Sism

K. Kegler , A. Habierski , K. Hahn , S. P. Amarilla , F. Seehusenand W. Baumgartner*

*Department of Pathology, University of VeterinaryMedicine, Bunteweg 2, D-30559 Hannover, Germany and Department ofPa o,

This is the first report describing infection of tumour cells by L. infantum in a genital TVT from an asymptom-

Key

Visceral leishmaniasis (VL), caused by intracellular

in the absence of the vector have been reported in man

2009). This protozoon is an obligate intracellular para-

manifestations have been reported (Blavier et al., 2001)

J. Comp. Path. 2013, Vol. 149, 156e161 Available online at wwwparasites of the Leishmania donovani complex (L. donovaniand Leishmania infantum [syn. Leishmania chagasi]) is animportant zoonotic and principally vector-borne dis-ease affectingman and dogs.L. infantum is the causativeagent in Latin America and Europe and L. donovani isendemic in East African countries, Northeast India,Nepal and Bangladesh (Dujardin et al., 2008; Romeroand Boelaert, 2010). Alternative routes of transmission

site of monocytes andmacrophages in organs includingthe spleen, liver, lymph nodes and bone marrow(Grimaldi and Tesh, 1993). After infection, clinicalmanifestations in dogs range fromasymptomatic to sys-temic disease characterized by progressive weight loss,anaemia, alopecia, dry exfoliative dermatitis, onychog-ryphosis, hepatosplenomegaly and generalized lymph-adenopathy (Oliveira et al., 1993). Inaddition, atypicalan1920

Cor

tiho

002

httpatic bitch. Transplantation of Leishmania-laden neoplastic cells could represent an alternative route of venerealtransmission of leishmaniasis among dogs.

2012 Elsevier Ltd. All rights reserved.

words: dog; Leishmania; transmissible venereal tumourd94;09)

resp

-ha

1-99

://dthology, Faculty of Veterinary Medicine, National University of Asuncion, Ruta Mcal. Estigarribia km 10, San LorenzParaguay

Summary

A 2-year-old female boxer dog was presented with a vaginal serosanguineous discharge not associated with oes-trus. There was a friable mass occupying the upper caudal part of the vagina. Cytological and histological ex-amination revealed a monomorphic population of neoplastic round cells consistent with canine transmissiblevenereal tumour (TVT). In addition, Leishmania spp. amastigotes were found within the neoplastic tissue. Inorder to characterize whether the amastigotes were present inside macrophages and/or neoplastic cells, a co-localization study using cell- and pathogen-specific markers was performed. To detect Leishmania spp. a 5.8Sribosomal RNA (rRNA) parasite-specific sequence was used for in-situ hybridization and Mac387 was usedas a macrophage marker for immunohistochemistry. Leishmania spp. rRNAwas detected insideMac387+mac-rophages andwithin the cytoplasm of some neoplastic cells. DNA isolation and polymerase chain reaction usingspecific primers and sequencing analysis identified the organism as Leishmania infantum (syn. Leishmania chagasi).INFECTIOU

Vaginal Canine TransmAssociated with Intra-tuAmastigotes in an Asym

*, *dogs, including via blood transfusion (Harris,Giger et al., 2002) or by venereal (Silva et al.,or congenital transmission (Pangrazio et al.,

ondence to: W. Baumgartner (e-mail: wolfgang.baumgaertner@

nnover.de).

