isolation,characterization and optimization of catechol ...cashew industry has national importance....
TRANSCRIPT
International Journal of Advanced Biotechnology Research.
ISSN 2249-3166 Volume 7, Number 1 (2017), pp. 13-23
© Research India Publications
http://www.ripublication.com
Isolation,characterization and optimization of
catechol degrading Pseudomonas aeruginosa from
Cashew Industrial soil
Parvathy.G, and Prabhakumari .C
Department of Biotechnology, CEPC Laboratory and Research Institute ,
Mundakkal, Kollam, India.,
Abstract
Catechol is a reaction intermediate in the bacterial metabolism of phenol,
benzoic acid, anthranilic acid and other compounds. Among the most
abundant environmental pollutants; catechol and related products are of major
concern because of their long term persistence and the toxicity.Industrial
emissions and disposal, treatment or recycling must comply with applicable
regulations to preserve environment.Therefore, the removal of catechol is vital
before letting it into the environment.The present study made an attempt to
find out the biodegradation of catechol by using microorganisms isolated
from cashew industrial soil. Eleven morphologically different strains were
isolates. Amoung these microbes one bacteria shows promising degradation of
catechol up to 100 mg/l. Morphological and Molecular studies was done and
identified as Pseudomonas aeruginosa. Batch studies are done by using the
pure culture of Pseudomonas aeruginosa, catechol degradation was setup at
various pH (5, 6, 7, 8, 9) and temperature (10, 20, 30, 40, 50)0 C. Maximum
catechol degradation was at pH 7 and temperature 300C. From this study we
can concluded that the Pseudomonas aeruginosa. is one of the efficient
catechol degraders and has wide application in the field of bioremediation.
INTRODUCTION
One of the worldwide problem faced by envirornment is pollution and its potential to
influence the health of human populations is great (Fereidoun et al, 2007; Progressive
Insurance, 2005). The significance of environmental factors to the health and well-
being of human populations’ is increasingly apparent (Rosenstock 2003; World
Health Organization [WHO], 2010b) in the densely settled urban-industrial Pollution
14 Parvathy.G, and Prabhakumari .C
reaches its most serious problem.(Kromm, 1973). Over the last three decades there
has been increasing global concern over the public health impacts attributed to
environmental pollution (Kimani, 2007). Environmental pollutants are compounds
that are toxic to living organisms; released into the ecosystem at high concentrations,
usually as a consequence of human activities. Catechol and related products are of
major concern because of their long term persistence and the toxicity The
International Agency for Research on Cancer (IARC) has classified catechol as a
Group 2B, possible human carcinogen.
Catechol used as industrial reagent in the manufacturing of dyes rubber plastics and
pharmeceuticals and cosmetics, in the production of insectiscides in metal plating and
coal refining. Catechol is very soluble in water and readily biodegradable. It has a low
potential for bioaccumulation. Various treatment strategies are available for its
removal; (M. Stanisavljevic and L. Nedic., 2004). Phenol biodegradation has been done by
applying different kinds of microbial culture in two recent decades.Many aerobic
bacteria have been confirmed to use aromatic compounds as the sole source of carbon
and energy (Paller et al., 1995), which suggests to use catechol as nutrient to the
organism and thereby converts catechol to nontoxic component. However, its removal
by biological means is much cheaper, less energy consuming and above all,
environment friendly.
India is largest producer, processor, exporter and second largest consumer of cashew
in the world. Kerala is the main processing and exporting center of cashew. The
industry provides livelihood for about 6-7 lakhs of employees and farmers, the
cashew industry has national importance. (Anonymous, 2009).The soil near to cashew
industry contains cashew nut shell liquid, a phenolic compound that is oozing out
from the cashew nut shell during the processing of cashew nut,contains a wide variety
of microbial population which has ability for degrading phenolic compounds.
Biological methods for the removal of phenolic compounds are possible because
some organisms have the capacity to degrade phenol utilizing it as their nutrients
(Kanekar et. al, 1999, Catia et.al, 2010). The aim of this work was to isolate catechol
degrading microorganisms from cashew industrial soil.
