was used in the assay as positive control. The assay showed
greater GUS expression in Quillinock cell suspensions inoculated with A. tumefaciens
carrying either pCAMBIA3201 or pAD1339 than in cv Merrit cells suspensions with
the same plasmids. Only in Quilinock, cells inoculated with A. tumefaciens carrying
pAD1339 expressed more GUS than cells inoculated with A. tumefaciens carrying
pCAMBIA3201 (Fig. 5.3).
M 1 2 3 4 5 6 7 8
250bp
138
Tobacco: Transgenic tobacco with pCAMBIA3201
p3201: A. tumefaciens with pCAMBIA3201
p1339: A. tumefaciens with pAD1339
M: Lupin cv Merrit Q: Lupin cv Quillinock
M-p3201 : cv Merrit inoculated with pCAMBIA3201
M-p3201a : M-p3201 substracted background from p3201 and M
Q-p3201 : cv Qiullinock inoculated pCAMBIA3201
Q-p3201a : Q-p3201 substracted background from p3201 and Q
M-p1339 : cv Merrit inoculated with pAD1339
M-p1339a : M-p1339 substracted background from p1339 and M
Q-p1339 : cv Qiullinock inoculated with pAD1339
Q-p1339a : Q-p1339 substracted background from p1339 and Q
Figure 5.3 GUS activity as determined by MUG assay of cultivars Merrit and
Quillinock cell suspension cultures transformed with pCAMBIA3201 or pAD1339.
Transgenic tobacco carrying pCAMBIA3201 was used as an assay control. A.
tumefaciens cells (AGL0) carrying each plasmid, and non-transgenic lupin cell
suspensions of both cultivars acted as negative controls.
Unexpectedly, GUS activity was detected in A. tumefaciens cells carrying both
plasmids, even though they both carry introns within their gus genes with the purpose of
preventing prokaryotic expression. To explain this, MUG assays were carried out on
lysate from A. tumefaciens cells not carrying plasmids, A. tumefaciens cells harbouring
pCGP1258 (a binary vector with an intronless gus gene) and A. tumefaciens cells
harbouring pCAMBIA3201 and pAD1339. The results (Fig. 5.4) showed that A.
109.02
43.67
25.21
-14.74
-48.38
39.26
10.33
20.7225.43
11.56
1.09
17.56
40.73
-60
-40
-20
0
20
40
60
80
100
120
Tob
acc
o
p3201
p1339
M Q M-p
3201
M-p
3201a
Q-p
3201
Q-p
3201a
M-p
1339
M-p
1339a
Q-p
1339
Q-p
1339a
GU
S a
ctiv
itie
s (μ
mo
les/
min
/m
g p
roti
en)
Treatments
139
tumefaciens cells with pCAMBIA3201 and pAD1339 had approximately the same low
expression of gus as cells without a plasmid. GUS activity detected in A. tumefaciens
cells with the intronless pCGP1258 was approximately 10 times more, indicating that
the introns within the gus genes of pCAMBIA3201 and pAD1339 effectively prevented
prokaryotic expression. Cells with the plasmids pCAMBIA3201, pAD1339 and
pCGP1258 were stained with X-gluc solution. Only cells with pCGP1258 stained blue
(Fig. 5.5). Therefore GUS activity obtained from A. tumefaciens cells harbouring
pCAMBIA3201 and pAD1339 might come from endogenous gus gene in A.
tumefaciens cell. True expression levels should be determined after subtracting the
background (ie bacterial and plant cells) expression.
AGLO: A. tumefaciens cells without plasmid (as negative control);
AGLO-p1258: A. tumefaciens cells harbouring pCGP1258 which has gus gene
without an intron (as positive control);
AGLO-p3201: A. tumefaciens cells harbouring pCAMBIA3201;
AGLO-p1339: A. tumefaciens cells harbouring pAD1339.
Figure 5.4 MUG assay of GUS activity of lysate of A. tumefaciens cells without a
plasmid (AGLO), A. tumefaciens cells with pCAMBIA3201 (AGLO-p3201), A.
tumefaciens cells with pAD1339 (AGLO-p1339) and A. tumefaciens cells with
pCGP1258 (AGLO-p1258).
0
50
100
150
200
250
300
AGLO AGLO-p3201 AGLO-p1339 AGLO-p1258
GU
S a
ctiv
ity
(μm
ole
s/m
in/m
g p
rote
in)
140
Figure 5.5 GUS expression of A. tumefaciens cells as determined by staining with x-
gluc. From left to right the cells carried: pCGP1258 showing blue staining,
pCAMBIA3201, pAD1339 and empty cells (without a plasmid) in 1.5 mL eppendorf
tubes.
5.4 Discussion
To transform a plant, A. tumefaciens must transfer its T-DNA through the plant cell
wall, the cytoplasm and the plasma membrane before it reaches the nucleus and
integrates into the genome. Recalcitrance to transformation could result from a number
of causes. These includes defects in the ability of plant exudates to induce A.
tumefaciens vir genes, defects in the ability of bacteria to bind to the plant cells,
deficiencies in the ability of the bacteria to transfer T-DNA to the plant cell, defects in
T-DNA nuclear targeting of integration into the plant genome, a lack of ability to
express T-DNA-encoded genes, or the plant’s lack of response to the phytohormones
whose synthesis is directed by T-DNA-encoded genes (Nam et al. 1997). In lupin,
differences of transformation efficiency amongst cultivars have been observed as high
as several times (Wylie et al. 2002). To determine reasons behind this observed
variation in A. tumefaciens-mediated transformation of lupins, some of the possible
constraints to A. tumefaciens transformation were investigated.
5.4.1 Binding of A. tumefaciens cells to plant cell walls.
Binding of A. tumefaciens cells to plant cell walls is reported to be genotype-specific
(Jordan and Hobbs 1994; Kuta and Tripathi 2005). Attachment is an essential process
that must occur before transformation can commence. Recalcitrance to transformation
in Arabidopsis can occur at the binding stage or in later steps in the transfer of T-DNA,
and it is host-genotype dependent (Nam et al. 1997). We showed that there was no
141
significant difference in the attachment of A. tumefaciens cells to the surface of
embryonic axis explants of six lupin cultivars (Table 5.1), despite the observed variation
in transformation efficiency between them. A. tumefaciens attachment is, therefore,
unlikely to play a role in limiting transformation efficiency in narrow-leafed lupin.
Further investigation was carried out to examine the significance of the cell wall to T-
DNA transfer by determination of gus expression from lupin cell suspensions (with cell
walls) comparing to lupin protoplasts (lacking cell walls) of cultivars Quilinock and
Merrit (5.3.2). The results (Fig. 5.2) showed there was a genotype-dependent effect of
the cell wall because less gus expression was evident in cell suspensions of lupin cv
Merrit than in cell suspensions of cv Quilinock. However, no significant difference in
expression was detected between protoplasts of cv Merrit and cv Quilinock. This shows
the cell wall composition plays a role in determining the success of T-DNA transfer. In
this case, the result was unexpected because cv Quillinock is reported to be more
recalcitrant to transformation than cv Merrit. The critical mechanism(s) determining the
difference in transformation between these cultivars is therefore likely to occur
upstream of T-DNA transfer across the cell wall barrier. Given that A. tumefaciens is a
plant pathogen, it is interesting to note that disease profiles of lupin cultivars by
DAFWA showed that cv Quilinock was more susceptible to six common lupin
pathogens (viral and fungal) screened than was cv Merrit (Salam et al. 2005).
The plant cell wall plays a dual and contradictory role in the life of plant pathogens. It
serves as a barrier that impedes the infection of certain tissues but it also can act as a
source of energy. Therefore cell wall degrading enzymes (CWDE) are widespread
among plant pathogens including A. tumefaciens (Van Sluys et al. 2002). In
comparative genome analysis of plant-associated bacteria, members of the Rhizobiaceae
possessed poor pectinolytic agents, although a gene similar to the ligninase from
Pseudomonas paucimobilis (lignin beta-ether hydrolase) is present uniquely in their
genomes (Van Sluys et al. 2002). This enzyme may facilitate A. tumefaciens not only to
colonize woody hosts but also to degrade lignin to produce phenolic compounds that
serve as signal molecules for VirA protein (Lee et al. 1995). Binding of the A.
tumefaciens cells to cell walls is influenced by two plant cell wall proteins, the
vitronectin-like protein (Wagner and Matthysse 1992) and rhicadhesin-binding protein
(Swart et al. 1994). It is therefore possible that differences in the amounts of the
various cell wall components between cv Quillinock and cv Meritt may affect the
142
efficiency with which A. tumefaciens can attach and penetrate the cell wall, although
this was not proven experimentally.
In the attachment experiment (5.3.1), the whole embryonic axis was used and it gave no
significant differences in the number of binding A. tumefaciens. Since efficient
infection normally requires wounding and/or actively dividing cell cultures (An 1985),
it would be interesting to do an attachment experiment with cell suspension of different
cultivars of lupin instead of whole embryonic axis.
5.4.2 Transient gene expression.
Transient expression of T-DNA does not always correlate to stable transformation
because transformation efficiency involves other downstream steps of the T-DNA
transfer process, as well as the subsequent selection and recovery of whole plants. This
was evident in the two lupin cultivars tested because even though cv Quillinock had
more transient GUS expression than cv Merrit, it has a lower rate of stable
transformation. This suggests that stable transformation in lupins might be dependant
on a factor that is important downstream of the T-DNA transfer step, such as T-DNA
integration or selection and regeneration.
In narrow-leafed lupin, the regeneration and rooting protocol was developed for cvs
Merrit and Unicrop (Pigeaire et al. 1997) and the same protocol has been applied to
other cultivars. An optimised selection and regeneration protocol especially for cv
Quillinock may see its transformation efficiency increase.
Enchancing the vir genes of A. tumefaciens may improve plant transformation
efficiency. A number of enhancements exist, amongst them virGN54D (constitutive
virG mutant carrying Asn-54 to Asp amino acid substitution, Han and Winans 1994),
virGI77V (supersensitive virG mutant with an I77V substitution, Rodenburg et al. 1994)
and virE (wild-type). Constructs carrying virGN54D was the most effective enhancer in
transformation of tobacco and cotton (Park et al. 2000), Catharanthus roseus (van der
Fits et al. 2000), rice and soybean (Ke et al. 2001). The virGN54D gene increased both
transient and stable transformation in C. roseus but it did not affect the number of
transgene integrated (van der Fits et al. 2000). In this study with lupin, virGN54D
increased transient expression of gus only in cv Quillinock cells, not in cv Merrit cells.
Constructs carrying virGN54D may, therefore, be of some use as a component of a
transformation protocol for cv Quillinock, and possibly other recalcitrant lupin
cultivars.
143
5.5 Conclusion
Lupin cv Merrit shows a higher transformation efficiency than cv Quillinock.
Unexpectedly, the experiments described here show that cv Merrit is more resistant to
gene transfer by A. tumefaciens than cv Quillinock as determined by transient
expression of a reporter gene. This indicates that the factors limiting transformation in
Quillinock are downstream of T-DNA transfer to the cytoplasm of the host cell,
possibly involved in T-DNA integration and/or expression, or selection and recovery of
whole plants. Optimisation of recovery procedures for transgenic cv Quillinock
explants may significantly increase efficiency of recovery of transgenic plants.
144
Chapter 6 General Discussion
The impact of a simple and efficient transformation system can be witnessed in
Arabidopsis research after in planta transformation was developed and adopted
worldwide. For example, hundreds of thousands of T-DNA insertional mutagenesis
mutants have accelerated Arabidopsis functional genomics research (Radhamony et al.
2005). Although narrow-leafed lupins (Pigeaire et al. 1997) and yellow lupins (Li et al.
2000) have been transformed by A. tumefaciens-based transformation, this method
involved many steps in vitro and was of low efficiency. In this research project the
main aim was to investigate alternative transformation methods that might increase the
efficiency of transformation of narrow-leafed lupins.
To address this aim, two potential plant transformation methods were investigated:
particle bombardment (direct gene transfer) and in planta transformation (A.
tumefaciens-based transformation). To study the mechanisms of transformation, lupin
and A. tumefaciens interactions were studied to provide the information on the factors
that limit transformation and the involvement of an additional virG on lupin
transformation.
6.1 Investigations using particle bombardment
Particle bombardment is a direct means to deliver foreign DNA to target cells. It is the
main direct transformation method used to generate transgenic crop plants. A range of
transgenic plants have been produced by this method, and details of integration sites,
manner of integration, number of copies, expression and inheritance have been reported.
They differed from transgenic plants produced by A. tumefaciens-based methods
because T-DNA favours certain transcriptionally active regions, whereas insertion of
transgenes through bombardment is more random, and tends to result in insertion of
more copies of the target gene. This method was viewed as a possible alternative to A.
tumefaciens-mediated methods.
In this research project, experiments were done to try to identify optimum conditions
required to accomplish stable lupin transformation. Parameters studied were: plasmid
DNA preparation to provide the quality and quantity suitable for transient and stable
transformation, delivery of DNA to plant target tissues and pre-and post-bombardment
treatment, to minimize any adverse effects from high pressure bombardment and to
145
synchronise cell growth cycle to favour uptake and integration of foreign genes. The
following conditions were identified as being optimal for transformation via particle
bombardment using a Helium inflow gun with lupin embryonic axes as target explants:
Embryonic axes used as explants were pre-treated in MS media supplemented
with 5 mg/L BAP and 0.5 mg/L NAA, 3% sucrose and 0.7% agar for 3 days in the
dark at 25oC.
Pre-treated explants were placed onto MS media with 0.3 M mannitol as
osmoticum 4 h prior to bombardment.
Bombardment procedure was carried out by:
Precipitation protocol described in 3.2.2 (a) using plasmid DNA prepared by
Qaigen spin column and 2 ng plasmid DNA per μg tungsten particles (10 L of
0.5 g/L plasmid DNA and 50 L of 50 g/L tungsten particles in
precipitation mix).
Bombardment conditions: 400 psi with 7 cm target distance
Bombardment was performed twice with 10 L coated particles loaded each
time.