75/$ - see front matter

x.doi.org/10.1016/j.jcpa.2012.11.241DISEASE

sible Venereal Tumouroural Leishmania spp.ptomatic Female Dog

* *

.sciencedirect.com

www.elsevier.com/locate/jcpaas well as coinfections with ehrlichiosis and babesiosis.Leishmania spp.haveoccasionallybeen reported incuta-neous canine transmissible venereal tumour (TVT)cells (Ciaramella et al., 1997; Levy et al., 2006).TVT is a transplantable round cell tumour affect-

ing the external genitalia of dogs (Das and Kumar,

2012 Elsevier Ltd. All rights reserved.

2000). It is mostly transmitted sexually and less oftenby sniffing or licking. Despite many studies, the originof the specific cell linage of TVT remains obscure.The expression of lysozyme, alpha-1-antitrypsin andvimentin suggest a reticuloendothelial origin(Mozos et al., 1996; Marchal et al., 1997). Genomicstudies have shown that the tumour may have arisenat the time of domestication of the dog (Rebbeck et al.,2009).The present report describes a female dog with vag-

inal TVT and asymptomatic VL, in which tumourcells and tumour-infiltrating macrophages containedintracellular amastigotes of Leishmania spp.A 2-year-old female boxer dog was presented to the

Veterinary Hospital, Faculty of Veterinary Medicineof the National University of Asuncion because ofa vaginal serosanguineous discharge not associatedwith oestrus. The dog was apparently healthy and

Leishmania spp. Amastithere was a non-encapsulated, lobulated, whiteegrey,friable mass, approximately 3 cm in diameter, withhigh bleeding tendency located in the upper caudalpart of the vagina. Fine needle aspirates taken fromthis mass and stained by Giemsa revealed a populationof round cells with distinct cell boundaries, pale baso-philic vacuolated cytoplasm, round to oval eccentricnuclei with granular chromatin and prominent nucle-oli. Numerous oval structures, 2e3 mm in diameter,with a basophilic nucleus and a rod-shaped kinetoplastand consistent with Leishmania spp. amastigotes, werepresent within macrophages and also extracellularly.In addition, some tumour cells appeared to contain in-tracytoplasmic amastigotes (Fig. 1). Confirmation ofLeishmania spp. infection was achieved by analysis ofbone marrow aspirates and serology using a commer-

Fig. 1. Impression smear from vaginal TVT. Neoplastic roundcells characterized by pale basophilic vacuolated cyto-

plasm and eccentric nuclei. Leishmania spp. amastigotesare present within a neoplastic cell (arrow). Giemsa. Bar,20 mm.cial kit containing immunochromatographic stripswith recombinant antigenK39 (rK39) fromL. infantum(Sundar et al., 2002).Biopsy samples were collected from the vaginal

mass, fixed in 10% neutral buffered formalin and em-bedded in paraffin wax. Sections were stained withhaematoxylin and eosin (HE). In order to furthersubstantiate the observation that amastigotes werepresent within macrophages and neoplastic cells, co-localization was performed by in-situ hybridization(ISH) for the detection of parasites in combinationwith immunohistochemistry (IHC) for cell immuno-phenotyping. For ISH, an oligonucleotide probe la-belled with digoxigenin (DIG) was designed, basedon previously published sequences (el Tai et al.,2000; Schonian et al., 2003). The probe sequence(50TGATACCACTTATCGCACTT30) detectedthe 5.8S ribosomal RNA (rRNA) of Leishmania spp.ISH was performed as described by Jacobsen et al.(2009) and Dinhopl et al. (2011)with some modifica-tions. Briefly, sections were attached to Superfrostplus slides (Menzel-Glaser, Braunschweig,Germany), dewaxed in Rotihistol (Carl Roth,Karlsruhe, Germany), hydrated in graded ethanoland washed in diethylpyrocarbonate (DEPC)-treated water. Proteolytic treatment was with 4.3 mlproteinase K in Tris-buffered saline at 37C for15 min. The slides were then rinsed with 0.2% glycinein phosphate buffered saline (PBS), post-fixed in 4%paraformaldehyde (PFA) and washed in PBS. Afteracetylation and prehybridization, slides were coveredwith hybridization mixture (HB-mix) containing18 ml RNA, 20 ml ssDNA, 80 ml dextran sulphateand 3 ml Leishmania probe (100 ng/ml) and hybridizedovernight in a humid chamber at 52C. The detectionsystem consisted of an anti-DIG antibody conjugatedto alkaline phosphatase (1 in 200 dilution; Fab Frag-ments; Roche Diagnostics, Mannheim, Germany)and the substrates nitroblue tetrazolium chloride(NBT) and 5-bromo-4-chloro-3-indolyl phosphate(BCIP). The staining reaction was terminated byplacing the slides in TriseEDTA buffer (TE buffer,pH 8.0). A skin sample containing amastigotes ofLeishmania spp. was used as a positive control. Nega-tive controls included slides in which the HB-mixlacked the Leishmania probe.Subsequently, IHCusingMac387 as amacrophage