MATERIALS AND METHODS
Sampling
In this study the soil samples were collected from cashew industry near
Kollam,Kerala. The samples were put into sterile bottles, then into the containers full
of ice and then transferred to lab and stored in the refrigerator at temperature 4ºC prior
to analysis.
Isolation,characterization and optimization of catechol degrading Pseudomonas… 15
Isolation of catechol degrading bacteria
For this experiment microorganisms were isolated from three different sites in cashew
industry near Kollam, Kerala. Pure colonies were isolated from spread plate method
using mineral salt medium (MSM) containing 1% v/v catechol. Firstly, different types
of colonies were selected and taken by using sterile loop and streaked onto mineral
salt medium agar plate containing 1% v/v catechol concentration. Then, the plates
were incubated overnight at 30°C. The growth of pure colonies was observed after 24
hours.
Screening of catechol degrading bacteria
Eleven different bacteria were labeled and cultured on nutrient agar and incubated for
24 hours at 37°C. Then, a single colony of each bacteria was inoculated into nutrient
broth and incubated at 37°C for 24 hours at 150 rpm. Then, the broths were
centrifuged at 4000 rpm at 4°C for 15 minutes. Supernatants were decanted and
pellets containing bacterial cells were centrifuged with 0.8 % NaCl twice to ensure
removal of all broth components The supernatant was thrown away and the pellet was
centrifuged again with 10 mL of 0.8% solution NaCl.
The centrifuged pellet of eleven bacteria were inoculated into 250mL conical flask
containing 100 mL mineral salt medium (Zajic and Supplison 1972) and 10 ppm
catechol. The medium was adjusted to pH 7.0. Each sample was assayed in replicates.
The samples were incubated at 150 rpm for 4 days, at 37°C. 1 mL of culture was
centrifuged at 5000 rpm for 10 minutes and assayed the biodegradation of catechol
colourimetrically by Folins Ciocalteous Method at 12 hour interval of time using UV-
VIS spectrophotometer and measured at 555 nm.
Identification of catechol degrading bacteria
Identification was done on one isolated catechol degrading bacteria, were
characterized and identified by their morphological characteristic based on size, shape
and colony morphology on nutrient agar plate the isolates were examined by gram
staining and Biochemical tests.
16S rRNA sequencing
Genomic DNA was isolated using NucleoSpin® Tissue Kit (Macherey-Nagel).
Sequencing of 16S rRNA region using universal primers
5’CAGGCCTAACACATGCAAGTC3’, 5’GGGCGGWGTGTACAAGGC3’
16 Parvathy.G, and Prabhakumari .C
Catechol degradation under varying initial catechol concentrations.
10 ml of the isolate was centrifuged and the pellet was washed with 0.8% Nacl.Then
the pellet was added to 100 ml of mineral salt media containing different
concentration of catechol ie. 5, 10, 50, and 100mg/L and carried out in standard flask
culture experiments. These flasks were kept in dark to avoid photo decomposition.
1ml of sample were removed at different time intervals and microbial growth was
monitored by UV-Visible Spectrophotometer at 550nm. Then the samples were
clarified by centrifugation at 5000rpm for 10 minutes and supernatants were subjected
to Folins-Ciocalteus spectrophotometric method for monitoring the catechol
concentration.
Effect of different pH and temperature on catechol degradation.
10 ml of the isolate was centrifuged and the pellet was washed with 0.8% Nacl.Then
the pellet was added to 100 ml of mineral salt media containing different
concentration of catechol ie. 5, 10, 50, and 100mg/L and carried out in standard flask
culture experiments. These flasks were kept in dark to avoid photo decomposition.
1ml of sample were removed at different time intervals and microbial growth was
monitored by UV-Visible Spectrophotometer at 550nm. Then the samples were
clarified by centrifugation at 5000rpm for 10 minutes and supernatants were subjected
to Folins-Ciocalteus spectrophotometric method for monitoring the catechol
concentration.
RESULTS AND DISCUSSIONS
Isolation of catechol degrading bacteria
Three soil samples were collected from three different sites of Cashew Industry near
Kollam. Eleven different isolates are isolated, out of which one bacteria with high
potential to degrade catechol was selected for further studies.
Figure 1. Isolate on nutrient agar.
