Isolation, Identification, and Enumeration of Pathogenic Salmonella Serovars from Environmental Waters

Timothy M. Smith Jr.

Senior Honors Research Proposal

Cook-Cole College of Arts and Sciences

Department of Biological and Environmental Sciences

Sponsored by Dr. David W. Buckalew

Proposal Submitted on January 3, 2012

Spring 2012-Fall 2012

Thesis supervisor: ___________________________________________ (Dr. David W. Buckalew) BES Department Chair: _______________________________________ (Dr. Mark L. Fink)

Introduction

Since the acceptance of the Germ Theory of Disease, society has been interested in water quality and its influence on public health. Awareness of causal links to contaminated drinking water and disease led to questions about the best gauge or indicators of water quality. As early as 1880, Von Fritsch suggested the use of Klebsiella pneumoniae and K. rhinoscleromatis as suitable indicators due to their presence in human feces (Geldreich, 1978). Five years later, Theodor Escherich discovered Bacillus coli (now Escherichia coli) whose presence was also observed in high numbers in the feces of warm blooded animals (Escherich, 1885). Several workers at that time argued for the use of total coliform bacteria as the gauge of fecal contamination in water (Hutchinson and Ridgway 1977). However, in 1905, Alfred MacConkey proclaimed that many coliforms in water were not of fecal origin (MacConkey, 1905). This led scientists to focus their attention mainly on E. coli while using total coliforms as a very loose guideline, although coliform bacteria are still the focus of many current water quality assays depending on location. Water quality is of as much interest now as it was in the mid-to-late 1800’s when Pasteur and Koch were helping postulate the Germ Theory of Disease. Since then, there have been many discoveries of pathogens that are transmitted via the fecal-oral route. Some of these pathogens include: hemorrhagic E. coli O157:H7, Campylobacter jejuni, Salmonella enterica, enteric viruses, and certain protozoans, to name a few -- all of which cause some form of gastroenteritis which, in some cases, can be fatal. This understanding has increased both the interest and the need to ensure safe water quality for human contact. Of these potential human pathogens, this study will mainly focus on the clinically relevant serovars of Salmonella. The taxonomy of Salmonella is somewhat complex. The current taxonomic scheme consists of the genus Salmonela containing two species being S. enterica and S. bongori (Bhaduri et al. 2009). Within the species S. enterica, there are seven groups or subspecies (ssp.) which are further composed of serovars. The main pathogens for humans are found in group 1 which is Salmonella enterica ssp. enterica (Miljkovid-Selimovid et al. 2010). Within this subspecies, there are many serovars, but the two serovars that are clinically most important are serovars Typhimurium and Enteritidis (Madigan et al. 2006). According to the World Health Organization (2005), 61% of reported worldwide cases of salmonellosis are contributed to the serovar Enteritidis while serovar Typhimurium contributes to 18% of worldwide cases. The primary question posed by this study is: To what degree can potentially pathogenic Salmonella serovars be found in our local waterways? Most of the available environmental literature focuses on the entire genus of Salmonella without specificity towards pathogenic serovars. This study will attempt to identify the presence of S. enterica ssp. enterica serovars Typhimurium, Enteritidis, Hadar, and Heidelberg. To accomplish this task, molecular (nuclear-acid based) characteristics are to be assessed by multiplex polymerase chain reaction (MPCR) schemes to distinguish amongst the serovars (Sanchez 2006).

A second question posed by this study is: How effective is the presence of indicator bacteria, specifically E. coli, at predicting the simultaneous presence of pathogenic Salmonella? This is a particularly interesting question due to the seemingly contradictory findings in the literature. Ahmed et al. (2008) and Schriewer et al. (2010) correlated fecal indicators, including E. coli, with potential pathogens, including Salmonella spp., concluding that there was poor correlation between the two groups while others such as Krometis et al. (2004) have shown a significant correlation between the two groups.

Project Overview Hypotheses The primary goal of this research study is to isolate and enumerate potentially pathogenic Salmonella serovars from environmental water samples to examine the proportion of them to all Salmonella found. The primary hypothesis I propose to test is:

H01: There are no pathogenic Salmonella serovars in the local waterways or the numbers of these pathogenic serovars are too low to be detected.