Bombarded explants were kept on osmoticum media (MS media with 0.3 M
mannitol) for another 4 h then transferred to pre-/post-treatment media for post-
treatment for another 3 days in the dark at 25oC.
After post-treatment, explants were transferred to selection media (MS media with
1 mg/L BAP and 0.1 mg/L NAA, 3% sucrose, 0.7% agar and 10 mg/L PPT) for 8
weeks with subculture every two weeks. Survivors were transferred to rooting media
and analysed for presence of the transgene by PCR.
A total of 1,487 lupin apical meristem explants were treated under these conditions.
Fifty T0 plants survived the selection regime for 8 weeks, but of these only seven shoots
from six plants were transgenic. None of seven transformed shoots produced roots on
rooting medium. To overcome this problem they were grafted onto non-transgenic
seedling rootstocks in vitro, but none survived.
The main problem of this system was the choice of target explants and lack of
availability of a higher pressure Biolistic particle gun in later experiments. Although,
there has been a report of successful regeneration of lupin plants from de-differentiated
tissue of leaves, hypocotyls and cotyledons, transformation using this method has not
been repeated (Pigeaire et al. 1997). Therefore, the choice of target explants to be used
146
was narrowed down to the apical meristem of embryonic axes, the only explant to have
been successfully transformed using A. tumefaciens.
There are some advantages and disadvantages of using embryonic axes as target
explants. An established regeneration and selection protocol was published for this
explant type in lupins. And direct shoot regeneration should eliminate somaclonal
variation (Hadi et al. 1996). However, the embryonic axis is a difficult explant to
transform by particle bombardment because the target tissue which gives rise to shoots
(the L2 layer) is small and is several layers below the epidermis, and it is difficult to
penetrate this responsive cell layer with DNA-coated particles without excessive
damage to surrounding tissues (McCabe et al. 1988). Furthermore, the apical
meristematic cells in the embryonic axis require additional treatments to allow them to
take up foreign DNA. In this project pre- and post-bombardment treatments were
developed to stimulate the target cells using high cytokinin. The method achieved T0
transformation as confirmed by PCR. However, we lost access to a high-pressure
particle gun part way through this procedure, and as a result, subsequent transformation
was not successful using a lower-pressure gun. Also, the embryonic axis has a thick
layer of non-regenerable surrounding tissue, some of which would have received
introduced DNA after bombardment and could have survived in media because the
basal cells provided protection for regenerating shoots. This could lead to a high
percentage of explant escapes (up to 86% in our case) that survived the selection
regime, but gave negative PCR results for a transgene.
Despite a number of parameters being tested and a set of optimum conditions
developed, an efficient particle bombardment protocol was not achieved. T0
transformants were generated at low efficiency and there was a high percentage of
escapes. Nonetheless, it is envisioned that these problems might be circumvented by
using other target explants that have regenerable meristematic cells such as the
cotyledon, node or internodes.
6.2 Investigations using in planta transformation
In planta transformation is an A. tumefaciens-based transformation technique. The
success of this method of transformation depends on delivering A. tumefaciens to the
target cells and a series of molecular interactions that result in those plant cells being
147
transformed. Here we did experiments to test the viability of A. tumefaciens-mediated
transformation of seedlings and flowers.
In in planta seedling transformation for lupin, the optimisation experiments were
carried out to meet two principles of this transformation technique required for success
namely; 1) delivery A. tumefaciens to the target tissues (L2 layer of apical meristem of
seedlings) and 2) enhanced ability of A. tumefaciens cells to be active to transform plant
cells. The delivery protocol was established by sonicating seedlings for 15 min before
10 min infiltration with A. tumefaciens cells giving the best overall balance of both gene
transfer, as determined by GUS staining, and seedling survival rate. The A. tumefaciens
induction conditions and infiltration media was developed after optimisation of A.
tumefaciens growth phase and media composition (11 different media including 5
published media) to enhance and keep A. tumefaciens cells virulent. During the trial
with combined conditions, some tests of shoots that were randomly picked for GUS
expression, including the whole apical area and part of leaves of new shoots, indicated
that there was gene transfer and stable transformation, although selected tissues were
chimeric. However, no transformants were obtained. A possible explanation may come
from the experiments investigating A. tumefaciens viability and time of gene transfer in
lupin. It showed that by day 4, when T-DNA transfer in vitro was approaching
maximum efficiency, survival of A. tumefaciens cells on the plant was about 103 times
less than routinely used for successful transformation of lupins via the in vitro lupin
transformation method of Pigeaire et al. (1997). It is essential for the success of this
technique that a large number of viable A. tumefaciens cells are maintained at the site of
target cells until target cells became susceptible and ready for taking up foreign DNA
(Feldmann 1995; Xu et al. 2008). In the case of lupin seedlings, to ensure that sufficient
numbers of viable and active A. tumefaciens cells are retained it may be necessary to
keep the apical area moist to prevent cells becoming dehydrated (as discussed in detail
in Chapter 4). Another alternative is to keep the process of wounding and co-cultivation
with A. tumefaciens in vitro until seedlings are stably transformed, then transfer them to
soil in a glasshouse for further growth and seed set. This ‘in planta’ transformation
method was reported successful in the legumes alfalfa (Weeks et al. 2008), pigeon pea
(Sankara Rao et al. 2008) and field bean (Keshamma et al. 2011). In this method the
process of imbibing seeds, infecting and co-cultivating with A. tumefaciens, and
recovery (2 weeks in the case of alfalfa) is carried out in vitro, then seedlings are
transferred to soil to grow and set seed ‘ex vitro’. The embryonic axes of young
148
seedlings were excised or wounded by needle punctures to make access to A.
tumefaciens. The in vitro part of the method would allow the processes of A.
tumefaciens and plant interaction and is advantageous in that the environment for these
processes is easier to manipulate in vitro, e.g. by manipulating plant growth regulators
and other conditions, to make plant cells competent and maintain A. tumefaciens
virulence. The advantage of the ex vitro stage is that the complication of growing plants
to maturity in tissue culture is avoided.
The second set of experiments on in planta transformation for lupin involved vacuum
infiltration of flowers. The attempt to transform lupin flowers in planta using vacuum
infiltration was initiated to seek a higher efficiency and simpler transformation method,
since it appeared at that time in the literature that both A. thaliana and M. truncatula
(the so-called “model legume”) could be transformed by this method. Especially, for M.
truncatula, transformation efficiency under vacuum infiltration of flowers, up to 76%
was reported (Trieu et al. 2000).
Studies undertaken to understand the mechanism of in planta transformation in A.
thaliana concluded that the target of this transformation was the ovule (Desfeux et al.
2000; Ye et al. 1999; Bechtold et al. 2000). Therefore, our experiments were designed
to deliver A. tumefaciens cells to lupin ovules. The factors contributing to success in
this type of transformation include using surfactant, infiltration period and times under
vacuum and composition of infiltration medium, and these were tested and optimised
for lupins. No transformants were obtained after infiltration of flowering lupin plants
using optimised conditions. The infiltration medium that was developed in this project
(Medium 11) was also tested with A. thaliana flower infiltration under vacuum and
many transgenic plants were produced. The use of this model species indicated that it
was not the medium, conditions or constructs that prevented in planta transformation of
lupin flowers from working but other factors.
Histology studies of lupin flower structure by SEM and wax-embedded sectioning
indicated that there was no possible physical channel for A. tumefaciens cells to gain
access to the ovule via the stigma or style before anthesis. In lupin, there was a long
and dense style that could not be penetrated mechanically without fatal damage. It was
not possible for A. tumefaciens cells to gain access to the ovule through the immature
carpel of young flowers as the developing carpel closed before the ovule developed.
This is in contrast to the situation for Arabidopsis, in which the carpel remains open
while ovules develop inside it until stage 11 of flower development, when it has
149
stigmatic papillae (Smyth et al. 1990). This happens approximately 4 days before
anthesis. That might be the reason why floral-dip after 4 days before anthesis did not
work successfully on A. thaliana (Desfeux et al. 2000). Furthermore, in the younger
flowers of lupin the zygomorphic petal structure formed an interlocking structure that
would collapse during vacuum infiltration, abort and fall off.
After in planta transformation of M. truncatula had been published, later it was found
by many researchers that this method was difficult and could not be repeated (Somers et
al. 2003; Bent and Wang 2006) and the associated patent application describing this
procedure was subsequently withdrawn (Weeks et al. 2008). This sounded a note of
caution for researchers embarking on in planta transformation using floral organs. In
wheat floral-dip, Zale et al. (2009) chose cultivar Crocus spring wheat germplasm that
has crossability alleles which provide a decreased barrier in wide crosses, and that might
also result in a reduced barrier to A. tumefaciens penetration into the pistil. Using this
cultivar they obtained transgenic wheat that was stable for six generations.
Hirsch et al. (2010) used an open-flower mutant of Melilotus alba (Fabaceae; white
sweetclover), in an attempt at floral-dip transformation. This mutant developed flowers
with reflexed sepals and petals, thereby exposing the stamens and carpel, whereas wild-
type sweetclover inflorescences developed closed flowers where the young stamens and
carpel remain covered during the early stages of flower development. However, there
was no success in obtaining transgenic plants. After investigation, they concluded that
although this mutant had an open flower structure similar to that of Arabidopsis, its
carpel developed with the margins fused together as the ovule primordia differentiated,
just as in the case of wild-type flowers. Again, this meant that there was no channel for
A. tumefaciens to access the ovule.
After more than a decade research on in planta transformation, the general consensus is
that only plant species that possess a flower structure which has an open carpel while
ovules are developing such as in members of the Brassicaceae and wheat (Tucker and
Kantz 2001) are amenable to this method (Hirsch et al. 2010). This view is supported
here by our findings in lupin. The only plants transformed so far via flowers in planta
were, members of the family Brassicaceae, including Pakchoi (Brassica rapa spp.
Chinensis, Qing et al. 2000), radish (Raphanus sativus longipinnatus Bailey, Curtis and
Nam 2001) and flax (Camelina sativa, Lu and Kang 2008).
150
6.3 Studies on A. tumefaciens and lupin interactions
Three stages involved in T-DNA transfer process were studied to determine which
stage might be limiting the transfer of genes from A. tumefaciens to lupins, such that the
knowledge gained could be used to improve lupin transformation efficiency by A.
tumefaciens in a genotype-independent fashion. These stages were the attachment of A.
tumefaciens to the lupin explants, T-DNA transport through the host cell wall and cell
membrane. In addition, the effect of an extra virG was examined to determine whether
it would increase T-DNA transport.
The interaction studies were done by comparing reactions to gene transfer in lupin
cultivars Merrit and Quillinock that differ significantly in transformation efficiency
(6.5% for cv Merrit and ~1% for cv Quillinock). The results of the attachment of A.
tumefaciens cells showed no statistically significant difference in the number of
bacterial cells attached to the explants (half embryonic axes) of six cultivars of narrow-
leafed lupin (Merrit, Quilinock, Belara, Illyarrie, Yorrel and Danja). Therefore, the
attachment stage was not the factor limiting gene transfer. T-DNA transport through
the cell wall and cell membrane was evaluated by studying gus expression in cell
suspension cultures (ie cells with walls) and protoplast (ie cells without walls),
determined by the relative intensities of the RT-PCR amplicons. The results showed,
unexpectedly, that cv Merrit had less T-DNA transferred by A. tumefaciens than cv
Quillinock in cell suspension, but that was not the case for protoplasts. These results
were supported with MUG assays to quantify transient expression of the gus reporter
gene in cell suspensions of both cultivars. This study suggested that differences in cell
wall composition between the two cultivars played an important role in gene transfer,
but that the factors limiting transformation success in Quillinock are downstream of T-
DNA transfer to the cytoplasm of the host cell, possibly involved in T-DNA integration
and/or expression, or selection and recovery of whole plants. Optimisation of recovery
procedures for transgenic cv Quillinock explants may significantly increase efficiency
of recovery of transgenic plants.
Plants that are less amenable to tissue culture, such as cereals and legumes should be
screened to identify genotypes with good regeneration frequency before developing
transformation protocols (Collen and Jarl 1999; Seraj et al. 1997). In Arabidopsis,
recalcitrance to tumorigenesis occurred at different steps of the transformation process.
151
In one case, the limiting factor was the decreased binding of A. rhizogenes to root
explants, while in another ecotype inhibition occurred at a later step of T-DNA transfer.
6.4 Conclusion
In this thesis, a protocol of particle bombardment transformation for narrow-leafed
lupin was developed, critical factors for success in lupin seedlings and flower in planta
transformation were uncovered and the study of interactions between A. tumefaciens
and lupin indicates that the factors limiting transformation are downstream of T-DNA
transfer.
A further study to investigate the potential of an in planta transformation system is
suggested here for an improvement of genetic transformation for narrow-leafed lupin
with reduced tissue culture involvement by using sonication to wound germinating lupin
seedlings (with shoot apex already emerging from the cotyledons) and vacuum
infiltration with A. tumefaciens suspension to deliver A. tumefaciens cells to the target
apical meristem tissues and co-cultivate in vitro (providing more controllable conditions
than in vivo (ie in glasshouse) to keep an essential number of viable A. tumefaciens
during the critical time of T-DNA transfer.
152
References
Ahokas, H. 1989. Transfection of germinating barley seed electrophoretically with
exogenous DNA. Theoretical & Applied Genetics 77:469-472.
Al-Ahmad, Hani, Shmuel Galili, and Jonathan Gressel. 2004. Tandem constructs to
mitigate transgene persistence: tobacco as a model. Molecular Ecology 13
(3):697-710.
Albert, H., E. C. Dale, E. Lee, and D. W. Ow. 1995. Site-Specific Integration of DNA
into Wild-Type and Mutant Lox Sites Placed in the Plant Genome. Plant
Journal 7 (4):649-659.
Albright, L. M., M. F. Yanofsky, B. Leroux, D. Ma, and E.W. Nester. 1987. Processing
of the T-DNA of Agrobacterium tumefaciens generates border nicks and linear,
single stranded T-DNA. Bacteriology 16:1046-1055.
