jvi accepts, published online ahead of print on 3 july...

A myeloid progenitor cell line capable of supporting human cytomegalovirus latency 1 and reactivation resulting in infectious progeny 2

3 Christine M. O’Connor and Eain A. Murphy* 4

5 6

Department of Molecular Genetics 7 Lerner Research Institute 8

Cleveland Clinic 9 Cleveland, OH 44195 10

11 12 Footnotes: 13 14 *Corresponding author. 15 Phone: 216-445-9870. Fax: 216-444-0512. E-mail: [email protected] 16 17 Running Title: In vitro model system for HCMV latency 18 Abstract word count: 217; Text word count: 7,387 19 20

Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Virol. doi:10.1128/JVI.01278-12 JVI Accepts, published online ahead of print on 3 July 2012

on June 5, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

1

ABSTRACT 21 Human cytomegalovirus (HCMV) is a herpesvirus that establishes a life-long, latent 22 infection within a host. At times when the immune system is compromised, the virus 23 undergoes a lytic reactivation producing infectious progeny. The identification and 24 understanding of the biological mechanisms underlying HCMV latency and reactivation 25 is not completely defined. To this end, we have developed a tractable in vitro model 26 system to investigate these phases of viral infection using a clonal population of myeloid 27 progenitor cells (Kasumi-3 cells). Infection of these cells results in maintenance of the 28 viral genome with restricted viral RNA expression that is reversed with the addition of 29 the phorbol ester, 12-O-tetradecanoylphorbol-13-acetate (TPA, a.k.a. PMA). Additionally, 30 a latent viral transcript (LUNA) is expressed at times where viral lytic transcription is 31 suppressed. Infected Kasumi-3 cells initiate production of infectious virus following TPA 32 treatment, which requires cell-to-cell contact for efficient transfer of virus to other cell 33 types. Importantly lytically infected fibroblasts, endothelial, or epithelial cells can 34 transfer virus to Kasumi-3 cells, which fail to initiate lytic replication until stimulated 35 with TPA. Finally, inflammatory cytokines, in addition to the pharmacological agent 36 TPA, are sufficient for transcription of IE genes following latent infection. Taken 37 together, our findings argue that the Kasumi-3 cell line is a tractable in vitro model 38 system with which to study HCMV latency and reactivation. 39 40


.org/D

ownloaded from

http://jvi.asm.org/

2

INTRODUCTION 41 Human cytomegalovirus (HCMV), a ubiquitous pathogen found in >50% of the general 42 population by 40 years of age, is the most common cause of congenital birth defects yet 43 rarely induces severe disease in immuno-competent hosts (6). Primary infection in 44 healthy individuals results in mild mononucleosis-type symptoms in conjunction with a 45 low level viremia (69). Within a host, HCMV is detected in a wide range of tissues and 46 cell types including, but not limited to, epithelial, endothelial, fibroblasts and myeloid 47 cells (22, 50). Primary infection is often resolved by a strong HCMV specific adaptive 48 immune response. However, HCMV, like all human herpesviruses, establishes a life-long, 49 latent infection within its host that is likely coupled with a subclinical persistent/latent 50 infection (6, 23). During this phase of the viral lifecycle, HCMV infection remains 51 asymptomatic in immunocompetent individuals, however upon immunosuppression, such 52 as that which occurs in solid organ transplant recipients, bone marrow recipients, and 53 AIDS patients, reactivation of the virus leads to severe morbidity and mortality (49). 54 HCMV-associated disease in adults is predominantly due to reactivation of latent virus as 55 opposed to primary infection, and therefore understanding latent infection and 56 reactivation is critical. 57 58

The reservoir for latent HCMV is commonly accepted to reside within 59 hematopoietic stem cells within the bone marrow, particularly in undifferentiated cells of 60 the myeloid lineage and monocytes (15, 26, 28, 32, 40, 56). Several hallmarks define 61 herpesvirus latency, including long-term maintenance of the viral genome coupled with 62 limited viral transcript expression, and a lack of detectable productive viral replication 63