The secondary goal of this study is to examine the correlation between an indicator bacterium, such as E. coli, and pathogenic Salmonella serovars. The secondary hypothesis I propose to test is:

H02: There is no correlation between the amount of specific pathogenic Salmonella serovars and the amount of E. coli in the three stream sample locations of this study.

Preliminary Work Beginning in January 2011, work began on determining how to best isolate, enumerate, and confirm Salmonella spp. from environmental waters. Water samples were collected from three water sources around the Farmville area: Appomattox River at the Rt. 45 bridge (APP2), Sayler’s Creek at the Rt. 620 bridge (SAY5), and Green Creek at the Rt. 600 (GRE16). After raw water samples were processed by membrane filtration, different primary enrichment media were tried to determine which worked best in selecting for Salmonella spp before deciding on tetrathionate (Oxoid) enrichment broth enhanced with novobiocin (TT-n) for 8 hours followed by a differential incubation using brilliant green bile (BGB) broth (Merck). The proceeding months focused on gaining experience in identifying the Salmonella colonies, enumeration techniques to improve identification accuracy, as well as performing and analyzing

confirmatory tests. Data was continuously analyzed to best discern which colonial phenotypes typically test positive for being Salmonella. This experience has been utilized to begin a library of serologically confirmed Salmonella isolates for future serotyping. New isolates will continue to be added to the library throughout the study as they are detected.

Generalized Process In order to better appreciate the methodology of this study, a general overview of the steps from sample collection to serotype identification is given below:

Obtain a confirmed Salmonella isolate o Raw water samples are collected from 3 environmental water sources and

returned to the lab according to published standardized protocols o One mL aliquots of raw water samples are diluted with sterile, buffered matrix

water and vacuum filtered, onto filter membranes with 0.45 um pore size o The filter membrane is placed on selective TT-n enrichment media and incubated

for 8 hrs o The membrane is then transferred to BGB diagnostic broth and incubated 24 hrs o Colonies with physical characteristics of Salmonella are enumerated and

transferred to Triple Sugar Iron (TSI) agar slants for confirmatory testing o After 48 hrs of incubation, the TSI’s are subjected to a polyclonal

immunoglobulin (antibody) agglutination test to serologically determine identity o TSI cultures confirmed as being Salmonella are transferred to sterile nutrient

broth (NB) tubes and added to the isolate library

Determine if the Salmonella isolate is one of the group 1 serotypes being identified o Isolates are cultured in Luria-Bertani (LB) broth, centrifuged, then subjected to a

a DNA extraction kit in order to obtain the genomic DNA (gDNA) o Extracted gDNA is then combined with a PCR kit and primers and subjected to a

Multiplex Polymerase Chain Reaction (MPCR) in a thermocycler to amplify known DNA sequences that differ amongst Salmonella group 1 serovars

o Amplified DNA sequences are then subjected to a Pulsed-Field Gel Electrophoresis (PFGE) containing both the amplified product and 100 base pair (bp) molecular weight marker to determine the length of the amplicons

o Completed gels are stained further if necessary and then viewed under Ultra-violet (UV) irradiation to detect bands

o Banding patterns are analyzed to identify if the Salmonella sample is one of the serovars of interest

Methodology

Creating the Salmonella Isolate Library Water samples are collected from three locations: Appomattox River (APP2), Saylor’s Creek (SAY5), and Green Creek (GRE16). Each sampling location was chosen as they reveal a variable record of high indicator bacterial presence. The samples are collected by lowering a sterile container mid-column into the streams, avoiding the uptake of autochthonous debris. Samples are then placed on ice and transported back to the laboratory for processing. In the laboratory, the samples are assayed via membrane filtration. One milliliter (mL) of sample is diluted with sterile, buffered water and filtered through a 0.45 um pore size filter membrane (Millipore, Bedford, MA) and transferred to a 50 mm petri plate containing 1.5 mL of tetrathionate enrichment broth (Oxoid, United Kingdom) enhanced with novobiocin (Merck, Whitehouse Station, NJ) (40 mg/L) and incubated at 35oC for 6-8 hours. The sample is then transferred to a 50 mm petri plate containing 1.5 mL of sterile BGB broth (Remel, Lanexa, KS) and incubated an additional 24 hrs at 35oC. The plates are then examined for all colony forming units (CFU) that are thought to be Salmonella spp. based upon colonial phenotype (i.e. color and morphology) -- all presumed colonies are enumerated. Representative CFU’s of each different colonial phenotype are photographed and then aseptically transferred to TSI agar slants for further diagnostic testing and for later serological confirmation. TSI agar slants are incubated at 35oC for 48 hrs. After the incubation period, acid reaction, CO2 production, H2S production, and growth morphology are recorded from the TSI tubes. Aseptically obtained samples from the TSI tubes are then subjected to serologic confirmation using Oxoid Rapid Salmonella Antibody Beads™. Oxoid Rapid Salmonella Antibody agglutination is performed by mixing a loop of suspect bacteria into a polyclonal antibody mixture for ten seconds on a card, which is then tilted back and forth for an additional minute or so as per manufacturer’s instructions. Agglutination of the beads signifies a positive test for Salmonella spp. A bacterial isolate from TSI agar slants revealing positive agglutination results is transferred to NB to be added to the isolate library.