marker (monoclonal antibody, diluted 1 in 200; Da-koCytomation, Hamburg, Germany) and a standardavidinebiotineperoxidase complex (ABC, VectorLaboratories, Burlingame, California, USA) methodwas performed. After incubation of slides in 4%

gotes in Canine TVT 157H2O2 in PBS, heat-induced (microwave) antigenicretrieval was performed followed by incubation withgoat normal serum (1 in 5 dilution) and then with

cent to the ulcerated region and less frequently amongneoplastic cells. In addition, scattered neoplastic cellscontaining Leishmania spp. were identified (Fig. 2).Neoplastic cells did not express Mac387, CD3 orCD79a, but were labelled strongly for expression of vi-mentin and lysozyme. Infiltrating macrophages ex-pressed Mac387, lysozyme and vimentin. T and Blymphocytes expressing CD3 and CD79a, respec-tively, were also identified.Leishmania spp. rRNA was demonstrated by ISH

inside Mac387+ macrophages and within the cyto-plasm of some neoplastic cells (Fig. 3). PCR assay re-sulted in the amplification of a 53 bp fragment. Acomparison of the nucleotide sequence of the ampli-con revealed the absence of a cytosine residue at posi-tion 32, identifying the parasite as L. infantum (Fig. 4).This represents the first report of Leishmania spp.

within neoplastic cells in a TVT located in the genitalarea of an asymptomatic female dog. In regions in

ler et al.the primary antibody for 90 min. Slides were washedin PBS and incubated with biotinylated secondaryantibody (goat anti-mouse IgG, 1 in 200 dilution;Vector Laboratories) for 30 min. Labelling was visu-alized by incubation with 3-amino-9-ethylcarbazole(AEC) followed by counterstaining with Mayershaematoxylin. Finally, slides were mounted underAquatex (Merck Millipore, Darmstadt, Germany).In addition, monoclonal antibodies specific for vi-

mentin (diluted 1 in 100; DakoCytomation) andCD79a (diluted 1 in 60; DakoCytomation) and poly-clonal antibodies specific for lysozyme (diluted 1 in250; DakoCytomation) and CD3 (diluted 1 in 3,000;DakoCytomation) were used to detect mesenchymalcells, B cells, macrophages and T cells, respectively.Primary antibodies were omitted for negative controlsand replaced by isotype-matched antibodies from thesame animal species but of irrelevant specificity.To further characterize the Leishmania spp. involved,

DNA was extracted from the wax block using a com-mercial kit (QIAmp DNA FFPE Tissue, Qiagen,Hilden, Germany). Briefly, for polymerase chainreaction (PCR) assay, the forward primer50GATGATTAGAGACCATTGTA30 and the reverseprimer 50CAATTCATGGGTGTCATC30 (EurofinsMWG Operon, Ebersberg, Germany) were used toamplify a 53 base pair (bp) segment of the 18S rRNAgene for L. donovani (GenBank accession numberX07773.1) and L. infantum (GenBank accession num-ber GQ332359.1). The amplicon was purified usingQIAquick Gel Extraction kit (Qiagen) and clonedinto pCR4-TOPO vector (Invitrogen, Darmstadt,Germany). Plasmid isolation was performed using Nu-cleoSpin Plasmid Quick Pure (MachereyeNagel,Duren, Germany). The insert was sequenced (SEQ-LAB Sequence Laboratories Gottingen, Germany) us-ing M13 forward and reverse primers.Histopathology revealed a non-encapsulated and