Altpeter F, Xu J. P. 2000. Rapid production of transgenic turfgrass (Festuca rubra L.)
plants. Journal of Plant Physiology 157:441-448
Altpeter F, Xu J.P., Ahmed S. 2000. Generation of large numbers of independently
transformed fertile perennial ryegrass (Lolium perenne L.) plants of forage- and
turf-type cultivars. Molecular Breeding 6:519-528
Amoah, B. K., H. Wu, C. Sparks, and H. D. Jones. 2001. Factors influencing
Agrobacterium-mediated transient expression of uidA in wheat inflorescence
tissue. Journal of Experimental Botany 52 (358):1135-1142.
An, G. 1985. High efficiency transformation of cultured tobacco cells. Plant Physiology
79:568-570.
An, G., B. D. Watson, S. E. Stachel, M. P. Gordon, and E. W. Nester. 1985. New
cloning vehicles for transformation of higher plants. EMBO J 4:277-284.
Aragao FJL, Barros LMG, Brasileiro ACM, Ribeiro SG, Smith FD, Sanford JC, Faria
JC, Rech EL. 1996. Inheritance of Foreign Genes in Transgenic Bean (Phaseolus
Vulgaris L) Co-Transformed Via Particle Bombardment. Theoretical & Applied
Genetics 93:142-150
Aragao FJL, Sarokin L, Vianna GR, Rech EL. 2000. Selection of transgenic
meristematic cells utilizing a herbicidal molecule results in the recovery of fertile
transgenic soybean (Glycine max (L.) Merril) plants at a high frequency.
Theoretical & Applied Genetics 101:1-6
153
Arencibia, Ariel, Pedro Molina, Gustavo de la Riva, and Guillermo Selman-Housein.
1995. Production of transgenic sugarcane (Saccharum officinarum L.) plants by
intact cell electroporation. Plant Cell Reports 14 (5):305-309.
Armaleo D, Ye GN, Klein TM, Shark KB, Sanford JC, Johnston SA. 1990. Biolistic
nuclear transformation of Saccharomyces cerevisiae and other fungi. Current
Genetics 17:97-103
Babaoglu, M. 2000(b). Protoplast isolation in Lupin (Lupinus mutabilis Sweet):
Determination of optimum explant sources and isolation conditions. Turkish
Journal of Botany 24:177-185.
Babu, P., and H. S. Chawla. 2000. In vitro regeneration and Agrobacterium mediated
transformation in gladiolus. The Journal of Horticultural Science &
Biotechnology 75 (4):400-404.
Barna, K.S., Mehta S. L. 1995. Genetic Transformation and Somatic Embryogenesis in
Lathyrus Sativus. Journal of Plant Biochemistry & Biotechnology 4:67-71
Bernaerts, M. J., De Ley, J. 1963. A biochemical test for crown gall bacteria. Nature
197: 406-407
Batista D, Fonseca S, Serrazina S, Figueiredo A, Pais M. 2008. Efficient and stable
transformation of hop (Humulus lupulus L.) var. Eroica by particle
bombardment. Plant Cell Reports 27:1185-1196
Bechtold, N., and D. Bouchez. 1995. In Planta Agrobacterium-Mediated
Transformation of Adult Arabidopsis thaliana Plants by Vacuum Infiltration.
Edited by I. Potrykus and G. Spangenberg, Gene Transfer to Plants: Springer.
Bechtold, N., B. Jaudeau, S. Jolivet, B. Maba, D. Vezon, R. Voisin, and G. Pelletier.
2000. The maternal chromosome set is the target of the T-DNA in the in planta
transformation of Arabidopsis thaliana. Genetics 155 (4):1875-87.
Bechtold, N., J. Ellis, and G. Pelletier. 1993. In planta Agrobacterium-mediated gene
transfer by infiltration of adult Arabidopsis thaliana plants. C R Acad Sci Paris,
Life Science 316:1194-1199.
Belanger, C., M. L. Canfield, L. W. Moore, and P. Dion. 1995. Genetic analysis of
nonpathogenic Agrobacterium tumefaciens mutants arising in crown gall tumors.
Bacteriology 177:3752-3757.
Bellucci M, De Marchis F, Mannucci R, Arcioni S. 2003. Jellyfish green fluorescent
protein as a useful reporter for transient expression and stable transformation in
Medicago sativa L. Plant Cell Reports 22:328-337
154
Belzile, F., M.W. Lassner, Y. Tong, R. Khush, and J. I. Yoder. 1989. Sexual
transmission of transposed Activator elements in transgenic tomatoes. Genetics
123:181-189.
Bendich AJ. 1987. Why do chloroplasts and mitochondria contain so many copies of
their genome? Bioessays 6:279-282
Bent, A. F. 2000. Arabidopsis in planta transformation. Uses, mechanisms, and
prospects for transformation of other species. Plant Physiology 124 (4):1540-
1547.
Bent, Andrew, and Kan Wang. 2006. Arabidopsis thaliana floral dip transformation
method. In Agrobacterium Protocols, edited by J. M. Walker: Humana Press.
Bhatnagar S, Kapur A, Khurana P. 2002. Evaluation of parameters for high efficiency
gene transfer via particle bombardment in Indian mulberry. Indian Journal of
Experimental Biology 40:1387-1392
Bidney, D., C. Scelonge, J. Martich, M. Burrus, L. Sims, and G Huffman. 1992.
Microprojectile bombardment of plant tissues increases transformation
frequency by Agrobacterium tumefaciens. Plant Molecular Biology 18:301-313.
Binns, A. N., and Howitz V. R. 1994. The genetic and chemical basis of recognition in
the Agrobacterium: plant interaction. Current Topics in Microbiology and
Immunology 192:119-38.
Birch, R. G., and Bower R. 1994. Principles of gene transfer using particle
bombardment. In Particle bombardment technology for gene transfer, edited by
N.-S. Yang and P. Christou. New York: Oxford University Press, pp 3-29.
Bohmer P, Meyer B, Jacobsen H. J. 1995. Thidiazuron-induced high frequency of shoot
induction and plant regeneration in protoplast derived pea callus. Plant Cell
Reports 15:26-29
Bower R, Birch R. G. 1990. Competence for gene transfer by electroporation in a
subpopulation of protoplasts from uniform carrot cell suspension cultures. Plant
Cell Reports 9:386-389.
Bower R, Birch R. G. 1992. Transgenic sugarcane plants via microprojectile
bombardment. The Plant Journal 2:409-416.
Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Analytical
Biochemistry 72 (1-2):248-254.
155
Brar G. S, Cohen B. A, Vick C. L, Johnson G. W. 1994. Recovery of Transgenic Peanut
(Arachis Hypogaea L) Plants from Elite Cultivars Utilizing Accell(R)
Technology. Plant Journal 5:745-753.
Brookes, G and Barfoot, P. 2012. Forthcoming. GM Crops: Global socio-economic and
environmental impacts 1996-2010, PG Economics Ltd, Dorchester, UK.
Cao, X., Q. Liu, L. J. Rowland, and F. A. Hammerschlag. 1998. GUS expression in
blueberry (Vaccinium spp.): factors influencing Agrobacterium-mediated gene
transfer efficiency. Plant Cell Reports 18 (3-4):266-270.
Carlson SR, Rudgers GW, Zieler H, Mach JM, Luo S, Grunden E, Krol C, Copenhaver
GP, Preuss D. 2007. Meiotic Transmission of an In Vitro-Assembled
Autonomous Maize Minichromosome. PLOS Genetics 3:e179.
Casas AM, Kononowicz AK, Haan TG, Zhang LY, Tomes DT, Bressan RA, Hasegawa
PM. 1997. Transgenic Sorghum Plants Obtained after Microprojectile
Bombardment of Immature Inflorescences. In Vitro Cellular & Developmental
Biology-Plant 33:92-100.
Chabaud, M., F. de Carvalho-Niebel, and D. G. Barker. 2003. Efficient transformation
of Medicago truncatula cv. Jemalong using the hypervirulent Agrobacterium
tumefaciens strain AGL1. Plant Cell Reports 22 (1):46-51.
Chang, S. S., S. K. Park, B. C. Kim, B. J. Kang, D. U. Kim, and H. G. Nam. 1994.
Stable Genetic Transformation of Arabidopsis thaliana by Agrobacterium
Inoculation in Planta. Plant Journal 5 (4):551-558.
Chin HG, Kim GD, Marin I, Mersha F, Evans TC, Jr., Chen L, Xu MQ, Pradhan S.
2003. Protein trans-splicing in transgenic plant chloroplast: reconstruction of
herbicide resistance from split genes. Proceedings of the National Academy of
Sciences of the United States of America 100:4510-4515
Cho SH, Chung YS, Cho SK, Rim YW, Shin JS. 1999. Particle bombardment mediated
transformation and GFP expression in the moss Physcomitrella patens.
Molecules & Cells 9:14-19
Christie, Peter J. 2004. Type IV secretion: the Agrobacterium VirB/D4 and related
conjugation systems. Biochimica et Biophysica Acta (BBA) - Molecular Cell
Research 1694 (1-3):219-234.
Christou P, McCabe D, Swain WF. 1990. Soybean genetic engineering-commercial
production of transgenic plants. Trends in Biotechnology 8:145-151.
Christou P, Swain W, Yang N, McCabe D. 1989. Inheritance and expression of foreign
genes in transgenic soybean plants. Proceedings of the National Academy of
Sciences of the United States of America 86:7500-7504.
156
Chung, M. H., M. K. Chen, and S. M. Pan. 2000. Floral spray transformation can
efficiently generate Arabidopsis transgenic plants. Transgenic Research 9
(6):471-6.
Citovsky, V., B. Guralnick, M. N. Simon, and J. S. Wall. 1997. The Molecular Structure
of Agrobacterium Vire2-Single Stranded DNA Complexes Involved in Nuclear
Import. Journal of Molecular Biology 271 (5):718-727.
Clough, S. J., and A. F. Bent. 1998. Floral dip: a simplified method for Agrobacterium-
mediated transformation of Arabidopsis thaliana. Plant Journal 16 (6):735-743.
Collen, A. M. C., and C. I. Jarl. 1999. Comparison of different methods for plant
regeneration and transformation of the legume Galega orientalis Lam. (goat's
rue). Plant Cell Reports 19 (1):13-19.
Cormick, C. 2011 Chapter 6: Australia: Better Communication Through Better
Understanding of the Target Audience. In Communication Challenges and
Convergence in Crop Biotechnology edited by Navarro, M. J., and Hautea, R.
A., 130-154. Ithaca: International Service for the Acquisition of Agri-biotech
Applications (ISAAA).
Costantino, P., P. J. J. Hooykaas, H. den Dulk-Ras, and R. A. Schilperoort. 1980.
Tumor formation and rhizogenicity of Agrobacterium rhizogenes carrying Ti
plasmids. Gene 11 (1-2):79-87.
Curtis, I. S., and H. G. Nam. 2001. Transgenic radish (Raphanus sativus L.
longipinnatus Bailey) by floral-dip method--plant development and surfactant
are important in optimizing transformation efficiency. Transgenic Research 10
(4):363-71.
Curtis, I. S., H. G. Nam, J. Y. Yun, and K. H. Seo. 2002. Expression of an antisense
GIGANTEA (GI) gene fragment in transgenic radish causes delayed bolting and
flowering. Transgenic Research 11 (3):249-56.
Dai SH, Zheng P, Marmey P, Zhang SP, Tian WZ, Chen SY, Beachy RN, Fauquet C.
2001. Comparative analysis of transgenic rice plants obtained by
Agrobacterium-mediated transformation and particle bombardment. Molecular
Breeding 7:25-33
Daley M., Knauf V. C., Summerfelt K. R., and Turner J. C. 1998. Co-transformation
with one Agrobacterium tumefaciens strain containing two binary plasmids as a
method for producing marker-free transgenic plants. Plant Cell Reports19 489–
496
Dalton, S. J., A. J. E. Bettany, E. Timms, and P. Morris. 1997. Transgenic plants of
Lolium multiflorum, Lolium perenne, Festuca arundinacea, and Agrostis
157
stolonifera by silicon carbide fiber-mediated transformation of cell suspensions.
Plant Science 132:31-43.
Daniell, H., M. S. Khan, and L. Allison. 2002. Milestones in chloroplast genetic
engineering: an environmentally friendly era in biotechnology [Review]. Trends
in Plant Science 7 (2):84-91.
Daniell, Henry. 2007. Transgene containment by maternal inheritance: Effective or
elusive? Proceedings of the National Academy of Sciences of the United States
of America 104 (17):6879-6880.
Davies, D. R., J. Hamilton, and P. Mullineaux. 1993. Transformation of peas. Plant Cell
Reports 12 (3):180-183.
Dayton-Wilde H, Meagher RB, Merkle SA. 1992. Expression of foreign genes in
transgenic yellow-poplar plants. Plant Physiology 98:114-120.
De Block M, Schell J, Van Montagu M. 1985. Chloroplast transformation by
Agrobacterium tumefaciens. EMBO J 4:1367-1372.
De Block, M., Bottleman, J., Vandewiele, M., Dockx, J., Thoen, C., Gossele, V., Rao
Movva, N., Thompson, C., Van Montagu, M., Leemans, J. 1987. Engineering
herbicide resistance in plants by expression of a detoxifying enzyme. EMBO J. 6
(9): 2513-2518.
De la Pena, A., H. Lorz, and J. Schell. 1987. Transgenic plants obtained by injecting
DNA into young floral tillers. Nature 325:274-276.
de Mesa, M. C., S. Jimenez-Bermudez, F. Pliego-Alfaro, M. A. Quesada, and J. A.
Mercado. 2000. Agrobacterium cells as microprojectile coating: a novel
approach to enhance stable transformation rates in strawberry. Australian
Journal of Plant Physiology 27 (12):1093-1100.
de Oliveira, Maria, Vicente Febres, Marcio Costa, Gloria Moore, and Wagner Otoni.
2009. High-efficiency Agrobacterium-mediated transformation of citrus via
sonication and vacuum infiltration. Plant Cell Reports 28 (3):387-395.
de Ronde, J. A., W. A. Cress, and A. van der Mescht. 2001. Agrobacterium-mediated
transformation of soybean (Glycine max) seed with the beta-glucuronidase
marker gene. South African Journal of Science 97 (9-10):421-424.