Enumeration of E. coli The same water samples are split for the assessment of total coliforms and E. coli via Defined Substrate Test using the Colilert (Idexx, Westbrook, ME) Quanti-tray 2000 system. Twenty-five mL of water sample is diluted with 75 mL of sterile, buffered water and then processed based on the manufacturer’s instructions and incubated at 44.5° ± 0.5° C for 24 ± 2 hours.

After incubation, the numbers of wells presenting chromogenicity (yellow coloration) are counted for total coliform enumeration. The trays are then subjected to long wavelength UV light (365 nm) to count the fluorescing wells for E. coli enumeration. The results are compared to a Most Probable Number based system with a quantification range of <1 to 9,680 CFU per 100 mL when using a 25 mL sample dilution. According to Edberg et al. (1990) and Buckalew et al. (2006), confirmatory testing of coliform bacteria and E. coli using Colilert media is not necessary.

Extraction of gDNA from Isolates An isolate is inoculated in LB broth and incubated at 37oC for at least 18 hrs. Genomic DNA of the isolate is then extracted using a DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany), or a similar kit, according to the manufacturer’s instructions (modified from Si Hong et al. 2009). The cell lysate is then centrifuged at full speed (13,000 rpm for 5 min) to pellet the cellular debris. Two uL of the supernatant is used as a template for the MPCR modified from Jamshidi et al. (2009).

MPCR Primer Design In order to distinguish between different bacteria or groups of bacteria, researchers often look for unique differences between the genomes of the bacteria. To differentiate between the serogroups of Salmonella, the genetic code within each serogroup that codes for certain antigens (a foreign structure that invokes an immune response) is often chosen as the differentiation factor (DF). To view genetic differences, a variety of synthesized primers are utilized in the MPCR. This study will adopt the serogroup-specific primer sequences that were used by Hong et al. (2008). Hong et al. (2008) chose the O antigen (part of the lipopolysaccaride on the surface of gram negative bacteria), H1 antigen, and H2 antigen (H antigen proteins are associated with the flagella of bacteria) as DF’s for pathogenic Salmonella serogroupings. The genetic differences between the alleles that code for the O, H1, and H2 antigens amongst the serogroups may be exploited to differentiate them because the O, H1, and H2 antigens all have several possible alleles (Joys, 1985; Samuel and Reeves, 2003). For the antigenic formulas for each S. enterica serovar see Table 1. To develop the specific primers needed to isolate the sequence of nucleotides that code for these DF’s, the serogroup-specific wba operon (related to the O antigen), fliC allele (related to H1 antigen), and fliB allele (related to H2 antigen) were compared amongst serogroups to identify portions of sequences that consistently differed between groups. The specific primer sequence along with its recognized antigenic allele can be seen in Table 2. Primers for this study are to be synthesized by Integrated DNA Technologies®, Inc. (US) or a similar company.

Table 1: Antigenic allele formula key for S. enterica serovars identifying O alleles A,B,C1,C2,D1,E1; H1 alleles i,gm,r,z10; H2 alleles 1,2,enx – Adapted from Hong et al. (2008)