Isolation,characterization and optimization of catechol degrading Pseudomonas… 17
Identification of catechol degrading bacteria
The potential isolate was characterized based on their gram reaction characteristics,
morphological features and biochemical properties. The results showed that the
isolate is a gram negative rod and the biochemical characterization are explained in
the table.(Table:1)
Table: 1 Biochemical Characterization of the isolate
S.No Test Response of the organism
1 Gram staining -
2 Indole -
3 Methyl Red -
4 Voges proskauer -
5 Simmon citrate agar +
6 Oxidase +
7 Catalase +
8 Gelatin Liquefaction + (Rapid liquefaction)
9 Triple Sugar iron Agar +
10 Nitrate reduction +
11 Glucose +
12 Lactose -
13 Fructose -
(+ = Positive reaction, - = Negative reaction)
16S rRNA sequencing
Genomic DNA was isolated using NucleoSpin® Tissue Kit (Macherey-Nagel).
Sequencing of 16S rRNA region using universal primers
5’CAGGCCTAACACATGCAAGTC3’, 5’GGGCGGWGTGTACAAGGC3’
18 Parvathy.G, and Prabhakumari .C
Figure :2 DNA
Figure :3 PCR
Isolation,characterization and optimization of catechol degrading Pseudomonas… 19
Figure 4. Phylogenetic analysis of strain PSEUDOMONAS AERUGINOSA PG4
16srRNA gene sequence with other PSEUDOMONAS AERUGINOSA species/strains
Catechol degradation under varying initial catechol concentrations.
The Isolate has an ability to degrade phenol up to 100 mg/l (Fig:6). 100 ppm was the
initial concentration after that a rapid decrease in phenol concentration in 96 hour.
This shows that the Isolate has a potential ability to degrade the phenol and has a wide
application in the field of bioremediation. Catia et al (2010) (Figure 5)
20 Parvathy.G, and Prabhakumari .C
Figure 5: Catechol degradation under varying initial catechol concentrations.
Figure 6: Effect of different pH on catechol degradation.
0
20
40
60
80
100
120
0 12 24 36 48 60 72 84 96 108
Cat
ech
ol (
mg/
l)
Hours
Catechol Degradation
Catechol Degradation
0
2
4
6
8
10
12
0 12 24 36 48 60 72
Cat
ech
ol (
mg/
l)
Hours
CATECHOL DEGRADATION AT DIFFERENT pH
ph 6
ph 5
ph 7
ph 8
ph 9
Isolation,characterization and optimization of catechol degrading Pseudomonas… 21
Figure 7: Effect of different temperature on catechol degradation.
Effect of different pH and temperature on catechol degradation.
To determine the effect of temperature and pH on phenol degradation the experiments
were carried out at different temperatures such as 100C 200C, 300C, 400C and 500C at
pH ranges from (5,6,7,8,9). The data shows that there was maximum phenol
degradation takes place at room temperature of 300C and on further increase in
temperature the rate of biodegradation decreases because the catalytic activity of the
enzymes is starts to decrease beyond that temperature. So the optimum temperature
for the maximum enzymatic activity is 300C and for pH, the results show that there
was maximum phenolic degradation occurs maximum at neutral pH due to maximum
utilization of carbon source (Figure 6&7).
At acidic or basic pH there is reduction in phenolic degradation due to the fact at that
culture utilize less carbon source. Viraraghavan and Rao (2002), used the cells of
Isolate .to treat the effluent of many waste water treatment plants to remove the
phenol from aqueous solution. Most of the organisms, cannot tolerate the pH values
below 4.0 and above 9.0 as because the acids and bases which can easily entered in to
the cell which affect the metabolic pathway and denature the proteins finally leads to
lethality Bandyopadhyay,et al (1998) & Annadurai et al (2000).