.org/D

ownloaded from

http://jvi.asm.org/

3

(reviewed in 8). In vivo, latently infected cells represent only a small population of an 64 individual’s hematopoietic compartment. Typically only 1 in 10,000 to 1 in 25,000 65 PBMCs harbor viral genomes with a low viral copy number (2-13 viral genomes present 66 per cell) (54). Considerable efforts have been made to identify specific viral transcripts 67 that are expressed during stages of latency from naturally infected cells including the 68 identification of UL138 (13), vIL-10 (24), US28 (5), ORF94 (29) and a transcript that 69 runs antisense to the UL81-UL82 locus called LUNA (4). The biological requirement of 70 these viral factors on establishment and maintenance of latency are the focus of ongoing 71 investigations. It is generally established that virus reactivates from latency either within 72 CD34+ hematopoietic progenitors or CD14+ monocytes reactivates as the cells mature 73 into macrophages or dendritic cells resulting in a lytic infection (reviewed in 45). 74

75 Previous studies using several model systems have laid the foundation for 76

establishing paradigms of key components of HCMV latency and critical aspects of 77 reactivation. While these studies have proven instrumental, these model systems possess 78 characteristics that render studies assessing complete reactivation from latency 79 problematic. In vitro HCMV latency models using either THP-1 cells (a monocyte cell 80 line) (10) or NTera2 cells (embryonic carcinoma cell line) (2) have been extensively 81 employed to study HCMV latency (5, 10, 11, 20, 25, 30, 31, 34, 46, 63, 66, 70). While 82 these cell lines are valuable tools for identifying cellular factors that modulate viral 83 latency, neither cell type maintain the viral genome for extended periods of time, 84 resulting in no clear demarcation between latency and reactivation. Importantly, these 85 model systems lack the ability to recapitulate the critical defining characteristic of 86


.org/D

ownloaded from

http://jvi.asm.org/

4

reactivation -- the production of infectious virus progeny. Thus these systems represent 87 only a snapshot of the complete viral life cycle. 88

89 Ex vivo latency models that utilize primary CD34+/CD38- hematopoietic 90

progenitor cells (HPCs) isolated from bone marrow or umbilical cord blood (13, 14, 26, 91 35, 43) as well as peripheral blood monocytes (7, 16, 27, 33, 51, 53, 57, 59, 68) represent 92 perhaps a more complete assessment of HCMV latency. These model systems support 93 HCMV latent infection and importantly, the latent virus can be reactivated, producing 94 infectious progeny (12, 14, 16, 51, 56, 57). However, these primary cell systems are 95 hampered by finite cell numbers coupled with lower infectivity rates, limited life span ex 96 vivo, donor variation, the complexity of a heterogeneous population, and the inability to 97 exploit current molecular biology tools to manipulate gene expression. For example, 98 since these primary cells have short life spans, it is not possible to generate stable cell 99 lines that either repress or over-express a gene of interest. Donor variation between 100 samples and highly heterogeneous populations, coupled with reduced infectivity rates, 101 renders global analyses by deep sequencing and/or commercial microarray platforms for 102 transcript assessment problematic. Thus, although such ex vivo systems most closely 103 represent a complete model of latency, it is difficult to further identify and define the 104 biological roles of cellular and viral factors that are involved in latency. 105 106

In order to develop a model system that combines the positive attributes of current 107 systems, we have defined a novel system for HCMV latency in vitro utilizing Kasumi-3 108 cells. Kasumi-3 cells are a clonal cell line, derived from a patient suffering from 109


.org/D

ownloaded from

http://jvi.asm.org/

5

myeloperoxidase-negative acute leukemia (3). This patient harbored a chromosomal 110 rearrangement, including a breakpoint that disrupts the normal repression of the EVI1 111 gene promoter. EVI1 is a nuclear activator of the cell cycle and stem cell growth and 112 expression of EVI1 aids in the transformation of these cells (37). This cell line is 113 attractive as a potential resource for a latency model, as these cells are negative for 114 HCMV and express cell surface markers indicative of myeloid progenitors, including 115 CD13, CD33, CD34, HLA-DR, and c-Kit (3). Furthermore, Kasumi-3 cells maintain the 116 ability to differentiate down the myeloid pathway, and specifically are directed towards 117 the monocyte lineage by the addition of the phorbol ester, 12-O-tetradecanoylphorbol-13-118 acetate (TPA, a.k.a. PMA) (3). Therefore, we hypothesized that Kasumi-3 cells are a 119 tractable cell line that could be used to study HCMV latency and reactivation. We report 120 that the Kasumi-3 myeloid-derived cell line is well suited to study in vitro HCMV latency 121 and recapitulates all of the aspects of viral dormancy and reactivation. We have observed 122 key defining characteristics of HCMV latency using the Kasumi-3 cells, including initial 123 infection, genome maintenance in the absence of viral lytic transcription, reactivation due 124 to an external stimulus, and finally, production of infectious progeny virions. Thus the 125 novel in vitro system described herein using Kasumi-3 cells serves as an attractive model 126 system for investigations into mechanisms of HCMV latency and reactivation, providing 127 a valuable resource to complement current ex vivo model systems. 128 129 MATERIALS AND METHODS 130 131