Deblaere, R. 1985. Efficient octopine Ti plasmid-derived vectors for Agrobacterium-
mediated gene transfer to plants. Nucleic Acids Reseach 13:4777-4788.
Desfeux, C., S. J. Clough, and A. F. Bent. 2000. Female reproductive tissues are the
primary target of Agrobacterium-mediated transformation by the Arabidopsis
floral-dip method. Plant Physiology 123 (3):895-904.
158
Desfeux, C., S. J. Clough, and A. F. Bent. 2000. Female reproductive tissues are the
primary target of Agrobacterium-mediated transformation by the Arabidopsis
floral-dip method. Plant Physiology 123 (3):895-904.
Dix PJ, Kavanagh TA. 1995. Transforming the Plastome - Genetic Markers and DNA
Delivery Systems. Euphytica 85:29-34
Doetsch NA, Favreau MR, Kuscuoglu N, Thompson MD, Hallick RB. 2001.
Chloroplast transformation in Euglena gracilis: splicing of a group III twintron
transcribed from a transgenic psbK operon. Current Genetics 39:49-60
Dominguez, A., J. Guerri, M. Cambra, L. Navarro, P. Moreno, and L. Pena. 2000.
Efficient production of transgenic citrus plants expressing the coat protein gene
of citrus tristeza virus. Plant Cell Reports 19 (4):427-433.
Eapen, S. 2008. Advances in development of transgenic pulse crops. Biotechnology
Advances 26 (2):162-8.
Ellis DD, McCabe DE, McInnis S, Ramachandran R, Russell DR, Wallace KM,
Martinell BJ, Roberts DR, Raffa KF, McCown BH. 1993. Stable Transformation
of Picea glauca by Particle Acceleration. Bio-Technology 11:84-89
Emani C, Sunilkumar G, Rathore KS. 2002. Transgene silencing and reactivation in
sorghum. Plant Science 162:181-192
Escudero, J., and B. Hohn. 1997. Transfer and Integration of T-DNA without Cell
Injury in the Host Plant. Plant Cell 9 (12):2135-2142.
Farrand, S. K., P. B. Van Berkum, and P. Oger. 2003. Agrobacterium is a definable
genus of the family Rhizobiaceae. International Journal of Systematic and
Evolutionary Microbiology 53 (Pt 5):1681-7.
Feldmann, K. A. 1995. Seed transformation in Arabidopsis thaliana. In Gene transfer to
plants, edited by I. Potrykus and G. Spangenberg. New York: Springer.
Feldmann, K. A., and M. D. Marks. 1987. Agrobacterium-mediated transformation of
germinating seeds of Arabidopsis thaliana: a non tissue culture approach.
Molecular and General Genetics 208:1-9.
Finer JJ, Finer KR, Ponappa T, Figures P. 1999. Particle bombardment mediated
transformation [Review] Hammond J, McGarvey P, Yusibov V. Plant
Biotechnology: New Products and Applications. Current Topics in Microbiology
and Immunology 240 PG. 59-80. Springer-Verlag Berlin: http://www.springer.de
Finer JJ, McMullen MD. 1990. Transformation of cotton (Gossypium hirsutum L.) via
particle bombardment. Plant Cell Reports 8:586-589
159
Finer JJ, Vain P, Jones MW, McMullen MD. 1992. Development of particle inflow gun
for DNA delivery to plant cells. Plant Cell Reports 11:232-238
Fitch MMM, Manshardt RM, Gonsalves D, Slightom JL, Sanford JC. 1990. Stable
transformation of papaya via microprojectile bombardment. Plant Cell Reports
9:189-194
Folling L, Olesen A. 2001. Transformation of wheat (Triticum aestivum L.) microspore-
derived callus and microspores by particle bombardment. Plant Cell Reports
20:629-636
Frame, B., P. R. Drayton, S. Bagnall, C. J. Lewnau, P. Bullock, A. M. Wilson, J. M.
Dunwell, J. Thompson, and K. Wang. 1994. Production of fertile transgenic
maize plants by silicon carbide whisker mediated transformation. Plant Journal
6:941-948.
Franklin G, Oliveira M, Dias ACP. 2007 Production of transgenic Hypericum
perforatum plants via particle bombardment-mediated transformation of novel
organogenic cell suspension cultures. Plant Science 172:1193-1203
Franks T, Birch RG. 1991a. Gene transfer into intact sugarcane cells using
microprojectile bombardment. Australian Journal Plant Physiology 18:471-480
Fromm ME, Morrish FM, Armstrong CL, Williams R, Thomas J, Klein TM. 1990.
Inheritance and expression of chimeric genes in the progeny of transgenic maize
plants. Biotechnology 8:833-839
Fu XD, Duc LT, Fontana S, Bong BB, Tinjuangjun P, Sudhakar D, Twyman RM,
Christou P, Kohli A. 2000. Linear transgene constructs lacking vector backbone
sequences generate low-copy-number transgenic plants with simple integration
patterns. Transgenic Research 9:11-19
Fu YC, Ding YY, Liu XF, Sun CQ, Cao SY, Wang DJ, He SJ, Wang XK, Li LC, Tian
WZ. 1998. Rice transformation with a senescence-inhibition chimeric gene.
Chinese Science Bulletin 43:1810-1815
Fuqua, W C, S C Winans, and E P Greenberg. 1994. Quorum sensing in bacteria: the
LuxR-LuxI family of cell density-responsive transcriptional regulators. Journal
of Bacteriology 176 (2):269-275.
Gao C, Long D, Lenk I, Nielsen K. 2008. Comparative analysis of transgenic tall fescue
(Festuca arundinacea Schreb.) plants obtained by Agrobacterium-mediated
transformation and particle bombardment. Plant Cell Reports 27:1601-1609
Gelvin, S. B. 2000. Agrobacterium and plant genes involved in T-DNA transfer and
integration [Review]. Annual Review of Plant Physiology & Plant Molecular
Biology 51:223-256.
160
Gelvin, S. B. 2003. Improving plant genetic engineering by manipulating the host.
Trends in Biotechnology 21 (3):95-8.
Gelvin, S. B. 2003 (a). Agrobacterium-Mediated Plant Transformation: the Biology
behind the “Gene-Jockeying” Tool. Microbiology and Molecular Biology
Review 67(1): 16–37.
Georgiev, Milen, Jutta Ludwig-Müller, Kalina Alipieva, and Annemarie Lippert. 2011.
Sonication-assisted Agrobacterium rhizogenes-mediated transformation of
Verbascum xanthophoeniceum Griseb. for bioactive metabolite accumulation.
Plant Cell Reports 30 (5):859-866.
Gladstones, J. S. 1994. An historical review of lupins in Australia. Paper read at
Proceedings of the First Australian Lupin Technical Symposium, at Perth,
Western Australia.
Gleave, A. P., D. S. Mitra, S. R. Mudge, and B. A. M. Morris. 1999. Selectable marker-
free transgenic plants without sexual crossing: transient expression of cre
recombinase and use of a conditional lethal dominant gene. Plant Molecular
Biology 40 (2):223-235.
Glencross, B. D. 2004. Lupins. Aqua Foods: Formulation & Beyond 1 (2):11-15.
Golz, T. 1993. Lupin: Alternative Agriculture Series, Number 8. North Dakota: NDSU
Extension Service, North Dakota State University.
http://library.ndsu.edu/tools/dspace/load/?file=/repository/bitstream/handle/1036
5/8038/AA8_1993.pdf?sequence=1.
Gondo T, Matsumoto J, Tsuruta S-i, Yoshida M, Kawakami A, Terami F, Ebina M,
Yamada T, Akashi R. 2009. Particle inflow gun-mediated transformation of
multiple-shoot clumps in rhodes grass (Chloris gayana). Journal of Plant
Physiology 166:435-441
Gordon-Kamm WW, Spencer T, Mangano M, Adams TR, Daines R, Start WG, O'Brien
JV, Chambers SA, Adams WR, Willetts NG, Rice TB, Mackey CV, Krueger
RW, Kausch AP, Lemaux PG. 1990. Transformation of maize cells and
regeneration of fertile transgenic plants. Plant Cell 2:603-618
Grant, J. E., E. M. Dommisse, M.C. Christey, and A.J. Conner. 1991. Gene Transfer to
Plants Using Agrobacterium. In Advanced Methods in Plant Breeding and
Biotechnology, edited by R. M. David: C.A.B. International.
Grayburn, S. W., and Vick, B. A. 1995. Transformation of sunflower (Helianthus
annuus L.) following wounding with glass beads. Plant Cell Reports 14, 285–
289.
161
Griesbach, R. J., and J. Hammond. 1993. Incorporation of the GUS gene into orchid via
embryo electrophoresis. Acta Horticulturae 336:165-169.
Gurlitz, R. H., P. W. Lamb, and A. G. Matthysse. 1987. Involvement of Carrot Cell
Surface Proteins in Attachment of Agrobacterium tumefaciens. Plant Physiology
83 (3):564-568.
Hadi, M. Z., M. D. McMullen, and J. Finer. 1996. Transformation of 12 different
plasmids into soybean via particle bombardment. Plant Cell Reports 15:500-
505.
Hamilton, C. M., A. Frary, C. Lewis, and S. D. Tanksley. 1996. Stable Transfer of
Intact High Molecular Weight DNA into Plant Chromosomes. Proceedings of
the National Academy of Sciences of the United States of America 93 (18):9975-
9979.
Han, D. C., and S. C. Winans. 1994. A mutation in the receiver domain of the
Agrobacterium tumefaciens transcriptional regulator VirG increases its affinity
for operator DNA. Molecular Microbiology 12 (1):23-30.
Hansen, G., A. Das, and M. D. Chilton. 1994. Constitutive expression of the virulence
genes improves the efficiency of plant transformation by Agrobacterium.
Proceedings of the National Academy of Sciences of the United States of
America 91 (16):7603-7.
Hansen, G., and M. D. Chilton. 1996. "Agrolistic" transformation of plant cells:
integration of T-strands generated in planta. Proceedings of the National
Academy of Sciences of the United States of America 93 (25):14978-83.
Hansen, G., and M. S. Wright. 1999. Recent advances in the transformation of plants
[Review]. Trends in Plant Science 4 (6):226-231.
Hansen, G., J. Tempe, and J. Brevet. 1992. A T-DNA transfer enhanced sequence in the
vicinity of the right border of Agrobacterium rhizogenes pRi8196. Plant
Molecular Biology 20:113-122.
Hansen, G., M. D. Chilton, and Plates Figures. 1999. Lessons in gene transfer to plants
by a gifted microbe [Review] Hammond J, McGarvey P, Yusibov V. Plant
Biotechnology : New Products and Applications]. Curr.Top.Microbiol.Immunol.
240 PG. 21-57. 1999. Springer-Verlag: http://www.springer.de.
Haygood, Ralph, Anthony R. Ives, and David A. Andow. 2004. Population genetics of
transgene containment. Ecology Letters 7 (3):213-220.
Hellens, R. P., P. M. Mullineaux, and H. J. Klee. 2000. A guide to Agrobacterium
binary Ti vectors. Trends in Plant Science 5 (10):446-451.
162
Helms, B., and E. W. Meijer. 2006. Dendrimers at work. Science 313 (5789):929-30.
Hirsch, A M., A. Lee, W. Deng, and C. Tucker. 2010. An open-flower mutant of
Melilotus alba: potential for floral-dip transformation of a pilionoid legume with
a short life cycle? American Journal of Botany 97 (3):395–404.
Hoekema, A., P.R. Hirsch, P. J. J. Hooykaas, and R. A. Schilperoort. 1983. A binary
plant vector stretegy based on separation of vir and T region of the
Agrobacterium temefaciens Ti-plasmid. Nature 303:179-180.
Hoffmann, K. 1999. The optimisation of Agrobacterium-mediated transformation of
Lupinus angustifolius and engineering towards resistance to bean yellow mosaic
virus (BYMV). Biological Science, Murdoch University, Perth.
Holm, Preben Bach, Ole Olsen, Martin Schnorf, Henrik Brinch-Pedersen, and Søren
Knudsen. 2000. Transformation of barley by microinjection into isolated zygote
protoplasts. Transgenic Research 9 (1):21-32.
Holsters, M. 1980. The functional organisation of the nopaline A. tumefaciens plasmid
pTiC58. Plasmid 3:212-230.
Hood, E. E. 1986. The hypervirulence of Agrobacterium tumefaciens A281 is encoded
in the region of pTiBo542 outside the T-DNA. Bacteriology 168:1291-1301.
Hood, E. E., S. B. Gelvin, L. S. Melchers, and A. Hoekema. 1993. New Agrobacterium
Helper Plasmids for Gene Transfer to Plants. Transgenic Research 2 (4):208-
218.
Horsch, R. B., J. E. Fry, N. L. Hoffmann, D. Eicholtz, S.G. Rogers, and R. T. Fraley.
1985. A simple and general method for transferring genes into plants. Science
227:1229-1231.
Huang FC, Klaus SM, Herz S, Zou Z, Koop HU, Golds TJ. 2002. Efficient plastid
transformation in tobacco using the aphA-6 gene and kanamycin selection.
Molecular Genetics and Genomics 268:19-27
Humara JM, Marin MS, Parra F, Ordas RJ. 1999. Improved efficiency of uidA gene
transfer in stone pine (Pinus pinea) cotyledons using a modified binary vector.
Canadian Journal of Forest Research-Journal Canadien de la Recherche
Forestiere 29:1627-1632
Humara, J. M., M. Lopez, and R. J. Ordas. 1999. Agrobacterium tumefaciens-mediated
transformation of Pinus pinea L cotyledons: an assessment of factors
influencing the efficiency of uidA gene transfer. Plant Cell Reports 19 (1):51-
58.
163
Humara, J. M., M. Lopez, and R. J. Ordas. 1999. Transient expression of the uidA gene
in Pinus pinea cotyledons: A study of heterologous promoter sequences. Plant
Cell Tissue & Organ Culture 56 (2):69-78.
Hunold R, Burrus M, Bronner R, Duret JP, Hahne G. 1995. Transient Gene Expression
in Sunflower (Helianthus Annuus L) Following Microprojectile Bombardment.
