j rasaiyaah et al. nature 000 , 1 - 4 (2013) doi:10.1038/nature 12769

1

J Rasaiyaah et al. Nature 000, 1-4 (2013) doi:10.1038/nature12769 NF-B/IRF3 are activated by mutant HIV-1 and SmBz-CsA treatment causes WT HIV-1 to trigger innate responses.

Upload: chars

Post on 04-Jan-2016

36 views

Category:

Documents

2 download

Report

Download

Embed Size (px):

DESCRIPTION

NF- k B/IRF3 are activated by mutant HIV-1 and SmBz-CsA treatment causes WT HIV-1 to trigger innate responses. J Rasaiyaah et al. Nature 000 , 1 - 4 (2013) doi:10.1038/nature 12769. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: J Rasaiyaah et al. Nature 000 , 1 - 4 (2013) doi:10.1038/nature 12769

J Rasaiyaah et al. Nature 000, 1-4 (2013) doi:10.1038/nature12769

NF-B/IRF3 are activated by mutant HIV-1 and SmBz-CsAtreatment causes WT HIV-1 to trigger innate responses.

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2982 Supplementary Figure 2 Mapped 3 ends of lnc-pri-miR-122

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

JLW Morgan et al. Nature 000 , 1 - 6 (2012) doi:10.1038/nature 11744

Nature Immunology: doi:10.1038/ni · Nature Immunology: doi:10.1038/ni.2987 Supplementary Figure 6 Increased NET release and tissue damage in the lungs of dectin-1-deficient mice

DWJ Thompson et al. Nature 491 , 692-697 (2012) doi:10.1038/nature 11579

Nature Biotechnology: doi:10.1038/nbt

Nature Biotechnology: doi:10.1038/nbt · Nature Biotechnology: doi:10.1038/nbt.4136. ... Each compound was run in a cell culture plate from three independent wells and each bar represents

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Nature Reviews Drug Discovery Volume 13 Issue 10 2014 [Doi 10.1038%2Fnrd4391]

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

P. van der Harst et al. Nature 000 , 1 - 7 (2012) doi:10.1038/nature 11677

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Published in Nature Materials (2016) doi:10.1038/nmat4569

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

E Ammannito et al. Nature 000 , 1 - 4 (201 3 ) doi:10.1038/nature 12665

Nature Genetics: doi:10.1038/ng - David Reich...The gray dashed line denotes the diagonal (n = 11) . Nature Genetics: doi:10.1038/ng.3952 8 Supplementary Figure 8 Comparison of autosomal

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

G Zimmermann et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12205

C Kim et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 11799

J Hoggatt et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11929

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

Nature Neuroscience: doi:10.1038/nncPC in the distal, medial and proximal part of dCA1. Nature Neuroscience: doi:10.1038/nn.4517 Supplementary Figure 6 Direct long-range GABAergic

H Uoyama et al. Nature 492 , 234 - 238 (2012) doi:10.1038/nature 11687

RA Boon et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11919

B Nystedt et al. Nature 000 , 1 - 6 (2013) doi:10.1038/nature 12211

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

G Lu et al. Nature 000 , 1 - 5 (2013) doi:10.1038/nature 12328

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

O Jagoutz & MD Behn Nature 504 , 131 - 134 (201 3 ) doi:10.1038/nature 12758

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3107 Supplementary Figure 3 Distribution of P values from multiple-association analyses at 55 SNPs having a prior

DJ Ferguson et al. Nature 499 , 70 - 73 (2013) doi:10.1038/nature 12292

Nature Research€¦ · NATURE CHEMISTRY | 1 SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1088 1 [Submitted to Nature Chemistry] Supplementary Information: A