.org/D

ownloaded from

http://jvi.asm.org/

6

Cells and Viruses. Kasumi-3 cells (ATCC Cat # CRL-2725) were maintained in RPMI 132 containing 20% fetal bovine serum (FBS) and 100U/ml each of penicillin and 133 streptomycin at a concentration between 3x105 and 3x106 cells/ml. Primary human 134 foreskin fibroblasts (HFFs; passages 9-20) were cultured in Dulbecco’s modified Eagle 135 medium (DMEM) containing 10% FBS, 1mM sodium pyruvate, 10mM HEPES, 2mM L-136 glutamine, 0.1mM non-essential amino acids, and 100U/ml each of penicillin and 137 streptomycin. Primary human retinal pigment epithelial cells (ARPE19 [ATCC Cat # 138 CRL-2302]; passages 27-36) were cultured in 1:1 DMEM:HAM’s F12 with 10% FBS, 139 2.5mM L-glutamine, 0.5mM sodium pyruvate, 15mM HEPES, 1.2g/L NaHCO3, and 140 100U/ml each of penicillin and streptomycin. Primary human umbilical vascular 141 endothelial cells (HUVECs; passages 3-6) were cultured on tissue culture treated plates 142 coated with 3% porcine gelatin (Sigma) in EBM-2 medium containing 2% FBS and the 143 EGM-2 supplements (Lonza). All cells were propagated with 5% CO2 at 37°C. 144 145

The BAC-derived clinical strain, TB40/E (clone #4), was used in this study (52). 146 For infections, either TB40/E-wt-mCherry (39) or TB40/E expressing eGFP was used 147 where indicated. Using bacterial recombineering methods (64), we generated TB40/E-148 wtGFP, which expresses eGFP from the simian virus 40 (SV40) early promoter. In brief 149 galK was inserted between the US34 and TRS1 genes of TB40/E by homologous 150 recombination using the following primers: Forward 5’-151 TGTATTTGTGACTATACTATGTGCAGTCGTGTGTCGATGTTCCTATTGGGCCT152 GTTGACAATTAATCATCGGCA-3’ and Reverse 5’-153 GATGTCTTCCTGCGTCCCACCATTCTTTATACCTCCTACATTCACACCCTTTCA154


.org/D

ownloaded from

http://jvi.asm.org/

7

GCACTGTCCTGCTCCTT-3’, where the underlined sequences correspond to galK. 155 GalK-positive clones were selected as previously described (38). A cassette containing 156 eGFP driven by the SV40 promoter along with the bovine growth hormone poly(A) 157 sequence was then PCR amplified using the following primers: Forward 5’-158 TTGTATTTGTGACTATACTATGTGCAGTCGTGTGTCGATGTTCCTATTGGGATC159 TGCGCAGCACCATGGCCTGAAATAACCTCTGAAAG-3’ and Reverse 5’-160 GATGTCTTCCTGCGTCCCACCATTCTTTATACCTCCTACATTCACACCCTTCTG161 CCCCAGCTGGTTCTTTCCGCCTCAGAAGCCATAGA-3’ where the underlined 162 sequence corresponds to the intergenic region between HCMV US34 and TRS1. The 163 resulting PCR product was transformed into electro-competent SW105 cells, and finally 164 counter-selected for galK to generate TB40/E-wtGFP. All clones were sequenced to 165 validate proper positional insertion as well as to validate the sequence of the cassette 166 (data not shown). 167 168

