Thesis ProjectThesis Project

Isolation and Characterization of an Isolation and Characterization of an Extracellular Antifungal Protein Extracellular Antifungal Protein

from an Endophytic Fungal Isolatefrom an Endophytic Fungal Isolate

Kamdar Maulik Rajendra (07BT3007)

Supervised by

Professor Mrinal Kumar MaitiDepartment of Biotechnology, IIT Kharagpur

Found in virtually every plant on earth. Reside in the living tissues of the host plant and do so in a variety of relationships ranging from symbiotic to pathogenic.Plant host is able to supply the necessary nutrients and the compounds required for the endophyte to complete its life cycle.

IntroductionIntroductionEndophytes: “microbes that colonize living internal tissues of plants without causing any immediate, overt negative effects”

Fig. Endophyte grows inside cell

Fig. Endophyte Life Cycle

The Study of EndophytesThe Study of Endophytes Increase of disease causing microbes, which are resistant to

drug therapy New antibiotics, chemotherapeutic agents to cure diseases Natural selection has been found to be superior to

combinatorial chemistry for discovering novel substances Novel bio-molecules are obtained from organism, like

endophytic fungi, that inhabits novel biotope. Plants are directly used as medicines by a majority of cultures

around the world, for example Chinese medicine and Indian medicine (Ayurveda).

Endophytes produce a wide range of bioactive natural compounds.

Medicinal plants are known to harbor Endophytic fungi. This group of microbes are not extensively studied at all.

ObjectivesObjectivesGoal: To isolate and characterize an extracellular antifungal protein (exAFP-C28) from endophytic fungi Colletotrichum sp. (Strain-DM06) associated with a medicinal plant Ocimum sanctum.

Isolation and molecular identification of endophytic fungal strainStudy of fungal growth on various culture conditions to find out the characteristic changes in the expression of protein synthesisIsolation and Purification of the extracellular antifungal protein exAFP-C28Determine minimal inhibition concentration (MIC) against Candida albicansStudy the surface morphology of Candida albicans under effect of exAFP-C28Determine effect of exAFP-C28 on membrane permeabilityEvaluation of hemolytic activity of exAFP-C28Molecular Mass Determination and Protein Sequence AnalysisBioinformatics analysis of the primary amino acid sequence, homology modeling and prediction of amphipathic nature of the helixes.

Isolation of endophytic fungiIsolation of endophytic fungi

Fresh plant parts Distilled water Ethanol 95%

NaOCl 0.5%

Incubate 25c for 7 days

Distilled water

BLOT DRY Cut in section

Surface sterilization

1 min

1 min

1 min

1 min

Ethanol 95%

Molecular IdentificationMolecular Identification 1 ml of fungal culture which contains about 5 x 105 number of

spores is inoculated in 100 ml culture media. Culture grown at 28°C for 48 Hrs. Mycelia is harvested from liquid culture by filtration through

Whatman filter paper no1. CTAB method used for fungal genomic DNA isolation.

Amplification performed with a denaturation step of 94°C for 3 min followed by 30 cycles of 94°C for 1 min denaturation, 55°C for 1 min, 72°C for 2 min and final extension of 72°C for 7 min.

The two amplified products (amplicons) were sequenced, and the sequences were analyzed by NCBI blast search.

Small subunit RNA (17-18S) primers Internal transcribed spacer region primers

TR1 GTTTCTAGGACCGCCGTATR2 CTCAAACTTCCATCGACTTG

ITS1 TCCGTAGGTGAACCTGCGGITS4 TCCTCCGCTTATTGATATGC

Optimization of Culture ConditionsOptimization of Culture Conditions

Colletotrichum sp. (Strain-DM06) was cultivated in various media. All liquid cultures were incubated in shaken 500 mL flasks containing 250 mL of medium at 28 °C and 150 rpm.

The fungal isolate was cultivated in media containing different carbon sources, nitrogen sources, and ambient pH.

Yeast extract peptone sucrose medium (YEPS) Yeast extract peptone dextrose medium (YEPD)Potato Dextrose Agarose Medium (PDA)Czapek DOX Broth Medium (CDX)

Separation of the Crude ProteinSeparation of the Crude Protein The media was inoculated and incubated at 150 rpm at 28oC

for around 4 days. Mycelia separated by Whatman Filter paper no1. 206 gm of (NH4)2SO4 added in small quantities every 10

minutes at 4°C , to avoid denaturation. Incubation for the entire night and centrifugation for 30

minutes at 4oC and 10000 rpm, and dissolution in Ammonium acetate buffer provides the protein extract. It is tested with Bradford’s reagent.

Process was repeated for at least 10 times. Following steps involve dialysis and lyophilization. Protein Gel was run with the materials being prepared as

stated above using a protein Gel apparatus.