expansive mass. Tumour cells were generally ar-ranged in sheets and were separated by a delicate fi-brovascular stroma. Individual cells were round,with a moderate amount of pale eosinophilic cyto-plasm andmainly indistinct borders. The cells had ec-centrically located nuclei with coarse granularchromatin and a single prominent, round eosinophilicnucleolus. Anisokaryosis and anisocytosis were mildto moderate and there were 4e8 mitoses per high-power field (40 microscope objective). In some sec-tions, neoplastic cells elevated the overlying mucosaleading to attenuation of the epithelium and focal ul-ceration withmild submucosal oedema and fibrosis. Asmall number of lymphocytes, plasma cells and mod-

158 K. Kegerate numbers of macrophages were distributedamong the neoplastic cells. Macrophages harbouringLeishmania spp. amastigotes were mostly present adja-which VL is considered endemic, two types of changesare described in infected people and dogs: specific le-sions caused by L. infantum itself and those in whichthe finding of amastigotes are incidental to anotherprimary condition (Ciaramella et al., 1997; Boschet al., 2002). In people, infection with Leishmaniaspp. occurs mostly in immunosuppressed patients.Kaposis sarcoma parasitized by Leishmania spp. hasbeen described in patients with HIV infection(Gallego et al., 1996; Gonzalez-Beato et al., 2000). Indogs, tumours such as T-cell lymphoma (Manzilloet al., 2008) and haemangiosarcoma (Margaritoet al., 1994) have been reported concomitant withleishmaniasis.

Fig. 2. Vaginal TVT. Solid sheet of neoplastic round cells sepa-rated by a delicate fibrovascular stroma and parasitizedby Leishmania spp. Numerous mitotic figures are observed.

HE. Bar, 50 mm. Inset A. Higher magnification of a Leish-mania-laden tumour cell. Inset B. Higher magnification ofa macrophage harbouring numerous amastigotes.

Leishmania spp. AmastiCo-existence of Leishmania spp. and TVT has beendescribed in symptomatic dogs with neoplastic cuta-neous nodules (Albanese et al., 2002) and oral andnasal masses (Levy et al., 2006) in which Leishmania-laden neoplastic cells were observed in cytologicalsmears. However, Catone et al. (2003) failed to dem-onstrate intracytoplasmic amastigotes in tumour cellsin a TVT located in the glans penis of a dog withsymptomatic VL. In the present study, Leishmaniaspp. identified by ISH were noted within infiltrating

Fig. 3. Vaginal TVT. Colocalization of Leishmania spp. amasti-gotes by ISH and IHC. Hybridization of rRNA of Leish-mania is identified by a purple to black signal indicatingamastigoteswithin the cytoplasmof amacrophage express-ing Mac387 in red (arrowhead) and within a neoplasticcell negative for Mac387 (arrow). Bar, 20 mm.Mac387+ macrophages and TVT cells.It has been postulated that TVT cells arise from

a reticuloendothelial lineage; however, the specificcell type involved remains unknown (Mukaratirwaand Gruys, 2003). Immunophenotyping studies usingmarkers specific for vimentin, lysozyme and alpha-1-antitrypsin did not allow the unequivocal identifica-tion of all TVT cells (Mozos et al., 1996; Marchalet al., 1997). Moreover, macrophages and neutrophilsalso express these markers. In contrast, Mac387 im-munoreactivity was found in macrophages of theintra- and peritumoural infiltrate, but not associatedwith TVT cells (Perez et al., 1998). A similar patternof immunoreaction was observed in the present case.