Virus stocks were prepared as previously described (67). In brief, low-passage 169 fibroblasts were transfected with BAC DNA along with 1ug of pCGNpp71 plasmid, and 170 virus was harvested from cells when they reached complete cytopathic effect by 171 centrifugation through a 20% sorbitol cushion. Virus stocks were stored in DMEM 172 containing 10% FBS and 1.5% bovine serum albumin (BSA) at -80°C. Viral stock titers 173 were calculated using 50% tissue culture infectious dose (TCID50) assays on fibroblasts. 174 175 Kasumi-3 infection assay. Kasumi-3 cells were infected with TB40/E-wtGFP or 176 TB40/E-wt-mCherry, where indicated, at a multiplicity of 10 PFU/cell by centrifugal 177


.org/D

ownloaded from

http://jvi.asm.org/

8

enhancement at 1000 x g for 30 min at room temperature. Infected cultures were 178 incubated overnight at 37°C and 5% CO2. To remove debris, infected cells were 179 cushioned onto Ficoll-Paque PLUS (GE Healthcare) by low-speed centrifugation (450 x 180 g) for 35 min at room temperature without the brake. The following day, GFP-181 positive/propidium iodide (PI)-negative cells indicative of viable, infected cells were 182 isolated at room temperature by fluorescent activated cell sorting (FACS), using a 183 FACSDiva (Beckton-Dickinson). eGFP-positive cells were then returned to culture to 184 establish a latent infection. For each time point, 20nM 12-O-tetradecanoylphorbol-13-185 acetate (TPA, a.k.a. PMA; Sigma), 20μg/ml tumor necrosis factor-α (TNF-α; Pepro Tech, 186 Inc) or Interleukin-1β (IL-1β; Pepro Tech, Inc) was added 48 h prior to harvest, in order 187 to induce viral lytic reactivation. Where indicated, cells were cultured with 300 μg/ml 188 phosphonoacetic acid (PAA; Sigma). For these cultures, PAA-containing media was 189 changed every 5 d. 190 191 Analysis of viral RNA and DNA. Cell-associated and cell-free viral DNA was isolated 192 as previously described by lysis with 40 μg/ml proteinase K (PK) and 0.16% sodium 193 dodecyl sulfate (SDS) treatment followed by phenol:chloroform:isoamyl alcohol 194 extraction and ethanol precipitation (14). To ensure the measurement of encapsidated 195 viral DNA, cell-free viral particles were pre-treated with DNase prior to the addition of 196 PK and SDS. The levels of cell-associated viral DNA were normalized to the cellular 197 gene, MDM2, using the following primers: Forward 5’-CCCCTTCCATCACATTGCA-3’ 198 and Reverse 5’-AGTTTGGCTTTCTCAGAGATTTCC-3’. All samples were analyzed in 199


.org/D

ownloaded from

http://jvi.asm.org/

9

triplicate by SYBR green (Applied Biosystems) using an Eppendorf realplex2 200 Mastercycler real-time PCR machine. 201 202

Intracellular viral RNA was quantified as previously described (62). In brief, 203 RNA was isolated using TriReagent (Sigma) according to the manufacturer’s instructions 204 and precipitated with isopropanol. Samples were treated with DNase using the DNA-free 205 kit (Ambion) according to the manufacturer’s instructions. The concentration of RNA 206 was determined and 0.5 μg was used for the RT reaction. cDNA was synthesized using 207 the TaqMan reverse transcription kit with random hexamers according to the 208 manufacturer’s protocol (Applied Biosystems). Equal amounts of samples were analyzed 209 by quantitative PCR (qPCR) in triplicate using an Eppendorf realplex2 Mastercycler real-210 time PCR machine. RNA was normalized to cellular GAPDH: Forward 5’-211 ACCCACTCCTCCACCTTTGAC-3’ and Reverse 5’-212 CTGTTGCTGTAGCCAAATTCGT-3’. 213 Primer sets used for viral RNA and DNA are as follows: UL123 Forward 5’-214 GCCTTCCCTAAGACCACCAAT-3’ and Reverse 5’-215 ATTTTCTGGGCATAAGCCATAATC-3’; UL44 Forward 5’-216 TACAACAGCGTGTCGTGCTCCG-3’ and Reverse 5’-217 GGCGTGAAAAACATGCGTATCAAC-3’; UL99 Forward 5’-218 GTGTCCCATTCCCGACTCG-3’ and Reverse 5’-TTCACAACGTCCACCCACC-3’; 219 UL122 Forward 5’-ATGGTTTTGCAGGCTTTGATG-3’ and Reverse 5’-220 ACCTGCCCTTCACGATTCC-3’; UL54 Forward 5-CCCTCGGCTTCTCACAACAAT-221 3’ and Reverse 5’-CGAGGTAGTCTTGGCCATGCAT-3’; UL83 Forward 5’-222