O H1 H2 S. enterica serovar

A a l,5 Paratyphi A

B b l,2 Paratyphi B

B e,h l,2 Saintpaul

B e,h l,5 Reading

B f,g - Derby

B i l,2 Typhimurium

B l,v l,7 Bredeney

B l,v e,n,z15 Brandenburg

B b - Java

B e,h e,n,x Chester

B f,g,s - Agona

B r l,2 Heidelburg

B z l,5 Kiambu

B z l,7 Indiana

B z10 l,2 Haifa

C1 b l,w Ohio

C1 c l,5 Choleraesuis

C1 c l,5 Paratyphi C

C1 d l,w Livingstone

C1 g,m,s - Montevideo

C1 k l,5 Thompson

C1 m,t - Oranienburg

C1 z29 - Tennessee

C1 e,h e,n,z15 Braenderup

C1 r l,5 Infantis

C1 z10 e,n,z15 Mbandaka

C1 z28 - Lille

C2 d l,2 Muenchen

C2 e,h l,2 Newport

C2 i z6 Kentucky

C2 z10 e,n,x Hadar

D1 a l,5 Miami

D1 a l,5 Sendai

D1 g,m - Enteritidis

D1 g,p - Dublin

D1 l,v l,5 Panama

D1 - - Gallinarum

D1 f,g,t - Berta

D1 l,z28 l,5 Javiana

E1 e,h l,5 Meunster

E1 l,v l,7 Give

E1 e,h l,6 Anatum

E1 l,v l,6 London

Table 2: Forward (F) and reverse (R) primer sequences used in MPCR – Adapted from Hong et al. (2008)

Target gene Primer sequence Expected amplicon size

O-antigen multiplex

abe1 (B) F: GGCTTCCGGCTTTATTGG

561 R: TCTCTTATCTGTTCGCCTGTTG

wbaD-manC (C1) F: ATTTGCCCAGTTCGGTTTG

341 R: CCATAACCGACTTCCATTTCC

abe2 (C2) F: CGTCCTATAACCGAGCCAAC

397 R: CTGCTTTATCCCTCTCACCG

prt (A/D1) F: ATGGGAGCGTTTGGGTTC

624 R: CGCCTCTCCACTACCAACTTC

wzx – wzy (E1) F: GATAGCAACGTTCGGAAATTC

281 R: CCCAATAGCAATAAACCAAGC

H1-1 Multiplex

fliC (i)

F: AACGAAATCAACAACAACCTGC 508 R: TAGCCATCTTTACCAGTTCCC

fliC (g,m) F: GCAGCAGCACCGGATAAAG

309 R: CATTAACATCCGTCGCGCTAG

H1-2 Multiplex

fliC (r) F: CCTGCTATTACTGGTGATC

169 R: GTTGAAGGGAAGCCAGCAG

fliC (z10) F: GCACTGGCGTTACTCAATCTC

363 R: GCATCAGCAATACCACTCGC

H2 Multiplex

fljB (I: 1,2; 1,5; 1,6; 1,7) F: AGAAAGCGTATGATGTGAAA

294 R: ATTGTGGTTTTAGTTGCGCC

fljB (II: e,n,x; e,n,z15) F: TAACTGGCGATACATTGACTG

152 R: TAGCACCGAATGATACAGCC

MPCR and PFGE While it may be possible to allelotype many of the serotypes listed in Table 1, this study will focus on allelotyping the four serovars discussed in the introduction: Typhimurium, Enteritidis, Hadar, and Heidelberg. Due to logistical conflicts regarding the different primers, a single MPCR with all three major types of primers is not possible. Instead, an isolate will first undergo an MPCR containing the O antigen primers to determine which O allele the isolate possesses. Once the O antigen allele is established, if it matches one of the four serovars for the putative O antigen allele (see Table 1) then a second allelotyping is performed using the appropriate H1 primer set. Again, if this matches one of the four serovars above then a third and final MPCR using the H2 primer set is completed.