Fig. 4. Alignment of nucleotide sequence obtained from PCRproduct of the vaginal TVT against sequences of the 18SrRNA gene for L. donovani (GenBank X07773.1) and L. in-fantum (GenBank GQ332359.1). The absence of a cytosineresidue at position 32 characterizes the Leishmania sp. in-volved in the vaginal canine TVT as L. infantum.This differential marker expression could be used todiscriminate between Leishmania-laden neoplasticcells and macrophages harbouring amastigotes.Moreover, the capacity of tumour cells to internalizeamastigotes suggests phagocytic and/or receptor-mediated endocytosis that could be related to the pro-posed histiocytic phenotype of TVT (Albanese et al.,2002; Levy et al., 2006; Marino et al., 2012).The present case lacked clinical signs of VL and the

diagnosis was based on the incidental finding of amas-tigotes within the vaginal neoplastic tissue. L. infantumis normally found in the skin of symptomatic andasymptomatic dogs (Solano-Gallego et al., 2004)and shows a tropism for the epididymis, glans penisand prepuce (Diniz et al., 2005), but not for femalegenital organs (Silva et al., 2008). In the presentcase, Leishmania-laden macrophages were mostlyfound adjacent to areas of ulceration and less fre-quently between neoplastic cells. TVT might triggeran inflammatory cell influx (Perez et al., 1998) thatcontributes to the recruitment of Leishmania-ladenmacrophages if VL infection precedes the develop-ment of TVT. However, macrophages could be at-tracted to the neoplastic tissue because of thepresence of amastigotes within tumour cells, as it oc-curs in the skin after inoculation of Leishmania spp.by sandflies (Solano-Gallego et al., 2004).Although alternative routes of transmission for VL

have been demonstrated, including venereal transmis-sion in dogs (Silva et al., 2009), the role of Leishmania-laden TVT cells acting as a source of infection duringcopulation or after cutaneous implantation is un-known. However, a clinicopathological study of TVTand dogs suffering from VL indicated that this sourceof infection represents only a limited risk factor becauseof the low number of cases inwhich amastigotes are ob-served within neoplastic tissues (Marino et al., 2012).However, further studies are still needed to assess theinfectious potential and epidemiological impact of tu-mour cells harbouring Leishmania spp., consideringthat TVT andVL are endemic in similar geographicalregions. Moreover, whether amastigotes within neo-plastic cells are still viable and infectious remains tobe determined. Nevertheless, the viability of Leishmaniaspp. in other phagocytic cells such as neutrophils, den-dritic cells and also in fibroblasts indicates that a rangeof cell types can support the parasite (Williams, 1988;Hervas Rodriguez et al., 1996; Gueirard et al., 2008).There is currentlymuch discussion about themove-

ment of dogs with VL between endemic and non-endemic countries within the European Union(Dujardin et al., 2008; Mencke, 2011). The present

gotes in Canine TVT 159case suggests that consideration should also be givento the movement of dogs with TVT as these animalsmay also have subclinical VL. Furthermore, mating

Diniz S, Melo M, Borges A, Bueno R, Reis B et al. (2005)

1013e1018.

lerel Tai N, Osman O, el Fari M, Presber W, Schonian G(2000) Genetic heterogeneity of ribosomal internal tran-scribed spacer in clinical samples of Leishmania donovanispotted on filter paper as revealed by single-strand con-formation polymorphisms and sequencing. TransactionsGenital lesions associated with visceral leishmaniasisand shedding of Leishmania sp. in the semen of naturallyinfected dogs. Veterinary Pathology, 42, 650e658.

Dujardin J, Campino L, Ca~navate C, Dedet J, Gradoni Let al. (2008) Spread of vector-borne diseases and neglectof leishmaniasis, Europe. Emerging Infectious Diseases, 14,of such dogs may represent an underestimated sourceof Leishmania spp. infection, especially in areas wherethe role of sandflies as vectors is still questionable(Mencke, 2011).

Acknowledgments

The authors thankMrs.D.Waschke,Mrs. B. Buck andMrs. P. Gruenig for excellent technical assistance.K. Kegler received a scholarship from DAAD,Germany.