.org/D

ownloaded from

http://jvi.asm.org/

10

CGTGGAAGAGGACCTGACGATGAC-3’ and Reverse 5’-223 GGGACACAACACCGTAAAGCCG-3’. 224 225 To amplify the latent transcript LUNA, a strand specific RT reaction was 226 performed on RNA prepared as described above. The TaqMan reverse transcription kit 227 (Applied Biosystems) was used to generate LUNA specific cDNA, with the exception 228 that the random hexamers were replaced with the following strand-specific primer for 229 LUNA: 5’-ATGACCTCTCATCCACACC-3’. As a negative control, a primer upstream 230 of the LUNA coding region was used, to ensure the amplification of LUNA-specific 231 cDNA: 5’-CCTCCGCGTCACGCTGACCGG-3’. cDNA was then quantified by qPCR as 232 describe above using the following primer set: Forward 5’-233 GAGCCTTGACGACTTGGTAC-3’ and Reverse 5’-GGAAAACACGCGGGGGA-3’. 234 235 Immunofluorescence detection of pUL99. Kasumi-3 cells were infected with TB40/E-236 wt-mCherry at a multiplicity of 1.0 PFU/ml by low-speed centrifugation. Following 24 h 237 at 37°C/5% CO2 cells were cushioned onto Ficoll-Paque PLUS (GE Healthcare) and 238 incubated at 37°C/5% CO2 for an additional 24 h, after which the cells were sorted for 239 mCherry. Sorted cells were returned to culture for 18 d, and then cultured an additional 2 240 d in the presence or absence of 20nM TPA (Sigma). Non-adherent cells were removed 241 from culture, and cells that had adhered were removed by trypsin treatment. For each 242 treatment condition, adhered and non-adhered cells were combined, washed twice with 243 PBS and fixed in 4% formaldehyde (Thermo Scientific) for 10 min at room temperature. 244 The fixative was diluted with 5 times the volume with permeabilization buffer (1% BSA, 245


.org/D

ownloaded from

http://jvi.asm.org/

11

2mM EDTA, 0.1% sodium azide, 0.1% saponin, in PBS) and pelleted at 0.5 x g for 7 min. 246 Cells were washed and pelleted an additional two times, after which the cells were 247 incubated for 20 min at room temperature with a monoclonal antibody for pUL99 (48), 248 diluted 1:10 in permeabilization buffer. Cells were diluted and washed with 249 permeabilization buffer as above, and then incubated with Alexa Fluor 488 anti-mouse 250 secondary antibody (Molecular Probes) diluted 1:1000 in permeabilization buffer for 15 251 min in the dark at room temperature. Cells were diluted and washed as above. Cells were 252 washed an additional two times in buffer lacking saponin. Cells were then resuspended in 253 Vectashield mounting media (Vector Labs) containing 4’,6’-diamidino-2-phenylindole 254 (DAPI) and mounted on Superfrost Plus microscope slides (Cardinal Health). Images 255 were captured by using a Leica CTR5000 microscope equipped with tile scanning, and 256 outfitted with a Retiga-SRV camera (QImaging). Tiled imaged were collected at 10X 257 using Image Pro Plus, version 6.1 (MediaCybernetics) with an Oasis tile scanning module. 258 259 Assay for reactivation of infectious progeny virions. Kasumi-3 cells were infected at a 260 multiplicity of 10 PFU/cell by low-speed centrifugation, followed by overnight 261 incubation at 37°C/5% CO2. Infected cells were then treated with trypsin to remove 262 virions that had not entered the cells, and then Ficoll-Paque PLUS (GE Healthcare) 263 cushioned as above. Infected Kasumi-3 cells were maintained in culture for and 264 additional 6 days in the presence or absence of 20nM TPA (Sigma). Cells were then 265 washed with 1X PBS prior to co-culture with primary HFFs to remove the TPA. Infected 266 cells were co-cultured with HFFs with or without cell-to-cell contact using transwells 267 (0.4μm; Corning). After 2 days the infected Kasumi-3 cells were removed, and the HFFs 268