Purification of the Crude ProteinPurification of the Crude ProteinAmicon Ultra 4 Centrifugal Filter Devices

Spin Conditions: 4 mL starting volume

Fixed angle (25 degree), 5000 × g at 25 °C15 min spin for separation of protein ≥100 kDa

Fixed angle (25 degree), 7500 × g at 25 °C5 min spin for separation of protein ≥ 50 kDa 10 min spin for separation of protein ≥ 30 kDa 10 min spn for separation of protein ≥ 10 kDa 20 min spin for separation of protein ≥ 5 kDa

Radial Susceptibility AssayRadial Susceptibility Assay exAFP-C28 was diluted from 128μgml-1 to 0.06μgml-1 in

96 microtiter wells containing 0.4% glucose.

C. albicans cells were grown at 28 °C in YPD liquid medium for 3 hours, up to mid-exponential phase.

The fungal cells 2×103 per well was used as inoculum for susceptibility test. Separate wells containing no protein, well with only glucose and blank well were used as different controls. The plate was incubated at 28 °C for 24 hours.

The glucose utilization in each well was checked by Glucose Oxidase Assay Kit.

Scanning electron microscopy Scanning electron microscopy C. albicans, grown at 28 °C in YPD medium, were

treated with supra-MIC concentration of exAFP-C28 for 24 hours at 28°C.

10μl of the cell suspension, placed onto a 0.45μm filter, fixed with 2% glutaraldehyde for 1 hour, post-fixed with 1% OsO4.

Samples were loaded onto a graphite stub and kept in an auto sputter coater under low vacuum for gold coating up to 5min. Surface morphology of C. albicans cells was studied by using a SEM under 15-20 kV.

Flow Cytometry AnalysisFlow Cytometry Analysis

Different concentrations of exAFP-C28 protein were incubated with 0.5 ml of C. albicans cell suspension at a fixed concentration (10 μg ml-1) of propidium iodide (PI) for 1 hour.

The fluorescence data due to entry of PI inside the cells was recorded by a FACS Caliber flow cytometer with a 488 nm laser wavelength, and analyzed by Cell QuestPro software.

Hemolytic Activity AssayHemolytic Activity Assay Blood sample was washed 3 times with PBS.

Triton X-100 was used as positive control.

Aliquots (100 μl) of RBCs (8% suspension) were transferred to 96-well microtiter plate, and hemolysis was determined by measuring A570nm using the ‘Expert Plus UV’ (Emax) plate reader.

The percent (%) hemolysis was calculated as:

( )( )

570 – 570 % 100

570 1% 100 – 570

A nm with protein solution A nm in PBShemolysis

A nm with Triton X A nm in PBS= ×

−

Molecular Mass Determination Molecular Mass Determination and Protein Sequence Analysisand Protein Sequence Analysis

Mass Spectometry Analysis Molecular mass determined by Voyager DE ProTM mass

spectrometer. Spectrum recorded in the (+ve) ion linear mode in

accelerating voltage 20 kV.

Proteomics Analysis Mass spectra of different peptides, obtained from

protein digestion using Trypsin, were acquired in (+ve) ion reflector mode with range of 850–5000 Da.

Data was uploaded into MASCOT database to search the protein identity.

Bioinformatics AnalysisBioinformatics Analysis Protein hydrophobicity and hydrophilicity predicted using

algorithms of Kyte-Doolittle, Hoop-Woods and Garnier. Homology model constructed using MODELLER 9v2. Template: The crystal structure of 50S ribosomal protein L10

[Streptomyces avermitilis MA-4680] Hydrophobic moments determined using the

Totalizer module of Membrane Protein Explorer:

N is the number of residues in the sequence segment, Hn is the numerical value of hydrophobicity of the n th amino acid residue from the Wimley-White interfacial hydrophobicity scale, δ= 2π/m, and m is the number of residues per turn.

2 2

1 1

{[ sin( )] [ cos( )]H

N N

n n n n

n n

H Hµ δ δ= =

= +∑ ∑

ResultsResults

99% sequence identity of the DM06-specific amplicons with the genus Colletotrichum sp. The colony morphology of DM06 was cottony and grayish white mycelia with abundant bright orange conidial mass were found on the colonies.

PCR amplification yielded 2 amplicons of 542bp and 522bp.

DNA fragments were sequenced and NCBI blast search was performed using the sequences of these amplicons obtained from each isolate.

ResultsResults

Fig : (a) Phase-contrast microscopic picture of few spores. (b) Scanning electron microscopic view of the mycelial mat. (c) Phylogenetic tree constructed on the basis of 18S rRNA gene sequences of some fungi with their accession numbers in parenthesis. (d) The exAFP-C28 protein is neither a glycoprotein nor a lipoprotein as unveiled through carbohydrate-, protein- and lipid-specific staining.

Expression pattern of extracellular Expression pattern of extracellular protein in different mediaprotein in different media

28KDa

Fig : SDS-PAGE of extracellular protein of Colletotrichum sp. grown on 4 different culture media. M;Size marker of protein,1;YEPS media,2;YEPD media,3;PDA media,4;CDX media.

M 1 2 3 4

Purification of 28 kDa fractionPurification of 28 kDa fraction

28KDa

Fig : Purification of the exAFP-C28 protein from the culture supernatant of Colletotrichum sp. DM-06 grown in YPS medium. Coomassie Brilliant Blue stained SDS-PAGE (12%) showing the extracellular protein profile after fractionation through different cut-off of Amicon Ultra 4 Centrifugal Filter Devices.