Plant Science 105:95-109
Irish V. 1991. Cell lineage in plant development. Current Opinion in Genetics and
Development 1:169-173
Iser M, Fettig S, Scheyhing F, Viertel K, Hess D. 1999. Genotype-dependent stable
genetic transformation in German spring wheat varieties selected for high
regeneration potential. Journal of Plant Physiology 154:509-516
Ivic-Haymes SD, Smigocki AC. 2005. Biolistic transformation of highly regenerative
sugar beet (Beta vulgaris L.) leaves. Plant Cell Reports 23:699-704
James, Clive. 2011. Global Status of Commercialised Biotech/GM Crops: 2011. ISAAA
Brief 43-2011: Executive Summary, International Service for the Acquisition of
Agri-Biotech Applications (ISAAA)
Jen, G. C., and M. D. Chilton. 1986. The right border region of pTiT37 T-DNA is
intrinsically more active than the left border in promoting T-DNA
transformation. Proceedings of the National Academy of Sciences of the United
States of America 83:3895-3899.
Joersbo, Morten, and Janne Brunstedt. 1992. Sonication: A new method for gene
transfer to plants. Physiologia Plantarum 85 (2):230-234.
Jordan, M. C., and S. L. A. Hobbs. 1994. The transformation of legumes using
Agrobacterium tumefaciens. In Biotechnological applications of plant cultures,
edited by P. D. Shargool and T. T. Ngo. Boca Raton: CRC Press.
Jorgensen RA, Cluster PD, English J, Que Q, Napoli CA. 1996. Chalcone synthase
cosuppression phenotypes in petunia flowers: comparison of sense vs. antisense
constructs and single copy vs. complex T-DNA sequences. Plant Molecular
Biology 31:957-973
Jouanin, L., D. Bouchez, D. Tepfer, and J. L. Slightom. 1989. Analysis of TR-
DNA/plant junctions in the genome of a C. arvensis clone transformed with
Agrobacterium rhizogenes strain A4. Plant Molecular Biology 12:75-85.
Kado, C. I. 1991. Molecular Mechanisms of Crown Gall Tumorigenesis. Critical
Reviews in Plant Sciences 10 (1):1-32.
164
Kaeppler, H. F., D. A. Somers, H. W. Rines, and A. Cockburn. 1992. Silicon carbide
fiber-mediated stable transformation of plant cells. Theoretical Applied Genetics
84:560-566.
Kaeppler, H. F., W. Gu, D. A. Somers, H. W. Rines, and A. Cockburn. 1990. Silicon
carbide fiber-mediated DNA delivery into plant cells. Plant Cell Reports 9:415-
418.
Kang TJ, Han SC, Kim MY, Kim YS, Yang MS. 2004. Expression of non-toxic mutant
of Escherichia coli heat-labile enterotoxin in tobacco chloroplasts. Protein
Expression and Purification 38:123-128
Katavic, V., G. W. Haughn, D. Reed, M. Martin, and L. Kunst. 1994. In Planta
Transformation of Arabidopsis thaliana. Molecular & General Genetics 245
(3):363-370.
Ke, J., R. Khan, T. Johnson, D. A. Somers, and A. Das. 2001. High-efficiency gene
transfer to recalcitrant plants by Agrobacterium tumefaciens. Plant Cell Reports
20 (2):150-156.
Keshamma, E., Rohini Sreevathsa, A. Kumar, Kalpana Reddy, M. Manjulatha, N.
Shanmugam, and M. Udayakumar. 2011. Agrobacterium-Mediated In Planta
Transformation of Field Bean (Lablab purpureus L.) and Recovery of Stable
Transgenic Plants Expressing the cry1AcF Gene. Plant Molecular Biology
Reporter: 1-12.
Klein TM, Gradziel T, Fromm ME, Sanford JC. 1988. Factors influencing gene delivery
into Zea mays cells by high-velocity microprojectiles. Biotechnology 6:559-563.
Klein TM, Kornstein L, Sanford JC, Fromm ME. 1989. Genetic Transformation of
Maize Cells by Particle Bombardment. Plant Physiology 91:440-444
Kohli A, Griffiths S, Palacios N, Twyman RM, Vain P, Laurie DA, Christou P. 1999.
Molecular characterization of transforming plasmid rearrangements in transgenic
rice reveals a recombination hotspot in the CaMV 35S promoter and confirms
the predominance of microhomology mediated recombination. Plant Journal
17:591-601
Kohli, A., M. Leech, P. Vain, D. A. Laurie, and P. Christou. 1998. Transgene
Organization in Rice Engineered through Direct DNA Transfer Supports a Two-
Phase Integration Mechanism Mediated by the Establishment of Integration Hot
Spots. Proceedings of the National Academy of Sciences of the United States of
America 95 (12):7203-7208.
Kojima, Mineo, Hidenari Shioiri, Masahiro Nogawa, Masayuki Nozue, Daisuke
Matsumoto, Asami Wada, Yumi Saiki, and Kenji Kiguchi. 2004. In planta
transformation of kenaf plants (Hibiscus cannabinus var. aokawa No. 3) by
165
Agrobacterium tumefaciens. Journal of Bioscience and Bioengineering 98
(2):136-139.
Komari T., Hiei Y., Saito Y., Murai N., and Kumashiro T. 1996. Vectors carrying two
separate T-DNAs for co-transformation of higher plants mediated by
Agrobacterium tumefaciens and segregation of transformants free from selection
markers. Plant Journal 10 165–174
Komori, T., Imayama, T., Kato, N., Ishida, Y., Ueki, J., and Komari, T. Current Status
of Binary Vectors and Superbinary Vectors. Plant Physiology 145: 1155-1160
Koncz, C., and J. Schell. 1986. The promoter of TL-DNA gene 5 controls the tissue-
specific expression of chimeric genes carried by a novel type of Agrobacterium
binary vector. Molecular General Genetics 204:383-396.
Kost, Benedikt, Alessandro Galli, Ingo Potrykus, and Gunther Neuhaus. 1995. High
efficiency transient and stable transformation by optimized DNA microinjection
into Nicotiana tabacum protoplasts. Journal of Experimental Botany 46
(9):1157-1167.
Kuta, D. D., and L. Tripathi. 2005. Agrobacterium-induced hypersensitive necrotic
reaction in plant cells: a resistance response against Agrobacterium-mediated
DNA transfer. African Journal of Biotechnology 4 (8):752-757.
Kuvshinov, V., K. Koivu, A. Kanerva, and E. Pehu. 1999. Agrobacterium tumefaciens-
mediated transformation of greenhouse-grown Brassica rapa ssp oleifera. Plant
Cell Reports 18 (9):773-777.
Lacroix, B., and V. Citovsky. 2009. Agrobacterium aiming for the host chromatin: Host
and bacterial proteins involved in interactions between T-DNA and plant
nucleosomes. Communicative and Integrative Biology 2 (1):42-5.
Lazo, G.R. 1991. A DNA transformation-competent Arabidopsis genomic library in
Agrobacterium. Biotechnology 9:963-967.
Lee, David, and Ellen Natesan. 2006. Evaluating genetic containment strategies for
transgenic plants. Trends in Biotechnology 24 (3):109-114.
Lee, Y. P., T. A. Mori, I. B. Puddey, S. Sipsas, T. R. Ackland, L. J. Beilin, and J. M.
Hodgson. 2009. Effects of lupin kernel flour-enriched bread on blood pressure: a
controlled intervention study. The American Journal of Clinical Nutrition 89
(3):766-72.
Lee, Y. P., T. A. Mori, S. Sipsas, A. Barden, I. B. Puddey, V. Burke, R. S. Hall, and J.
M. Hodgson. 2006. Lupin-enriched bread increases satiety and reduces energy
intake acutely. The American Journal of Clinical Nutrition 84 (5):975-80.
166
Lee, Y. W., S. G. Jin, W. S. Sim, and E. W. Nester. 1995. Genetic Evidence for Direct
Sensing of Phenolic Compounds by the Vira Protein of Agrobacterium
tumefaciens. Proceedings of the National Academy of Sciences of the United
States of America 92 (26):12245-12249.
Li B, Wolyn DJ. 1997. Recovery of transgenic asparagus plants by particle gun
bombardment of somatic cells. Plant Science 126:59-68
Li HY, Zhu YM, Chen Q, Conner RL, Ding XD, Li J, Zhang BB. 2004. Production of
Transgenic Soybean Plants with Two Anti-Fungal Protein Genes via
Agrobacterium and Particle Bombardment. Biologia Plantarum 48:367-374
Li, H., S. J. Wylie, and M. G. K. Jones. 2000. Transgenic yellow lupin (Lupinus luteus).
Plant Cell Reports 19 (6):634-637.
Li, Z, R. Nelson, J. Widholm, and A Bent. 2002. Soybean transformation via the pollen
tube pathway. Soybean Genetics Newsletter 29:1-11.
Lichtenstein, C., and S. L. Fuller. 1987. Vectors for the genetic engineering of plants. In
Genetic Engineering, edited by P. W. J. Rigby. London: Academic Press.
Lippincott, J. A., B. B. Lippincott, and M. P. Starr. 1981. The Genus Agrobacterium. In
The Prokaryotes, A Handbook on Habitats, Isolation, and Identification of
Bacteria, edited by M. P. Starr, Stolp, H., Truper, H. G., Barlows, A., Schlegel,
H. G. Berlin, Heidelberg, New York: Springer-Verlag.
Liu CW, Lin CC, Chen JJ, Tseng MJ. 2007. Stable chloroplast transformation in
cabbage (Brassica oleracea L. var. capitata L.) by particle bombardment. Plant
Cell Reports 26:1733-1744
Liu, Y-G, Y. Shirano, H. Fukaki, Y. Yanai, M. Tasaka, S. Tabata, and D. Shibata. 1999.
Complementation of plant mutants with large genomic DNA fragments by a
transformation-competent artificial chromosome vector accelerates positional
cloning. Proceedings of the National Academy of Sciences of the United States
of America 96 (May):6535-6540.
Longnecker, N., R. Brennan, and A. Robson. 1998. Lupin nutrition. In Lupins as crop
plants: Biology, Production and Utilisation, edited by J. S. Gladstones, C.
Atkins and J. Hamblin: CAB International.
Lu, Chaofu, and Jinling Kang. 2008. Generation of transgenic plants of a potential
oilseed crop Camelina sativa by Agrobacterium-mediated transformation. Plant
Cell Reports 27 (2):273-278.
Lucas, O., J. Kallerhoff, and G. Alibert. 2000. Production of stable transgenic
sunflowers (Helianthus annuus L.) from wounded immature embryos by particle
167
bombardment and co-cultivation with Agrobacterium tumefaciens. Molecular
Breeding 6 (5):479-487.
Lusk, J.L, and P Sullivan. 2002. Consumer acceptance of genetically modified foods.
Food Technology 56:32-37.
Ma, Q, N. Longnecker, and C. Atkins. 1998. Exogenous cytokinin and nitrogen do not
increase grain yield in narrow-leafed lupins. Crop Science 38:717-721.
MacKenzie, D.R., P.M. Anderson, and C.C. Wernham. 1966. A mobile air blast
inoculator for plot experiments with maize dwarf mosaic virus. Plant Disease
Report 50:363-367.
Maenpaa P, Gonzalez EB, Ahlandsberg S, Jansson C. 1999. Transformation of nuclear
and plastomic plant genomes by biolistic particle bombardment. Mol Biotechnol
13:67-72
Mahmoudian, M., M. Yucel, and H. A. Oktem. 2002. Transformation of Lentil (Lens
culinaris M.) cotyledonary nodes by vacuum infiltration of Agrobacterium
tumefaciens. Plant Molecular Biology Reporter 20:251-257.
Manickavasagam, M., A. Ganapathi, V. R. Anbazhagan, B. Sudhakar, N. Selvaraj, A.
Vasudevan, and S. Kasthurirengan. 2004. Agrobacterium-mediated genetic
transformation and development of herbicide-resistant sugarcane (Saccharum
species hybrids) using axillary buds. Plant Cell Reports 23: 134-143.
Marchant R, Power JB, Lucas JA, Davey MR. 1998. Biolistic Transformation of Rose
(Rosa Hybrida L.). Annals of Botany 81:109-114
Matthysse, A. G. 1986. Initial interactions of Agrobacterium tumefaciens with plant
host cells. Critical Review of Microbiology 13 (3):281-307.
Matthysse, A. G. 1987. Characterization of nonattaching mutants of Agrobacterium
tumefaciens. Journal of Bacteriology 169 (1):313-23.
Matthysse, A. G. 1987. Effect of Plasmid pSa and of Auxin on Attachment of
Agrobacterium tumefaciens to Carrot Cells. Applied and Environmental
Microbiology 53 (10):2574-2582.
Matthysse, A. G., H. Yarnall, S. B. Boles, and S. McMahan. 2000. A region of the
Agrobacterium tumefaciens chromosome containing genes required for
virulence and attachment to host cells. Biochimica et Biophysica Acta - Gene
Structure & Expression 1490 (1-2):208-212.
Matzke AJM, Neuhuber F, Park YD, Ambros PF, Matzke MA. 1994. Homology-
Dependent Gene Silencing in Transgenic Plants - Epistatic Silencing Loci
168
Contain Multiple Copies of Methylated Transgenes. Molecular & General
Genetics 244:219-229
Mauro, A.O., T.W. Pfeiffer, and G. B. Collins. 1995. Inheritance of soybean
susceptibility to Agrobacterium tumefaciens and its relationship to
transformation. Crop Science 35:1152-1156.
McBride, K.E., and K. R. Summerfelt. 1990. Improved binary vectors for
Agrobacterium-mediated plant transformation. Plant Molecular Biology 14:269-
276.
McCabe D, Christou P. 1993. Direct DNA Transfer Using Electric Discharge Particle
Acceleration (Accell(Tm) Technology). Plant Cell Tissue & Organ Culture
33:227-236
Mccabe, D.E., W.F. Swain, B.J. Martinell, and P. Christou. 1988. Stable transformation
of soybean (Glycine max) by paticle accerleration. Bio-Technology 6:923-926.