.org/D

ownloaded from

http://jvi.asm.org/

12

were washed twice with PBS, then returned to culture with fresh media for an additional 269 4 days. Over the complete course of infection, HFFs were monitored for GFP-positive 270 plaques, and HFF cell-associated DNA was analyzed for viral genomes by qPCR, 271 described above. 272 273

Individual cultures of primary HUVECs, ARPE19s, or HFFs were infected at a 274 multiplicity of 1.0 PFU/cell for 2 days, and then trypsinized to remove any virus that had 275 not entered the cells. Uninfected Kasumi-3 cells were co-cultured with each cell type in 276 the presence or absence of a transwell (0.4μm; Corning) for 5 days, after which the 277 Kasumi-3 cells were removed and replated in the presence or absence of 20nM TPA 278 (Sigma) for 2 days. Kasumi-3 cell-associated DNA was harvested to quantify viral DNA 279 by qPCR, described above. 280 281 Limiting dilution assay. A HCMV limiting dilution assay was performed as preciously 282 described (12) with minor modifications. Kasumi-3 cells were infected at a multiplicity 283 of 10 PFU/cell, cushioned by Ficoll-Paque PLUS (GE Healthcare) after 24 h to remove 284 unattached virus and cell debris, and finally sorted by FACS the following day as 285 described above. Cells were then cultured for 8 days to favor a latent infection. Infected 286 cells were then cultured for an additional 2 days in the presence or absence of 20nM TPA 287 (Sigma). TPA and any residual cell-free virus was removed by trypsin treatment and 288 subsequently washed twice with 1X PBS. The Kasumi-3 cells were then plated directly 289 onto primary HFFs in a 96-well plate, where each well contained 1.0 x 104 HFF/well. The 290 Kasumi-3 cells were plated in 2-fold dilution, beginning with 1600 cells/well. In parallel 291


.org/D

ownloaded from

http://jvi.asm.org/

13

we plated infected Kasumi-3 cells that were sonicated prior to TPA treatment, to control 292 for residual cell-associated virus that might be infectious prior to reactivation. HFFs were 293 monitored for plaque formation. Positive wells were scored, and quantified with a 90% 294 confidence interval using the extreme limiting dilution analysis (ELDA) webtool 295 interface (17). If no wells were positive for plaque formation across the wells with the 296 most number of Kasumi-3 cells, the assumption was made that reactivation occurred in 1 297 in 38,400 cells, or at a frequency of 2.6 x 10-5. 298 299 300 RESULTS 301 302 Infected Kasumi-3 cells maintain HCMV genomes while restricting viral gene 303 transcription. To determine if Kasumi-3 cells could support HCMV infection, we 304 infected these cells by centrifugal enhancement at a multiplicity of 10 PFU/cell with 305 TB40/E-wtGFP and isolated viable eGFP-positive cells by FACS. We observed no 306 detectable eGFP positive cells for the viable mock-infected cells (Fig. 1A). Interestingly, 307 we observed roughly 11.4% eGFP-positive cells from the viable infected Kasumi-3 308 cultures 48 hours post-infection (hpi) (Fig. 1B) indicating that the virus was able to enter 309 the Kasumi-3 cells and express a reporter gene that is incorporated into the viral genome. 310 A common hallmark of herpesviral latency is the maintenance of the viral genome in the 311 absence of robust lytic viral transcription. In order to determine the status of HCMV 312 transcription in Kasumi-3 cells, we collected infected cells over a 10-day time course and 313 isolated both RNA and DNA to quantify viral transcripts and genomes, respectively. To 314