References

Albanese F, Poli A, Millanta F, Abramo F (2002) Primarycutaneous extragenital canine transmissible venereal tu-mour with Leishmania-laden neoplastic cells: a furthersuggestion of histiocytic origin? Veterinary Dermatology,13, 243e246.

Blavier A, Keroack P, Denerolle I, Goy-Thollot L,Chabanne J et al. (2001) Atypical forms of canine leish-maniosis. Veterinary Journal, 162, 108e120.

Bosch R, Rodrigo A, Sanchez P, Galvez, Enrique M et al.(2002) Presence of Leishmania organisms in specific andnon-specific skin lesions in HIV-infected individualswith visceral leishmaniasis. International Journal of Derma-tology, 41, 670e675.

Catone G, Marino G, Poglayen G, Gramiccia M,Ludovisi A et al. (2003) Canine transmissible venerealtumour parasitized by Leishmania infantum. Veterinary Re-search Communications, 27, 549e553.

Ciaramella P, Oliva G, De Luna R (1997) A retrospectiveclinical study of canine leishmaniasis in 150 dogs natu-rally infected by Leishmania infantum. Veterinary Record,141, 539e543.

Das U, Kumar AD (2000) Review of canine transmissiblevenereal sarcoma. Veterinary Research Communications,24, 545e556.

Dinhopl N, Mostegl M, Richter B, Nedorost N,Maderner A et al. (2011) In-situ hybridisation for the de-tection of Leishmania species in paraffin wax-embeddedcanine tissues using a digoxigenin-labelled oligonucleo-tide probe. Veterinary Record, 169, 525.

160 K. Kegof the Royal Society of Tropical Medicine and Hygiene, 94,575e579.Gallego M, Aguilar A, Plaza S, Gomez J, Burgos F et al.(1996) Kaposis sarcoma with an intense parasitizationby Leishmania. Cutis, 57, 103e105.

Giger U, Oakley D, Owens S, Schantz P (2002) Leishmaniadonovani transmission by packed RBC transfusion to ane-mic dogs in the United States.Transfusion, 42, 381e383.

Gonzalez-Beato M, Moyano B, Sanchez C, Gonzalez-Beato M, Perez-Molina J et al. (2000) Kaposissarcoma-like lesions and other nodules as cutaneous in-volvement in AIDS-related visceral leishmaniasis. Brit-ish Journal of Dermatology, 143, 1316e1318.

Grimaldi J, Tesh R (1993) Leishmaniases of the NewWorld: current concepts and implications for future re-search. Clinical Microbiology, 6, 230e250.

Gueirard E, Laplante A, Rondeau C, Milon G,Desjardins M (2008) Trafficking of Leishmania donovanipromastigotes in non-lytic compartments in neutrophilsenables the subsequent transfer of parasites to macro-phages. Cellular Microbiology, 10, 100e111.

Harris M (1994) Suspected transmission of leishmaniasis.Veterinary Record, 135, 339.

Hervas Rodriguez J, Mozos E, Mendez A, Perez J, Gomez-Villamandos J (1996) Leishmania infection of canine skinfibroblasts in vivo. Veterinary Pathology, 33, 469e473.

Jacobsen B,Krueger L, Seeliger F, BruegmannM, Segales Jet al. (2009) Retrospective study on the occurrence ofporcine circovirus 2 infection and associated entities inNorthern Germany. Veterinary Microbiology, 138, 27e33.

Levy E, Mylonakis M, Saridomichelakis M,Polizopoulou Z, Psychogios V et al. (2006) Nasal andoral masses in a dog. Veterinary Clinical Pathology, 35,115e118.

Manzillo VF, Pagano A, Guglielmino R, Gradoni L,Restucci B et al. (2008) Extranodal gamma-delta T-cell lymphoma in a dog with leishmaniasis. VeterinaryClinical Pathology, 37, 298e301.