The determination of allelic presence after the MPCR’s compete is by analyzing the amplicon banding patterns via PFGE. For the MPCR reactions, 2 uL of extracted gDNA is added to a PCR kit such as the QIAGEN Multiplex PCR Kit (Qiagen, Hilden, Germany) along with the appropriate primer set, all of which is contained in a sterilized 0.5 mL PCR tube (modified from Hassanein et al. 2011). PCR kits typically contain Taq polymerase (an enzyme that anneals nucleotides to DNA strands; capable of surviving the high temperatures needed for DNA denaturation), free deoxynucleoside triphosphates (used as the building blocks of amplicons), and buffers. The enzyme, nucleotides, and buffers are collectively known as the master mix. The 0.5 mL PCR tube containing the extracted gDNA, master mix, and appropriate primer set are placed into a thermocycler programmed to raise and lower its internal temperature over prescribed times in a series of cycles. The changes in temperature are to promote three major steps in MPCR: denaturation (strands of the gDNA disassociate with one another at high temperatures), annealing (the primers associate with the complement strand of gDNA at lower temperatures), and extension (Taq polymerase builds the remainder of the strand containing the primer using the free nucleotides at medium temperatures. The specific MPCR conditions for this experiment are 30 cycles of 94oC for 1 min (denaturation), 55oC for 1 min (annealing), and 72oC for 1 min (extension) according to Hong et al. (2008). Once the MPCR is completed, 5 uL of the product containing the amplicons has 1 uL of loading dye added to visualize the amplicons on the agarose gel. The 6 uL of solution, 6 uL of 100bp marker, and 6 uL of a non-template control is loaded onto a 1.5% agarose gel submerged in 1X Tris-acetate-EDTA buffer stained with ethidium bromide and subjected to electrophoresis for 30 min at 100 volts per centimeter. The gels are then further stained with ethidium bromide (if needed) and photographed on a UV transilluminator (modified from Nashwa et al. 2009).

Final Analysis of Data The first null hypothesis will be accepted or rejected based on whether or not clinically relevant S. enterica serovars are detected via the MPCR and PFGE protocols described above. If such serovars are indeed confirmed to be present, the colonial phenotype of that isolate will be noted and enumerated on all collection events. A final average percentage of a pathogenic isolate per total Salmonella (pathogenic serovar/genus) will be reported. The final average percentage will be calculated by finding the arithmetic mean of the number of pathogenic serovar colonies per total Salmonella colonies times 100 for each collection event. An example would be that on 4 separate collection events 6, 8, 19, and 15 pathogenic serovar colonies were enumerated out of 45, 59, 82, and 61 Salmonella spp. colonies respectively.

This is to say that of the Salmonella spp., roughly 6.2% are the particular pathogenic serovar.

Additional statistical tests such as Q-tests, student t-tests, and correlative analysis may also be completed if the data permits. If applicable, the second null hypothesis will be accepted or rejected by analyzing the correlations between the serovars and E. coli using the least squares method of regression analysis.

Estimated Cost

Materials Est. Cost ($)

Colilert envelopes and media 350

DNA extraction kit 200

Primer synthesis 250

MPCR kit 300

PFGE gels and reagents 200

Total: 1300

Tentative Timeline Spring 2011 Isolate Salmonella spp. from

environmental waters

Increase accuracy of colonial phenotype recognition for Salmonella spp.

Fall 2011 Literature review

Proposal preparation

Continued work on accuracy

December 2011/Early 2012 Edit/complete proposal

Oral presentation of proposal to SHR Committee

Secure funds for the study

Spring 2012 Order necessary materials and reagents

Isolate and serotype environmental Salmonella spp.

Possibly begin enumerations of E. coli and Salmonella strains

Summer 2012 Begin outline of thesis manuscript Fall 2012 Continue/finish enumerations

Data compilation

Statistical analysis of data

December 2012 Defend thesis

Proposed Committee Members

Dr. Dale Beach o Molecular Biologist-Department of Biological and Environmental Sciences

Longwood University

Farmville, VA

Dr. Amorette Barber o Microbiologist/Immunologist-Department of Biological and Environmental

Sciences Longwood University

Farmville, VA

Mr. Dennis Jones o Total Maximum Daily Load (TMDL) specialist

U.S. Dept. of Agriculture/Natural Resource Conservation Service (NRCS)

Farmville, VA

Literature Cited Ahmed W, Huygens F, Goonetilleke A, and T Gardner. Real-Time PCR Detection of Pathogenic Microorganisms in Roof-Harvested Rainwater in Southeast Queensland, Australia. Appl. Environ. Microbiol. 74(2008): 5490-5496. Bhaduri A, S Kalaimathy, and R Sowdhamini. "Conservation And Divergence Among Salmonella Enterica Subspecies." Infectious Disorders - Drug Targets 9.3 (2009): 248-256. Buckalew D W, Hartman L J, Grimsley G A, Martin A E, and K M Register. "A Long-Term Study Comparing Membrane Filtration With Colilert® Defined Substrates In Detecting Fecal Coliforms And Escherichia Coli In Natural Waters." Journal Of Environmental Management 80.(2006): 191-197.