McCormac, A. C., M. R. Fowler, D. F. Chen, and M. C. Elliott. 2001. Efficient co-
transformation of Nicotiana tabacum by two independent T-DNAs, the effect of
T-DNA size and implications for genetic separation. Transgenic Research 10
(2):143-155.
McCown BH, McCabe D, Russell DR, Robinson DJ, Barton KA, Raffa KF. 1991.
Stable transformation of Populus and incorporation of pest resistance by electric
discharge particle acceleration. Plant Cell Reports 9:590-594.
McCullen, Colleen A., and Andrew N. Binns. 2006. Agrobacterium tumefaciens and
Plant Cell Interactions and Activities Required for Interkingdom
Macromolecular Transfer. Annual Review of Cell and Developmental Biology 22
(1):101-127.
McKnight T. D., Lillis M. T., and Simpson R. B. 1987. Segregation of genes transferred
to one plant cell from two separate Agrobacterium strains. Plant Molecular
Biology 8 439–445.
Medgyesy, P., A. Pa´y, and L. Ma´rton. 1986. Transmission of paternal chloroplasts in
Nicotiana. Molecular and General Genetics 204:195-198.
Men S, Ming X, Wang Y, Liu R, Wei C, Li Y. 2003. Genetic transformation of two
species of orchid by biolistic bombardment. Plant Cell Reports 21:592-598.
Mendel RR, Muller B, Schluze J, Kolesnikov V, Zelenin A. 1989. Delivery of foreign
genes to intact barley cells by high-velocity microprojectiles. Theoretical
Applied Genetics 78:31-34.
169
Meurer, C. A., R. D. Dinkins, and G. B. Collins. 1998. Factors affecting soybean
cotyledonary node transformation. Plant Cell Reports 18 (3-4):180-186.
Moore PJ, Moore AJ, Collins GB. 1994. Genotypic and Developmental Regulation of
Transient Expression of a Reporter Gene in Soybean Zygotic Cotyledons. Plant
Cell Reports 13:556-560
Mozsar, J., O. Viczian, and S. Sule. 1998. Agrobacterium-Mediated Genetic
Transformation of an Interspecific Grapevine. Vitis 37 (3):127-130.
Murray, P. J. 1994. The use of lupins as feed for sheep. Paper read at Proceedings of the
First Australian Lupin Technical Symposium, at Perth.
Mysore, K. S., J. Nam, and S. B. Gelvin. 2000. An Arabidopsis histone H2A mutant is
deficient in Agrobacterium T-DNA integration. Proceedings of the National
Academy of Sciences of the United States of America 97 (2):948-953.
Nagatani, N., H. Honda, T. Shimada, and T. Kobayashi. 1997. DNA delivery into rice
cells and transformation using silicon carbide whiskers. Biotechnology
Techniques 11:471-473.
Nam, J., A. G. Matthysse, and S. B. Gelvin. 1997. Differences in Susceptibility of
Arabidopsis Ecotypes to Crown Gall Disease May Result from a Deficiency in
T-DNA Integration. Plant Cell 9 (3):317-333.
Nam, J., K. S. Mysore, C. Zheng, M. K. Knue, A. G. Matthysse, and S. B. Gelvin. 1999.
Identification of T-DNA tagged Arabidopsis mutants that are resistant to
transformation by Agrobacterium. Molecular and General Genetics 261 (3):429-
438.
Neff, N. T., and A. N. Binns. 1985. Agrobacterium tumefaciens Interaction with
Suspension-Cultured Tomato Cells. Plant Physiology 77 (1):35-42.
Nester, E. W., and M. P. Gordon. 1991. Molecular strategies in the interaction between
Agrobacterium and its hosts. In Advances in Molecular Genetics of Plant-
Microbe Interactions., edited by H. Hennecke and D. P. S. Verma. Netherlands:
Kluwer Academic Publishers.
Neuhaus, G., G. Spangenberg, O. Mittelsten Scheid, and H. G. Schweiger. 1987.
Transgenic rapeseed plants obtained by the microinjection of DNA into
microspore-derived embryoids. Theoretical and Applied Genetics 75 (1):30-36.
Nielsen, Kaare M. 2003. Transgenic organisms-time for conceptual diversification?
Nature Biotechnology 21 (3):227-228.
170
Odell, J., P. Caimi, B. Sauer, and S. Russell. 1990. Site-directed recombination in the
genome of transgenic tobacco. Molecular and General Genetics 223 (3):369-
378.
O'Kennedy MM, Burger JT, Botha FC. 2004. Pearl millet transformation system using
the positive selectable marker gene phosphomannose isomerase. Plant Cell
Reports 22:684-690
Olhoft, P. M., L. E. Flagel, C. M. Donovan, and D. A. Somers. 2003. Efficient soybean
transformation using hygromycin B selection in the cotyledonary-node method.
Planta 216 (5):723-35.
Olhoft, PM, K Lin, J Galbraith, NC Nielsen, and DA Somers. 2001. The role of thiol
compounds in increasing Agrobacterium-mediated transformation of soybean
cotyledonary-node cells. Plant Cell Reports 20:731-737.
Park, B. J., Z. Liu, A. Kanno, and T. Kameya. 2005. Transformation of radish
(Raphanus sativus L.) via sonication and vacuum infiltration of germinated
seeds with Agrobacterium harboring a group 3 LEA gene from B. napus. Plant
Cell Reports 24(8):494–500.
Park, J. H., G. J. Kim, and H. S. Kim. 2000. Production of D-amino acid using whole
cells of recombinant Escherichia coli with separately and coexpressed D-
hydantoinase and N-carbamoylase. Biotechnology Progress 16 (4):564-70.
Park, S. H., B. M. Lee, M. G. Salas, M. Srivatanakul, and R. H. Smith. 2000. Shorter T-
DNA or additional virulence genes improve Agrobacterium-mediated
transformation. Theoretical and Applied Genetics 101 (7):1015-1020.
Parveez GKA, Chowdhury MKU, Saleh NM. 1997. Physical Parameters Affecting
Transient Gus Gene Expression in Oil Palm (Elaeis Guineensis Jacq) Using the
Biolistic Device. Industrial Crops & Products 6:41-50
Pasupathy, K., S. Lin, Q. Hu, H. Luo, and P. C. Ke. 2008. Direct plant gene delivery
with a poly (amidoamine) dendrimer. Biotechnology Journal 3 (8):1078-82.
Pathak, Malabika, and Riyad Hamzah. 2008. An effective method of sonication-assisted
Agrobacterium-mediated transformation of chickpeas. Plant Cell, Tissue and
Organ Culture 93 (1):65-71.
Pawlowski WP, Somers DA. 1996. Transgene inheritance in plants genetically
engineered by microprojectile bombardment. Molecular Biotechnology 6:17-30
Pawlowski WP, Somers DA. 1998. Transgenic DNA integrated into the oat genome is
frequently interspersed by host DNA. Proceedings of the National Academy of
Sciences of the United States of America 95:12106-12110
171
Peralta, G. E., R. Helmiss, and W. Ream. 1986. "overdrive", a T-DNA transmission
enhancer on the Agrobacterium tumefaciens tumor-inducing plasmid. EMBO
Journal 5:1137-1142.
Pereira LF, Erickson L. 1995. Stable transformation of alfalfa (Medicago sativa L.) by
particle bombardment. Plant Cell Reports 14:290-293.
Perry, M. W., M. Dracup, P. Nelson, R. Jarvis, I. Rowland, and R. J. French. 1998.
Agronomy and farming systems. In Lupins as crop plants: Biology, Production
and Utilization., edited by J. S. Gladstones, C. Atkins and J. Hamblin: CAB
International.
Pescitelli, S., and K. Sukhapinda. 1995. Stable transformation via electroporation into
maize Type II callus and regeneration of fertile transgenic plants. Plant Cell
Reports 14 (11):712-716.
Petit, A., and J. Tempe. 1985. The function of T-DNA in nature. In Molecular Form
and Function of the Plant Genome, edited by L. Van Vloten-Doting, G. Groot
and T. Hall. New York: Plenum Press.
Petolino, J. F., N. L. Hopkins, B. D. Kosegi, and M. Skokut. 2000. Whisker-mediated
transformation of embryogenic callus of maize. Plant Cell Reports 19 (8):781-
786.
Pigeaire, Alix, Deborah Abernethy, Penelope M. Smith, Kaylene Simpson, Natalie
Fletcher, Chin-Yi Lu, Craig A. Atkins, and Edwina Cornish. 1997.
Transformation of a grain legume (Lupinus angustifolius L.) via Agrobacterium
tumefaciens-mediated gene transfer to shoot apices. Molecular Breeding 3
(5):341-349.
Pónya, Z., P. Finy, A. Fehér, J. Mitykó, D. Dudits, and B. Barnabás. 1999. Optimisation
of introducing foreign genes into egg cells and zygotes of wheat (Triticum
aestivum L.) via microinjection. Protoplasma 208 (1):163-172.
Potrykus, I. 1990. Gene transfer to plants: assessment and perspectives. Physiologia
Plantarum 79:125-134.
Putnam, D. H., L. A. Field, L. L. Hardman, and S. R. Simmonds. 1991. Agronomic
studies on white lupins in Minnesota. Paper read at Prospects for lupins in North
America Proc. Symp., at St. Paul, MN.
Qing, C. M., L. Fan, Y. Lei, D. Bouchez, C. Tourneur, L. Yan, and C. Robaglia. 2000.
Transformation of Pakchoi (Brassica rapa L. ssp chinensis) by Agrobacterium
infiltration. Molecular Breeding 6 (1):67-72.
Radhamony, R. N., A. M Prasad, and R. Srinivasan. 2005. T-DNA insertional
mutagenesis in Arabidopsis: a tool for functional genomics. Electronic Journal
of Biotechnology 8 (1):82-106.
172
Rajasekaran K, Hudspeth RL, Cary JW, Anderson DM, Cleveland TE. 2000. High-
frequency stable transformation of cotton (Gossypium hirsutum L.) by particle
bombardment of embryogenic cell suspension cultures. Plant Cell Reports
19:539-545.
Rakousky, S., T. Kocabek, R. Vincenciova, and M. Ondrej. 1998. Transient Beta-
Glucuronidase Activity after Infiltration of Arabidopsis thaliana by
Agrobacterium tumefaciens. Biologia Plantarum 40 (1):33-41.
Ramaiah SM, Skinner DZ. 1997. Particle Bombardment - a Simple and Efficient
Method of Alfalfa (Medicago Sativa L.) Pollen Transformation. Current Science
73:674-682.
Rasco-Gaunt S, Riley A, Cannell M, Barcelo P, Lazzeri PA. 2001. Procedures allowing
the transformation of a range of European elite wheat (Triticum aestivum L.)
varieties via particle bombardment. Journal of Experimental Botany 52:865-874.
Rashid, H., S. Yokoi, K. Toriyama, and K. Hinata. 1996. Transgenic Plant Production
Mediated by Agrobacterium in Indica Rice. Plant Cell Reports 15 (10):727-730.
Razzaq, A., I. Hafiz, I. Mahmood, and A. Hussain. 2011. Development of in planta
transformation protocol for wheat. African Journal of Biotechnology 10 (5):740-
750.
Register JC, 3rd, Peterson DJ, Bell PJ, Bullock WP, Evans IJ, Frame B, Greenland AJ,
Higgs NS, Jepson I, Jiao S. 1994. Structure and function of selectable and non-
selectable transgenes in maize after introduction by particle bombardment. Plant
Molecular Biology 25:951-961
Ritala A, Aspegren K, Kurten U, Salmenkallio-Marttila M, Mannonen L, Hannus R,
Kauppinen V, Teeri TH, Enari TM. 1994. Fertile transgenic barley to particle
bombardment of immature embryos. Plant Molecular Biology 24:317-325
Rodenburg, K. W., E. Scheerengroot, G. Vriend, and P. J. J. Hooykaas. 1994. The N-
Terminal Domain of VirG of Agrobacterium tumefaciens - Modelling and
Analysis of Mutant Phenotypes. Protein Engineering 7 (7):905-909.
Romano A, Raemakers K, Visser R, Mooibroek H. 2001. Transformation of potato
(Solanum tuberosum) using particle bombardment. Plant Cell Reports 20:198-
204
Rommens, C. M. 2007. Intragenic crop improvement: combining the benefits of
traditional breeding and genetic engineering. Journal of Agricultural and Food
Chemistry 55 (11):4281-8.
173
Rommens, C. M., J. M. Humara, J. Ye, H. Yan, C. Richael, L. Zhang, R. Perry, and K.
Swords. 2004. Crop improvement through modification of the plant's own
genome. Plant Physiology 135 (1):421-31.
Rossi, L., B Horn, and B. Tinland. 1996. Integration of complete transferred DNA units
is dependent on the activity of virulence E2 protein of Agrobacterium
tumefaciens. Proceedings of the National Academy of Sciences of the United
States of America 93:126-130.
Rowland, I. C., M. G. Mason, and J. Hamblin. 1986. Effects of lupins on soil fertility.
Paper read at Proceedings of the Fourth International Lupin Conference, at
Geraldton, Western Australia.
Ruf, Stephanie, Daniel Karcher, and Ralph Bock. 2007. Determining the transgene
containment level provided by chloroplast transformation. Proceedings of the
National Academy of Sciences of the United States of America 104 (17):6998-
7002.
Russell DR, Wallace KM, Bathe JH, Martinell B, McCabe D. 1993. Stable
transformation of Phaseolus vulgaris via electric discharge mediated particle
acceleration. Plant Cell Reports 12:165-169
Russell JA, Roy MK, Sanford JC. 1992. Physical trauma and tungsten toxicity reduce
the efficiency of biolistic transformation. Plant Physiology 98:1050-1056
Saalbach, I., T. Pickardt, D. R. Waddell, S. Hillmer, O. Schieder, and K. Muntz. 1995.
The Sulphur-Rich Brazil Nut 2s Albumin Is Specifically Formed in Transgenic
Seeds of the Grain Legume Vicia narbonensis. Euphytica 85 (1-3):181-192.
Saalbach, I., T. Pickardt, F. Machemehl, G. Saalbach, O. Schieder, and K. Muntz. 1994.