Marchal T, Chabanne L, Kaplanski C, Rigal D, Mangol J(1997) Immunophenotype of the canine transmissiblevenereal tumour. Veterinary Immunology and Immunopatho-logy, 57, 1e11.

Margarito J, Ginel P, Molleda J, Moreno P, Novales Met al. (1994) Haemangiosarcoma associated with leish-maniasis in three dogs. Veterinary Record, 134, 66e67.

Marino G, Gaglio G, Zanghi A (2012) Clinicopathologicalstudy of canine transmissible venereal tumour in leish-maniotic dogs. Journal of Small Animal Practice, 53,323e327.

Mencke N (2011) The importance of canine leishmaniosisin non-endemic areas, with special emphasis on the situ-ation in Germany. Berliner und Munchener TierarztlicheWochenschrift, 124, 434e442.

Mozos E, Mendez A, Gomez-Villamandos J, Martn de lasMulas J, Perez J (1996) Immunohistochemical charac-terization of canine transmissible venereal tumor. Veter-inary Pathology, 33, 257e263.

Mukaratirwa S, Gruys E (2003) Canine transmissible vene-real tumour: cytogenetic origin, immunophenotype,

et al.and immunobiology. A review. Veterinary Quarterly, 25,101e111.

Oliveira G, Santoro F, Sadigursky M (1993) The sub-clinical form of experimental visceral leishmaniasisin dogs. Memorias do Instituto Oswaldo Cruz, 88,243e248.

Pangrazio K, Costa E, Amarilla S, Cino AG, Silva T et al.(2009) Tissue distribution of Leishmania chagasi and le-sions in transplacentally infected fetuses from symptom-atic and asymptomatic naturally infected bitches.Veterinary Parasitology, 165, 327e331.

Perez J, Day MJ, Mozos E (1998) Immunohistochemicalstudy of the local inflammatory infiltrate in spontaneouscanine transmissible venereal tumour at different stagesof growth. Veterinary Immunology and Immunopathology, 64,133e147.

Rebbeck CA, Thomas R, Breen M, Leroi AM, Burt A(2009) Origins and evolution of a transmissible cancer.Evolution, 63, 2340e2349.

Romero GAS, Boelaert M (2010) Control of visceral leish-maniasis in Latin America: a systematic review. PLoSNeglected Tropical Diseases, 4, e584.

Schonian G, Nasereddin A, Dinse N, Schweynoch C,Schallig H et al. (2003) PCR diagnosis and characteriza-tion of Leishmania in local and imported clinical samples.Diagnostic Microbiology and Infectious Disease, 47,349e358.

Silva F, Oliveira R, Silva T, Xavier M, Nascimento E et al.(2009) Venereal transmission of canine visceral leish-maniasis. Veterinary Parasitology, 160, 55e59.

Silva F, Rodrigues A, Rego I, Santos R, Oliveira R et al.(2008) Genital lesions and distribution of amastigotesin bitches naturally infected with Leishmania chagasi. Vet-erinary Parasitology, 151, 86e90.

Solano-Gallego L, Fernandez-Bellon H, Morell P,Fondevila D, Alberola J et al. (2004) Histological andimmunohistochemical study of clinically normal skinof Leishmania infantum-infected dogs. Journal of Compara-tive Pathology, 130, 7e12.

Sundar S, Pa K, SahuM, Kumar V,Murray H (2002) Im-munochromatographic strip-test detection of anti-K39antibody in Indian visceral leishmaniasis.Annals of Trop-ical Medical Parasitology, 96, 19e23.

Williams R (1988) Invasion of immune dendritic cells byLeishmania major and Leishmania mexicana mexicana. Journalof Parasitology, 74, 186e187.

Received, June 20th, 2012Accepted, November 29th, 2012

Leishmania spp. Amastigotes in Canine TVT 161

Vaginal Canine Transmissible Venereal Tumour Associated with Intra-tumoural Leishmania spp. Amastigotes in an Asymptomatic ...AcknowledgmentsReferences