Lane 1: Crude total extracellular protein, 2: Filtrate fraction of 100 kDa cutoff, 3: 50 kDa cutoff, 4: 30 kDa cutoff, 5: 3 kDa cutoff,

Lane M: Protein molecular weight marker (in kDa)

C 1 2 3 4 M

Antibacterial AssayAntibacterial Assay The antimicrobial activity of all the isolated extracellular

protein fractions was done. 28 kDa protein had the best antimicrobial activity than other

fractions. The antimicrobial plate assay on E. coli DH10B showed inhibition zone surrounding the agar plaques when 2µg protein was loaded.

Fig : Antimicrobial assay on E.coli, protein concentration used 0.5 µg/ml, 1.0 µg/ml, 1.5 µg/ml, 2.0 µg/ml

RSA and SEM ResultsRSA and SEM Results

Fig : (a) The MIC value of exAFP-C28 against C. albicans was found to be 32 µg ml-1. The RSA also revealed that glucose utilization by C. albicans gradually reduced and ceased in the wells containing >32 µg ml-1 of exAFP-C28. (b) The scanning electron microscopy image clearly indicated that the exAFP-C28 at a concentration of 32 µg ml-1 causes a significant damage in the cell wall in comparison to untreated cells

Flow Cytometry and HemolysisFlow Cytometry and Hemolysis

Fig : (a) Enhanced fluorescence level of propidium iodide (at fixed concentration of 10 μg ml-1) indicates increase in membrane permeability of C. albicans cells treated with variable concentrations (i.e., 4, 8, 16, 32, 64 and 128 μg ml-1) of the exAFP-C28. (b) The exAFP-C28 at a concentration of 32 μg ml-1 has no hemolytic activity towards human RBCs compared to the negative (1% Triton X-100) and positive (PBS) controls with 30 min and 60 min of incubation. Data represent mean ± SD of triplicate experiments.

Mass Spectrometry and ProteomicsMass Spectrometry and Proteomics

Fig : (a) Results obtained from peptide mass fingerprinting followed by MASCOT search shows 5 peptide sequences have identical matching (in red bold) with several stretches of amino acid sequences of the 50S ribosomal protein L10 of Streptomyces avermitilis, and display 61% coverage. (b) Mass spectrometric result depicts the molecular mass of exAFP-C28 as 28.2 kDa. (c) Garnier Plot to determine the secondary structure of the protein indicated that amino acid residues of exAFP-C28 form around 62% helixes.

1 MARPDKAAAV AELADQFRSS NAAVLTEYRG LTVAQLKTLR RSLGEDAQYA 51 VVKNTLTKIA ANEAGINTLD DLFNGPTAVA FITGDPVVSA KGLRDFAKDN 101 PNLVIKGGVL DGKALSADEI KKLADLESRE VLLAKLAGAF KGKQSQAASL 151 FQALPSKFVR TAEALRAKKA EQGGAE

Bioinformatics Analysis ResultsBioinformatics Analysis Results

Fig : (a) A superimposition of the Kyte-Doolittle Hydrophobicity plot and Hopp-Woods Hydrophilicity plot which indicate alternating hydrophobic and hydrophilic residue structures in exAFP-C28 (b) A plot of hydrophobic moments indicates strong hydrophobic moments in amino acid regions 90-95 and 120-130 which are alpha helixes, indicating amphipathic nature. (c) The homology model of exAFP-C28 generated from YASARA has 8 alpha helixes and 5 beta strands.

DiscussionDiscussion The exAFP-C28 might be comprised of several more amino acids or

modified post-translationally by covalent binding with some other biomolecules, as Mol. mass of S. avermitilis L10 protein (176 aa) is 18.54 kDa but Mol. Mass of exAFP-C28 is almost equal to 28 kDa.

Alternating hydrophobic and hydrophilic amino acid residues increases the probability of amphipathic nature in α-helixes, which provides the membrane permeability feature of exAFP-C28 (SEM).

Amino acid residues 90-95 and 120-130, regions which consist of helixes (Garnier Plot), have very large hydrophobic moments. Hence those α-helixes may have possible amphipathic nature.

N-terminal peptide derived from the 50S ribosomal protein L1 of Helicobacter pylori has cecropin-like antibacterial activity, and is also able to form perfect amphipathic helix, that is required for membrane penetration or destabilization.

ConclusionConclusion The Colletotrichum sp. DM-06, an endophytic fungus of the

medicinal herb Ocimum sanctum produces an extracellular antifungal protein of ~28 kDa, which is designated as exAFP-C28.

The morphological features and phylogentic analysis indicate that the endophyte fungal strain DM-06 is closely related to Colletotrichum gloeosporioides.

Through SEM and flow cytometry analyses, we have established that the exAFP-C28 protein destabilizes the cell membrane of the fungal pathogen C. albicans in a dose-dependent manner.

exAFP-C28 protein shows no cytotoxic effect on human red blood cells at a dose that is the MIC for the pathogenic C. albicans cells.