.org/D

ownloaded from

http://jvi.asm.org/

14

monitor viral DNA maintenance and levels of viral transcription we evaluated the 315 expression (RNA) and quantity (DNA) of the viral open reading frame (ORF), UL123. 316 We found that although viral genomes increase over the time course, viral RNA increases 317 slightly at 5 dpi but then decreases significantly by 10 dpi (Fig. 2). In support of this 318 finding, viral gene expression of UL123 in the ex vivo primary cell systems is activated at 319 early times and is then repressed (14) suggesting that our Kasumi-3 latency model system 320 mimics the findings in these other model systems. Taken together, these data suggest that 321 infected Kasumi-3 cells maintain viral genomes, yet restrict the transcription of viral 322 genes. 323 324 Viral transcription is induced in infected Kasumi-3 cells with the addition of TPA. 325 We next asked if the phorbol ester, TPA could induce viral transcription in the infected 326 Kasumi-3 cells, thereby relieving the repression of these transcripts. TPA is commonly 327 used in other well-established in vitro herpesviral latency model systems including EBV 328 (36) and KSHV (47) to reactivate viral transcription, thereby inducing lytic replication 329 (36). Additionally, partial HCMV reactivation is observed in Thp-1 (31, 63, 65) and 330 NTera2 (34) model systems after treatment with TPA. Finally, treatment of Kasumi-3 331 cells with TPA promotes their maturation to terminally differentiated cells of the myeloid 332 lineage (3), an important cell type in HCMV reactivation (55, 61, 68). To determine if 333 TPA is sufficient to induce viral gene transcription in our Kasumi-3 model system, we 334 harvested total RNA over a time course from infected cells cultured in the presence or 335 absence of this phorbol ester. We assessed representative viral transcripts from each class 336 of viral genes (i.e.: Immediate Early [IE], Early [E], Late [L]). HCMV, like other 337


.org/D

ownloaded from

http://jvi.asm.org/

15

herpesviruses, transcribes its genes in a coordinated cascade (60). IE genes are 338 transcribed first, which predominantly encode transcriptional activators and immune 339 evasion proteins. The Major Immediate Early Promoter (MIEP) driven transcripts encode 340 proteins (IE1 and IE2) that function to initiate E gene transcription and subsequent 341 protein synthesis. The E genes encode DNA replication machinery and facilitate HCMV 342 genome amplification, after which L genes are transcribed and function mainly in viral 343 assembly and egress. Interestingly, TPA treatment induces IE (UL122 and UL123), E 344 (UL44 and UL54), and L (UL83 and UL99) gene transcription. It is important to note that 345 the IE, E and L designations, while named on a temporal schedule, were originally 346 defined by protein and DNA replication inhibitor treatments. As such, the accumulation 347 of specific transcripts is more closely related to stages of viral replication as opposed to a 348 defined time frame. Yet several of the transcripts are commonly used to monitor timing 349 of lytic replication (e.g.: UL123, UL44 and UL99) (38). We observed a similar pattern of 350 gene expression in our TPA treated Kasumi-3 cells as we see in lytic infections of 351 fibroblasts. Maximal detection of the UL123 was observed at 5 dpi followed by the UL44 352 E gene at 6-7 dpi and finally UL99 L gene expression at 8 dpi (Fig. 3). We did not 353 observe robust HCMV transcription within infected cells that were untreated suggesting 354 the requirement of the phorbol ester on promoting reactivation. This indicates that TPA is 355 sufficient for inducing lytic gene transcription in infected Kasumi-3 cells, and that 356 transcription occurs in a cascade similar to that observed in lytically infected cells. 357 358 The HCMV latency transcript LUNA is expressed during viral transcriptional 359 repression in infected Kasumi-3 cells. Five viral transcripts are expressed in ex vivo 360


.org/D

ownloaded from

http://jvi.asm.org/

16

HCMV latent model systems including LUNA (4). Both the LUNA transcript and protein 361 are expressed in peripheral blood of sero-positive individuals (4). In order to determine if 362 LUNA is expressed in our model system, we utilized a modified RT-qPCR assay, in 363 which we used a strand-specific primer that yield a cDNA for LUNA but not the two 364 viral transcripts expressed on the opposite strand from LUNA (i.e.: UL81-82). We also 365 utilized a reverse transcriptase primer complementary to the region just upstream of the 366 LUNA transcription start site as a negative control. Kasumi-3 cells infected with HCMV 367 were FACs sorted and allowed to incubate for 20 days. The cells were either mock 368 treated or treated with TPA for 2 days prior to harvesting for total RNA. We observe 369 significantly more LUNA transcripts compared to UL123 transcripts in Kasumi-3 cells in 370 the absence of TPA (Fig. 4). Upon stimulation by TPA, IE gene expression increased in 371 relation to LUNA expression, consistent with activation of the lytic lifecycle (Fig. 4). As 372 expected, we were not able to detect amplification of LUNA when we utilized the 373 upstream primer thereby showing specificity of the assay (data not shown). These results 374 suggest that a viral latency transcript is expressed at times during which IE gene 375 expression is restricted. Further, this mimics the findings observed in natural and ex vivo 376 HCMV latency models (41). 377 378 TPA-induction of infected Kasumi-3 cells promotes the release of infectious progeny 379 virions. We have shown that Kasumi-3 cells are capable of supporting a latent HCMV 380 infection and that transcription of lytic genes is induced by TPA treatment. We therefore 381 next asked if these cells could produce extracellular virions following TPA treatment. To 382 this end, we infected Kasumi-3 cells and assessed their ability to produce cell-free virus 383