Edberg S C, Allen M J, Smith D B, and N J Kriz. Enumeration of total coliforms and Escherichia coli from source water by the defined substrate technology. Appl. Environ. Microbiol. 56(1990):366–369.

Escherich, T. Die Darmbakterien des Neugeborenen und Säuglings. Fortschr. Med. 3.(1885):515-522, 547-554. (In German.) Geldreich, E E. Bacterial populations and indicator concepts in feces, sewage, stormwater and solid wastes. In Indicators of Viruses in Water and Food (ed. G. Berg) 1978, p. 51-97. Ann Arbor Science, Ann Arbor, MI.

Hassanein R, Ali S, Abd El-Malek A, Mohamed M, and K. Elsayh. "Detection And Identification Of Salmonella Species In Minced Beef And Chicken Meats By Using Multiplex PCR In Assiut City." Veterinary World 4.1 (2011): 5-11. Hong Y, Liu T, Lee M, Hofacre C, Maier M, White D, Ayers S, Wang L, Berghaus R, & J. Maurer. "Rapid Screening Of Salmonella Enterica Serovars Enteritidis, Hadar, Heidelberg And Typhimurium Using A Serologically-Correlative Allelotyping PCR Targeting The O And H Antigen Alleles." BMC Microbiology 8.(2008): 178. Hutchinson, M and J W Ridgway. Microbiological Aspects of Drinking Water Supplies 1977, p. 180. Academic Press, London. Jamshidi A, G A Kalidari, and M Hedayati. "Isolation And Identification Of Salmonella Enteritidis And Salmonella Typhimurium From The Eggs Of Retail Stores In Mashhad, Iran Using Conventional Culture Method And Multiplex Pcr Assay." Journal Of Food Safety 30.3 (2010): 558-568. Joys, T M. "The Covalent Structure Of The Phase-1 Flagellar Filament Protein Of Salmonella Typhimurium And Its Comparison With Other Flagellins." The Journal Of Biological Chemistry 260.29 (1985): 15758-15761. Krometis L, Characklis G, Drummey P, and Sobsey, M. "Comparison Of The Presence And Partitioning Behavior Of Indicator Organisms And Salmonella Spp. In An Urban Watershed." Journal Of Water & Health 8.1 (2010): 44-59. MacConkey, A T. Lactose-fermenting bacteria in faeces. J. Hyg. 5.(1905):333.

Madigan, M. T, J.M. Martinko, D.A. Stahl, and D.P. Clark. Brock Biology of Microorganisms 13.(2006), p. 1036. Pearson Education, Inc. San Francisco, CA.

Miljković-Selimović B, T Babić, and P Stojanović. "Salmonella Enterica Subspecies Enterica Serovar Enteritidis - Actualities And Importance." Acta Medica Medianae 49.3 (2010): 71-75. Nashwa, M H, A H Mahmoud, and S A Sami. "Application Of Multiplex Polymerase Chain Reaction (MPCR) For Identification And Characterization Of Salmonella Enteritidis And Salmonella Typhimurium." Journal Of Applied Sciences Research 5.12 (2009): 2343-2348. Samuel, G and P Reeves. "Perspective/Review: Biosynthesis Of O-Antigens: Genes And Pathways Involved In Nucleotide Sugar Precursor Synthesis And O-Antigen Assembly." Carbohydrate Research 338.Bacterial Antigens and Vaccines (2003): 2503-2519.

Sanchez S. Making PCR a normal routine of the food microbiology lab. PCR Methods in Foods 2006, p. 51-68. Accessed by Google books on Dec. 19, 2011: http://books.google.com/books

Schriewer A, et al. Presence of Bacteroidales as a predictor of pathogens in surface waters of the central California coast. Appl. Environ. Microbiol. 76(2010):5802-5814. Si Hong P, Hyun Joong K, Woo Hee C, Jae Hwan K, Mi Hwa O, Sung Hun K, Bok Kwon L, Ricke S, and K. Hae Yeong. "Identification Of Salmonella Enterica Subspecies I, Salmonella Enterica Serovars Typhimurium, Enteritidis And Typhi Using Multiplex PCR." FEMS Microbiology Letters 301.1 (2009): 137-146. WHO. Global Salmonella Survey, Progress Report. 2005. Accessed on Dec. 16, 2011: http://www.who.int/salmsurv/links/GSSProgressReport2005.pdf