A Chimeric Gene Encoding the Methionine-Rich 2s Albumin of the Brazil Nut
(Bertholletia excelsa Hbk) Is Stably Expressed and Inherited in Transgenic
Grain Legumes. Molecular and General Genetics 242 (2):226-236.
Sailaja M, Tarakeswari M, Sujatha M. 2008. Stable genetic transformation of castor
(Ricinus communis L.) via particle gun-mediated gene transfer using embryo
axes from mature seeds. Plant Cell Reports 27:1509-1519.
Salam, M., K. Salam, G. Thomas, K. Adhikari, H. Dhammu, and G. Shea. 2005. e-
Variety Profiler for lupins in Western Australia. Department of Agriculture,
Western Australia 2005 [cited November 2005]. Available from
www.agric.wa.gov.au.
Salman, Hanna, Asmahan Abu-Arish, Shachar Oliel, Avraham Loyter, Joseph Klafter,
Rony Granek, and Michael Elbaum. 2005. Nuclear Localization Signal Peptides
Induce Molecular Delivery along Microtubules. Biophysical Journal 89
(3):2134-2145.
174
Sambrook, J., E. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory
Manual. 2 ed. New York: Cold Spring Harbor Laboratory Press.
Sanford JC, Devit MJ, Russell JA, Smith FD, Harpening PR, Roy MK, Johnston SA.
1991. An improved helium driven biolistic device. Technique 3:3-16
Sanford, J. C. 1988. The biolistic process. Trends in Biotechnology 6:299-302.
Sanford, J. C., T. M. Klein, E. D. Wolf, and N. Allen. 1987. Delivery of substances into
cells and tissues using a particle bombardment process. Particulate Science and
Technology 5:27-37.
Sankara Rao, K., Rohini Sreevathsa, Pinakee Sharma, E. Keshamma, and M. Udaya
Kumar. 2008. In planta transformation of pigeon pea: a method to overcome
recalcitrancy of the crop to regeneration in vitro. Physiology and Molecular
Biology of Plants 14 (4):321-328.
Santarem ER, Finer JJ. 1999. Transformation of soybean (Glycine max (L.) Merrill)
using proliferative embryogenic tissue maintained on semi-solid medium. In
Vitro Cellular & Developmental Biology-Plant 35:451-455
Sargent RG, Brenneman MA, Wilson JH. 1997. Repair of site-specific double-strand
breakers in a mammalian chromosome by homologous and illegitimate
recombination. Molecular Cell Biology 17:267-277
Sato S, Newell C, Kolacz K, Tredo L, Finer J, Hinchee M. 1993. Stable Transformation
via Particle Bombardment in 2 Different Soybean Regeneration Systems. Plant
Cell Reports 12:408-413
Sautter C, Waldner H, Neuhaus-Url G, Galli A, Neuhaus G, Potrykus I. 1991. Micro-
targeting: high efficiency gene transfer using a novel approach for the
acceleration of micro-projectiles. Biotechnology (NY) 9:1080-1085
Sawahel WA. 2002. Stable genetic transformation of garlic plants using particle
bombardment. Cell Molecular Biology Letters 7:49-59
Scheiffele, P., W. Pansegrau, and E. Lanka. 1995. Initiation of Agrobacterium
tumefaciens T-DNA processing. Purified proteins VirD1 and VirD2 catalyze
site- and strand-specific cleavage of superhelical T-border DNA in vitro. The
Journal of Biological Chemistry 270 (3):1269-76.
Seki M, Shigemoto N, Komeda Y, Imamura J, Yamada Y, Morikawa H. 1991.
Transgenic Arabidopsis thaliana plants obtained by particle bombardment-
mediated transformation. Applied Microbiology & Biotechnology 36:228-230
175
Seraj, Z. I., Z. Islam, M. O. Faruque, T. Devi, and S. Ahmed. 1997. Identification of the
Regeneration Potential of Embryo Derived Calluses from Various Indica Rice
Varieties. Plant Cell Tissue & Organ Culture 48 (1):9-13.
Serik, O., I. Ainur, K. Murata, M. Tetsuo, and I. Masaki. 1996. Silicon carbide fiber-
mediated DNA delivery into cells of wheat (Triticum aestivum L.) mature
embryos. Plant Cell Reports 16:133-136.
Serres RA, Stang E, McCabe D, Russell DA, Mahr D, McCown BH. 1992. Gene
transfer using electric discharge particle bombardment and recovery of
transformed cranberry plants. Journal of the American Society for Horticultural
Science 117:174-180.
Shaw, C. H. 1984. The right hand copy of the nopaline Ti plasmid 25 bp repeat is
required for tumor formation. Nucleic Acids Reseach 12:6031-6041.
Sheng, J. S., and V. Citovsky. 1996. Agrobacterium- Plant Cell DNA Transport: Have
Virulence Proteins, Will Travel. [Review]. Plant Cell 8 (10):1699-1710.
Shibata, D., and Y. G. Liu. 2000. Agrobacterium-mediated plant transformation with
large DNA fragments. Trends in Plant Science 5 (8):354-7.
Shirgurkar MV, Naik VB, von Arnold S, Nadgauda RS, Clapham D. 2006. An efficient
protocol for genetic transformation and shoot regeneration of turmeric (Curcuma
longa L.) via particle bombardment. Plant Cell Reports 25:112-116
Slightom, J. L., M. Durand-Tardif, L. Jouanin, and D. Tepfer. 1986. Nucleotide
sequence analysis of TL-DNA Agrobacterium rhizogenes type plasmid:
Identification of open reading frames. Biological Chemistry 261:108-121.
Smyth, D. R., J. L. Bowman, and E. M. Meyerowitz. 1990. Early Flower Development
in Arabidopsis. The Plant Cell Online 2 (8):755-767.
Snavely, B. B., O. G. Peterson, and R. F. Reithel. 1967. Blue Laser Emission from a
Flashlamp-Excited Organic Dye Solution. Applied Physics Letters 11: 275-276
Somers DA, Rines HW, Gu W, Kaeppler HF, Bushnell WR. 1992. Fertile, transgenic
oat plants. Bio-Technology 10:1589-1594
Somers, D. A., D. A. Samac, and P. M. Olhoft. 2003. Recent advances in legume
transformation. Plant Physiology 131 (3):892-9.
Southgate EM, Davey MR, Power JB, Westcott RJ. 1998. A Comparison of Methods
for Direct Gene Transfer into Maize (Zea Mays L.). In Vitro Cellular &
Developmental Biology-Plant 34:218-224.
176
Sripaoraya S, Marchant R, Power JB, Davey MR. 2001. Herbicide-tolerant transgenic
pineapple (Ananas comosus) produced by microprojectile bombardment. Annals
of Botany 88:597-603.
Sugita, K., E. Matsunaga, and H. Ebinuma. 1999. Effective selection system for
generating marker-free transgenic plants independent of sexual crossing. Plant
Cell Reports 18 (11):941-947.
Sujatha, M., and M. Sailaja. 2005. Stable genetic transformation of castor (Ricinus
communis L.) via Agrobacterium tumefaciens-mediated gene transfer using
embryo axes from mature seeds. Plant Cell Reports 23 (12):803-10.
Supartana, Putu, Tsutomu Shimizu, Hidenari Shioiri, Masahiro Nogawa, Masayuki
Nozue, and Mineo Kojima. 2005. Development of simple and efficient in planta
transformation method for rice (Oryza sativa L.) using Agrobacterium
tumefaciens. Journal of Bioscience and Bioengineering 100 (4):391-397.
Svenson, S. 2009. Dendrimers as versatile platform in drug delivery applications.
European Journal of Pharmaceutics and Biopharmaceutics 71 (3):445-62.
Svitashev S, Ananiev E, Pawlowski WP, Somers DA. 2000. Association of transgene
integration sites with chromosome rearrangements in hexaploid oat. Theoretical
and Applied Genetics 100:872-880
Swart, S., B. J. Lugtenberg, G. Smit, and J. W. Kijne. 1994. Rhicadhesin-mediated
attachment and virulence of an Agrobacterium tumefaciens chvB mutant can be
restored by growth in a highly osmotic medium. Journal of Bacteriology 176
(12):3816-9.
Swart, S., T. J. J. Logman, G. Smit, B. J. J. Lugtenberg, and J. W. Kijne. 1994.
Purification and Partial Characterization of a Glycoprotein from Pea (Pisum
Sativum) with Receptor Activity for Rhicadhesin, an Attachment Protein of
Rhizobiaceae. Plant Molecular Biology 24 (1):171-183.
Szegedi, E., and P. Kozma. 1984. Studies on the inheritance of resistance to crown gall
disease of grapevine. Vitis 23:121-126.
Tague, B. W. 2001. Germ-line transformation of Arabidopsis lasiocarpa. Transgenic
Research 10 (3):259-67.
Takumi S, Shimada T. 1997. Variation in Transformation Frequencies among Six
Common Wheat Cultivars through Particle Bombardment of Scutellar Tissues.
Genes & Genetic Systems 72:63-69.
Tao LZ, Xu QS, Liang CY, Ling DH. 2000. Factors influence on transformation by
particle bombardment in Indica rice. Shi Yan Sheng Wu Xue Bao 33:85-88.
177
Tao, Y., P. K. Rao, S. Bhattacharjee, and S. B. Gelvin. 2004. Expression of plant
protein phosphatase 2C interferes with nuclear import of the Agrobacterium T-
complex protein VirD2. Proceedings of the National Academy of Sciences of the
United States of America 101 (14):5164-9.
Tee CS, Maziah M. 2005. Optimization of biolistic bombardment parameters for
Dendrobium Sonia 17 calluses using GFP and GUS as the reporter system. Plant
Cell, Tissue and Organ Culture 80:77-89
Thomas, S., J. Plazinski, G. Rawlin, and C. Deane. 2001. Agricultural Biotechnology:
What is happening in Australia in 2000. [Internet:
www.brs.gov.au/agrifood/biotechpub.html#_Toc486668082]. Bureau of Rural
Sciences Australia, 29 May 2000 [cited 17 April 2001].
Thomashow, M. F., J. E. Karlinsey, J. R. Marks, and R. E. Hurlbert. 1987. Identification
of a new virulence locus in Agrobacterium tumefaciens that affects
polysaccharide composition and plant cell attachment. Journal of Bacteriology
169 (7):3209-16.
Tinland, B., F. Schoumacher, V. Gloeckler, A. M. Bravoangel, and B. Hohn. 1995. The
Agrobacterium tumefaciens Virulence D2 Protein Is Responsible for Precise
Integration of T-DNA into the Plant Genome. EMBO Journal 14 (14):3585-
3595.
Tjokrokusumo, D., T. Heinrich, S. J. Wylie, R. Potter, and J. A. McComb. 2000.
Vacuum infiltration of Petunia hybrida pollen with Agrobacterium tumefaciens
to achieve plant transformation. Plant Cell Reports 19:792-797.
Tomes DT, Wessinger AK, Ross M, Higgins R, Drimmond BJ, Schaff S, Malone-
Sconeberg J, Staebell M, Flynn P, Anderson J, Howard J. 1990. Transgenic
tobacco plants derived by microprojectile bombardment of tobacco leaves. Plant
Molecular Biology 14:261-268
Toro, N., A. Datta, M. Yanofsky, and E. Nester. 1988. Role of the overdrive sequence
in T-DNA border cleavage in Agrobacterium. Proceedings of the National
Academy of Sciences of the United States of America 85 (22):8558-62.
Touraev, A., E. Stoger, V. Voronin, and E. Heberlebors. 1997. Plant Male Germ Line
Transformation. Plant Journal 12 (4):949-956.
Trick, H. N., and J. J. Finer. 1997. SAAT - Sonication-Assisted Agrobacterium-
Mediated Transformation. Transgenic Research 6 (5):329-336.
Trick, H. N., and J. J. Finer. 1998. Sonication Assisted Agrobacterium-Mediated
Transformation of Soybean (Glycine max (L.) Merrill) Embryogenic Suspension
Culture Tissue. Plant Cell Reports 17 (6-7):482-488.
178
Trieu, A. T., S. H. Burleigh, I. V. Kardailsky, I. E. Maldonado-Mendoza, W. K.
Versaw, L. A. Blaylock, H. Shin, T. J. Chiou, H. Katagi, G. R. Dewbre, D.
Weigel, and M. J. Harrison. 2000. Transformation of Medicago truncatula via
infiltration of seedlings or flowering plants with Agrobacterium. Plant Journal
22 (6):531-41.
Tucker, S. C., and K. E. Kantz. 2001. Open carpels with ovules in Fabaceae.
International Journal of Plant Sciences 162:1065 – 1073.
Tzfira, T., and V. Citovsky. 2002. Partners-in-infection: host proteins involved in the
transformation of plant cells by Agrobacterium. Trends in Cell Biology 12
(3):121-9.
Tzfira, T., M. Vaidya, and V. Citovsky. 2002. Increasing plant susceptibility to
Agrobacterium infection by overexpression of the Arabidopsis nuclear protein
VIP1. Proceedings of the National Academy of Sciences of the United States of
America 99 (16):10435-40.
Tzfira, T., M. Vaidya, and V. Citovsky. 2004. Involvement of targeted proteolysis in
plant genetic transformation by Agrobacterium. Nature 431 (7004):87-92.
Tzfira, Tzvi, Jianxiong Li, Benoît Lacroix, and Vitaly Citovsky. 2004. Agrobacterium
T-DNA integration: molecules and models. Trends in Genetics 20 (8):375-383.
Vain P, McMullen MD, Finer JJ. 1993. Osmotic treatment enhances particle
bombardment-mediated transient and stable transformation of maize. Plant Cell
Reports 12:84-88
van Barneveld, R. J., and R. J. Hughes. 1994. The nutritive value of lupins for pigs and
poultry. Paper read at Proceeding of the First Australian Lupin Technical
Symposium, at Perth.
van der Fits, L., E. A. Deakin, J. H. C. Hoge, and J. Memelink. 2000. The ternary
transformation system: constitutive virG on a compatible plasmid dramatically
increases Agrobacterium-mediated plant transformation. Plant Molecular
Biology 43 (4):495-502.