0
2
4
6
8
10
12
0 12 36 48 60 72
Cat
ech
ol (
mg/
l)
Hours
CATECHOL DEGRADATION AT DIFFERENT TEMPERATURE
10 C
20 C
30 C
40 C
50 C
22 Parvathy.G, and Prabhakumari .C
CONCLUSION
From the above study it was concluded that the catechol is one of the most important
effluent of so many industries and it is harmful to the human system, so it has to be
removed. Biodegradation is a simple, cost effective method for the removal of
catechol and other effluents to protect the environment. In the present study we isolate
the Pseudomonas aeruginosa from Cashew Industry near Kollam for the
biodegradation of phenol. The Isolate degrade phenol up to 100mg/l. The catechol
degradation by Pseudomonas aeruginosa .was maximum at room temperature of 300
C and the degradation of catechol is maximum at neutral pH. Bioremediation is one of
the most effective method for the removal of catechol and it has wide application for
removing environmental pollutants.
ACKNOWLEDGEMENT
Authors are highly grateful to the CEPC Laboratory and Technical Division,
Mundakkal, Kollam for allowing us to carry out such a noble work for pollution free
environment.
REFERENCE
[1] Annadurai. G, Balan .M.S, and Murugesan .T, Design of experiments in the
biodegradation of phenol using immobilized Pseudomonas pictorium (NICM
– 2077) on activated carbon. Bioprocess Engineering 2000; 22: 101-107.
[2] Anonymous, 2008. Air pollution http// en. Wikipedia. Org/ wiki/ Air
pollution, Retrieved.
[3] Bandyopadhyay.D, Das, D. and Maitri. B.M , Kinetics of phenol degradation
using Pseudomonas putida MTCC 1194’. Bioprocess Engineering, 1998; 18:
373–377
[4] Catia T.D.P , Mariano.M ,Janaína. F, Medeiros. B , Susana. J.K, Carlos .A
and.Veiga.B , Biodegradation of phenol by free and encapsulated cells of a
new Aspergillus sp. isolated from a contaminated site in southern Brazil, Afri J
Biotechnol. 2010; 9(40): 6716-6720.
[5] The Environmental Protection Agency (EPA). Collation of toxicological data
and intake values for humans. EPA Report. 2004, pp: 44-64.
[6] Fereidoun. H, Nourddin .M.S, Rreza .N.A, Mohsen .A, Ahmad .R &
H.Pouria,The Effect of Long-Term Exposure to Particulate Pollution on the
Lung Function of Teheranian and Zanjanian Students, Pakistan Journal of
Physiology.2007;3, (2): pp. 1-5.
Isolation,characterization and optimization of catechol degrading Pseudomonas… 23
[7] Kanekar PP, Sarnaik SS and Kelkar AS. Bioremediation of phenol by
alkaliphilic bacteria isolated from alkaline Lake of Lonar, India. J. Appl.
Microbiol.Symposium Suppl.1999; 85:1285-1335
[8] Kimani, N. G. Environmental Pollution and Impacts on Public Health:
Implications of the Dandora Dumping Site Municipal in Nairobi, Kenya,
United Nations Environment Programme, 2007. pp. 1-31.
[9] Kromm, D. E. Response to Air Pollution in Ljubljana, Yugoslavia, Annals of
the Association of American Geographers, 1973. 63(2), pp. 208-217.
[10] Paller, G., Hommel, R.K and Kleber, H.P. Phenol degradation by
Acinetobacter calcoaceticus NCIB 8250. J. Basic Microbial. 1995. 35 : 325-
335
[11] Progressive Insurance, Pollution Impact on Human Health. Retrieved from
http://www.progressiveic.com/n25feb05.htm, 2005
[12] Rosenstock, L. . The Environment as a Cornerstone of Public Health,
Environmental Health Perspectives, 2003 111(7), pp. A376-A377.
[13] Stanisavljević . M and Nedić., L Removal of Phenol from Industrial
Wastewaters by Horseradish (Cochlearia armoracia L.), Working and Living
Environmental Protection, 2004.2(4), 345-349
[14] Viraraghavan .T and Rao. J.R., “Biosorption of phenol from an aqueous
solution by Aspergillus niger biomass”, Bioresource Technology, 2002; 85 pp:
165-171.
[15] Zajic, E. & Supplison, B. 1972. Emulsification and degaradation of “Bunker
C” fuel oil by microorganisms. Biotechnology and Bioengineering 14: 331-
334.
24 Parvathy.G, and Prabhakumari .C