Van Sluys, M. A., C. B. Monteiro-Vitorello, L. E. Camargo, C. F. Menck, A. C. Da
Silva, J. A. Ferro, M. C. Oliveira, J. C. Setubal, J. P. Kitajima, and A. J.
Simpson. 2002. Comparative genomic analysis of plant-associated bacteria.
Annual Review of Phytopathology 40:169-89.
Vaneck JM, Blowers AD, Earle ED. 1995. Stable Transformation of Tomato Cell
Cultures after Bombardment with Plasmid and Yac DNA. Plant Cell Reports
14:299-304
179
Voisey, C. R., D. W. R. White, B. Dudas, R. D. Appleby, P. M. Ealing, and A. G. Scott.
1994. Agrobacterium-Mediated Transformation of White Clover Using Direct
Shoot Organogenesis. Plant Cell Reports 13 (6):309-314.
Wagner, V. T., and A. G. Matthysse. 1992. Involvement of a vitronectin-like protein in
attachment of Agrobacterium tumefaciens to carrot suspension culture cells.
Bacteriology 174:5999-6003.
Wang, K., C. Genetello, M. Van Montagu, and P. Zambryski. 1987a. Sequence context
of the T-DNA border repeat element determines its relative activity during T-
DNA transfer to plant cells. Molecular and General Genetics 210:338-346.
Wang, K., S. E. Stachel, B. Timmerman, M. Van Montagu, and P. Zambryski. 1987b.
Site-specific nick occurs within the 25-bp transfer promoting border sequence
following induction of vir gene expression in Agrobacterium tumefaciens.
Science 235:587-591.
Wang, W. C., G. Menon, and G. Hansen. 2003. Development of a novel
Agrobacterium-mediated transformation method to recover transgenic Brassica
napus plants. Plant Cell Reports 22 (4):274-81.
Watad AA, Yun DJ, Matsumoto T, Niu X, Wu Y, Kononowicz AK, Bressan RA,
Hasegawa PM. 1998. Microprojectile Bombardment Mediated Transformation
of Lilium longiflorum. Plant Cell Reports 17:262-267.
Watson, B. 1975. Plasmids required for virulence of Agrobacterium tumefaciens.
Bacteriology 123:255-264.
Weber, G., S. Monajembashi, K.O. Greulich, and J. Wolfrum. 1988a. Injection of DNA
into plant cells with a UV-laser microbeam. Naturwissenschaften 75:35-36.
Weber, G., S. Monajembashi, K.O. Greulich, and J. Wolfrum. 1988b. Genetic
manipulation of plant cells and organells with a laser microbeam. Plant Cell
Tissue & Organ Culture 12:219-222.
Weeks JT, Anderson OD, Blechl AE. 1993. Rapid Production of Multiple Independent
Lines of Fertile Transgenic Wheat (Triticum aestivum). Plant Physiology
102:1077-1084.
Weeks, J., Jingsong Ye, and Caius Rommens. 2008. Development of an in planta
method for transformation of alfalfa (Medicago sativa). Transgenic Research 17
(4):587-597.
Weising, K., and G. Kahl. 1996. Natural genetic engineering of plant cells- the
molecular biology of crown gall and hairy root disease [Review]. World Journal
of Microbiology & Biotechnology 12 (4):327-351.
180
Whitehead, N. A., Barnard A. M. L., H. Slater, N. J. L. Simpson, and G. P. C.
Salmond. 2001. Quorum sensing in Gram-negative bacteria. FEMS
Microbiology 25:365-404.
Wijayanto T, McHughen A. 1999. Genetic transformation of Linum by particle
bombardment. In Vitro Cellular & Developmental Biology-Plant 35:456-465.
Wright M, Dawson J, Dunder E, Suttie J, Reed J, Kramer C, Chang Y, Novitzky R,
Wang H, Artim-Moore L. 2001. Efficient biolistic transformation of maize (Zea
mays L.) and wheat (Triticum aestivum L.) using the phosphomannose isomerase
gene, pmi, as the selectable marker. Plant Cell Reports 20:429-436
Wu, H., C. Sparks, B. Amoah, and H. D. Jones. 2003. Factors influencing successful
Agrobacterium-mediated genetic transformation of wheat. Plant Cell Reports 21
(7):659-68.
Wylie SJ. 1996. Characterisation of the NIa gene of bean yellow mosaic virus, MI
isolate, and its use for pathogen-derived resistance. In: Biological Science.
Murdoch University, Perth
Wylie, S. J., S. Barker, S. Chapple, N. Fletcher, L Hodgson, P. Krishnamurthy, K.
Ratanasanobon, and P. Smith. 2002. Efficiency of gene transfer in lupin
cultivars. Paper read at First Australian Medicago truncatula Workshop, at
Rottnest Island, Perth, Australia.
Xu, H., X. Wang, H. Zhao, and F. Liu. 2008. An intensive understanding of vacuum
infiltration transformation of pakchoi (Brassica rapa ssp. chinensis). Plant Cell
Reports 27 (8):1369-76.
Yadav, N. S., J. Vanderleyden, D. R. Bennette, W. M. Barnes, and M. D. Chilton. 1982.
Short Direct Repeats Flank the T-DNA on a Nopaline Ti Plasmid. Proceedings
of the National Academy of Sciences of the United States of America 79:6322-
6326.
Yamashita T, Iida A, Morikawa H. 1991. Evidence that more than 90% of beta-
glucuronidase-expressing cells after particle bombardment directly recieve the
foreign gene in their nucleus. Plant Physiology 97:829-831
Yang, A. F., X. G. Duan, F. Gu, G. Zhang, and J. R. Zhang. 2005. Efficient
transformation of beet (Beta vulgaris) and production of plants with improved
salt-tolerance. Plant Cell, Tissue and Organ Culture 83:259-270.
Yanofsky, M. F., S. G. Porter, C. Young, L. M. Albright, M. P. Gordon, and E. W.
Nester. 1986. The virD operon of Agrobacterium tumefaciens encodes a site-
specific endonuclease. Cell 47 (3):471-7.
181
Yao QA, Simion E, William M, Krochko J, Kasha KJ. 1997. Biolistic Transformation
of Haploid Isolated Microspores of Barley (Hordeum Vulgare L). Genome
40:570-581.
Ye, G. N., D. Stone, S. Z. Pang, W. Creely, K. Gonzalez, and M. Hinchee. 1999.
Arabidopsis ovule is the target for Agrobacterium in planta vacuum infiltration
transformation. Plant Journal 19 (3):249-57.
Yepes LM, Mittak V, Pang SZ, Gonsalves C, Slightom JL, Gonsalves D. 1995. Biolistic
Transformation of Chrysanthemum with the Nucleocapsid Gene of Tomato
Spotted Wilt Virus. Plant Cell Reports 14:694-698.
Young, J. M. 2008. Revision of Agrobacterium nomenclature. In Agrobacterium: From
Biology to Biotechnology, edited by T. Tzfira and V. Citovsky: Springer-Verlag
Young, J. M., L. D. Kuykendall, E. Martinez-Romero, A. Kerr, and H. Sawada. 2001. A
revision of Rhizobium Frank 1889, with an emended description of the genus,
and the inclusion of all species of Agrobacterium Conn 1942 and Allorhizobium
undicola de Lajudie et al. 1998 as new combinations: Rhizobium radiobacter, R.
rhizogenes, R. rubi, R. undicola and R. vitis. International Journal of Systematic
and Evolutionary Microbiology 51 (Pt 1):89-103.
Zale, Janice, S. Agarwal, S. Loar, and C. Steber. 2009. Evidence for stable
transformation of wheat by floral dip in Agrobacterium tumefaciens. Plant Cell
Reports 28 (6):903-913.
Zambryski, P. 1983. Ti plasmid vectors for the introduction of DNA into plant cells
without alteration of their normal regeneration capacity. EMBO Journal 2:2143-
2150.
Zhang P, Legris G, Coulin P, Puonti-Kaerlas J. 2000. Production of stably transformed
cassava plants via particle bombardment. Plant Cell Reports 19:939-945
Zhang, H. B., L. H. Wang, and L. H. Zhang. 2002. Genetic control of quorum-sensing
signal turnover in Agrobacterium tumefaciens. Proceedings of the National
Academy of Sciences of the United States of America 99 (7):4638-43.
Zhang, L.J, L.M Cheng, N Xu, N.M Zhao, C.G Li, Y Jing, and S.R Ji. 1991. Efficient
transformation of tobacco by ultrasonication. Biotechnology 9:996-997.
Zhang, S., M. J. Cho, T. Koprek, R. Yun, P. Bregitzer, and P. G. Lemaux. 1999.
Genetic transformation of commercial cultivars of oat (Avena sativa L.) and
barley (Hordeum vulgare L.) using in vitro shoot meristematic cultures derived
from germinated seedlings. Plant Cell Reports 18 (12):959-966.
182
Zhao Y, Yu YC, Qian Q, Yan MX, Huang DN. 2003. Cotransformation of rice by bar
and cecropin B gene expression cassettes lacking vector backbone sequences. Yi
Chuan Xue Bao 30:135-141
Zheng, Q, Y Zheng, G Wang, W Guo, and Z Zhang. 2011. Sonication assisted
Agrobacterium-mediated transformation of chalcone synthase (CHS) gene to
Spring Dendrobium cultivar ‘Sanya’. African Journal of Biotechnology
10:11832-11838.
Zhu, Yanmin, Jaesung Nam, Nicholas C. Carpita, Ann G. Matthysse, and Stanton B.
Gelvin. 2003. Agrobacterium-Mediated Root Transformation Is Inhibited by
Mutation of an Arabidopsis Cellulose Synthase-Like Gene. Plant Physiology
133 (3):1000-1010.
Zimmerman, T. W., and R. Scorza. 1996. Genetic Transformation through the Use of
Hyperhydric Tobacco Meristems. Molecular Breeding 2 (1):73-80.
Zubkot MK, Zubkot EI, van Zuilen K, Meyer P, Day A. 2004. Stable transformation of
petunia plastids. Transgenic Research 13:523-530.
Zuker, A., A. Ahroni, T. Tzfira, H. Ben-Meir, and A. Vainstein. 1999. Wounding by
bombardment yields highly efficient Agrobacterium-mediated transformation of
carnation (Dianthus caryophyllus L.). Molecular Breeding 5 (4):367-375.
183
List of Abbreviations
µE microEinstein
µFD microFaraday
µM micromolar
4-MU 4-methylumbelliferone
4-MUG 4-methylumbelliferyl-β-D-galactopyranoside
ANOVA Analysis of variance
B5 vitamin Gamborg vitamin
BAP 6-benzylaminopurine
bp base pair
Bt cotton transgenic cotton with gene coding for Bacillus thuringiensis toxin
CaMV35S cauliflower mosaic virus 35s promoter
cDNA complementary DNA
CFU colony-forming unit
CLIMA Centre for Legumes in Mediterranean Agriculture
cm centrimeter
CSIRO The Commonwealth Scientific and Industrial Research Organisation
cv cultivar
DAFWA Department of Agriculture and Food, Western Australia
DMSO dimethyl sulfoxide
DNA deoxyribonucleic acid
dNTPs deoxynucleotide triphosphate
DPX Distrene-Plasticiser-Xylene
DTT dithiothreitol
FDA fluorescein diacetate
g gram
GM genetically modified
GUS β-glucuronidase
hr hour
IBA indolyl-3-butyric acid
kb kilobase
kV kilovolt
184
L liter
LB medium Luria-Bertani medium
LB left border
m meter
MES 2-(N-morpholino) ethanesulfonic acid
min minute
mL milliliter
mm Millimeter
MS Murashige and Skoog
MUG assay Fluorimetric assay for β-glucuronidase
N Number of samples
NAA α-naphthaleneacetic acid
ng nanogram
nos nopaline synthase gene
NPK nitrogen, phosphorus, and potassium
oC degrees celsius
ocs octopine synthase gene
OD600 optical density at 600 nm
PCR Polymerase chain reaction
P-DNA plant-derived transfer DNA
pmol picamole
ppm part per million
PPT Phosphinothricin
psi per square inch
rpm revolutions per minute
RT-PCR Reverse transcriptase polymerase chain reaction
s second
S.E. Standard error
SEM Scanning electron microscopy
Std. dev. Standard deviation
T0 primary transformant
T1 first generation transgenic plant
TAE buffer Tris-acetate-EDTA buffer
T-DNA transferred DNA
185
Ti tumour-inducing
UV ultraviolet
UWA University of Western Australia
X-gluc 5-bromo-4-chloro-3-indolyl β-D-glucuronide
Ω ohm
186
Presentations and Publications
Poster presentations
Ratanasanobon K., Wylie S. and Jones M.G.K. (2001) Investigations into improving
the transformation efficiency of Lupinus angustifolius. The Twelfth Annual Combined
Biological Sciences Meeting, Perth, Australia.
Ratanasanobon K., Wylie S. and Jones M.G.K. (2002) Investigation of particle
bombardment as an alternative transformation method for narrow-leafed lupin (Lupinus
angustifolius). The 10th IAPTC&B (International Association for Plant Tissue Culture
& Biotechnology) Congress: Plant Biotechnology 2002 and Beyond, Orlando, USA.
Wylie S., Fletcher N., Chapple S., Hodgson L., Ratanasanobon K., Smith P. and
Barker S. (2002) Efficiency of gene transfer in lupin cultivars. First Australian
Medicago truncatula Workshop, Perth, Australia.
Ratanasanobon K., Wylie S. and Jones M.G.K. (2004) In Planta transformation of
Narrow-leafed lupin (Lupinus angustifolius) seedlings. ComBio 2004 International
combined conference of Australian Society for Biochemistry and Molecular Biology
(ASBMB), Australia& New Zealand Society for Cell and Developmental Biology
(ANZSCDB) and Australian Society of Plant Scientists (ASPS), Perth, Australia.
Oral Presentation
Ratanasanobon K. (2001) Towards unravelling why gene transfer to lupins is so
difficult. Lupin Symposium 2001, Department of Agriculture, Perth, Australia.
Publication
Ratanasanobon K., Wylie S. and Jones M.G.K. (2004) Alternative Approaches to
Lupin Transformation. CLIMA Binaen Report (2003-2004), Perth, Australia.
187