.org/D

ownloaded from

http://jvi.asm.org/

17

in the presence or absence of TPA. We collected cell-free supernatants over time for use 384 in quantitative analysis to determine the amount of released viral genomes. To ensure that 385 we were quantifying encapsidated viral DNA and not free DNA arising from cellular 386 necrosis or lysis, we first treated the cell-free supernatants with DNase prior to the release 387 of encapsidated viral genomes by proteinase K and SDS. HCMV infected Kasumi-3 cells 388 treated with TPA indeed produced extracellular particles as determined by qPCR for viral 389 genomes, whereas there were significantly fewer particles produced from infected cells 390 that were untreated (Fig. 5A). This result suggests that TPA treatment of infected 391 Kasumi-3 cells is sufficient for producing viral progeny. 392 393

Although informative, this assay does not yield information regarding the 394 infectivity of these particles. A defining attribute of a suitable in vitro model for 395 herpesvirus latency is the ability of the cells to produce infectious progeny upon lytic 396 induction. To determine if infectious viral progeny are produced in TPA-reactivated, 397 HCMV-infected Kasumi-3 cells, we assessed the ability of these cells to transfer virus to 398 HFFs. Primary fibroblasts (e.g.: HFFs and MRC5s) are commonly used to study the 399 HCMV lytic lifecycle in tissue culture as they are highly permissive for viral replication, 400 and thus serve as a suitable cell type with which to determine the infectivity of the 401 reactivated virus. We infected Kasumi-3 cells with TB40/E-wtGFP as described above, in 402 the presence or absence of TPA. To ensure that TPA treatment would not impact 403 infection of the fibroblasts, we cleared the Kasumi-3 cells of TPA prior to co-culturing. 404 We co-cultured these cells with HFFs either by direct physical contact or separated by 405 transwells to determine if cell-to-cell contact is necessary for the transfer of infectious 406


.org/D

ownloaded from

http://jvi.asm.org/

18

virus. After 2 days of co-culture between the two cell types, we removed the non-407 adherent Kasumi-3 cells, and monitored the HFFs for plaque formation for an additional 408 4 days by fluorescence microscopy. Fibroblasts that were in contact (i.e.: in the absence 409 of a transwell) with infected, TPA-treated Kasumi-3 cells displayed distinct plaques that 410 were eGFP positive (Fig. 5B). Importantly, we did not observe plaque formation within 411 the fibroblast monolayer in cells co-cultured with infected Kasumi-3 cells that were 412 untreated indicating that phorbol ester treatment is required to produce infectious virus 413 within Kasumi-3 cells. The requirement of TPA treatment suggests that the Kasumi-3 414 cells are not merely functioning as a carrier of infectious particles from the original 415 infection. We next qualitatively measured the infectivity rate of the mock and TPA 416 treated Kasumi-3 cells on co-cultured HFFs by monitoring the amplification of viral 417 DNA within the HFFs by qPCR. Fibroblasts co-cultured with TPA-treated Kasumi-3 418 cells displayed increased viral genome levels over background as compared to either 419 mock-infected cells treated with TPA or infected cells that were not treated with TPA 420 (Fig 5C). Infected Kasumi-3 cells that were treated with TPA, but co-cultured with HFFs 421 in transwells failed to transmit virus to the fibroblasts (data not shown), which suggests 422 that cell-to-cell contact is necessary for transferring virus to the fibroblasts, similar to the 423 mode of viral transfer seen in ex vivo models (42). Taken together, these data suggest that 424 infected Kasumi-3 cells treated with TPA produce viral particles that can establish a lytic 425 infection in permissive fibroblasts. 426 427

We next sought to determine the efficiency of viral reactivation by extreme 428 limiting dilution assay (ELDA) (17). Following initial infection of Kasumi-3 cells at a 429


.org/D

ownloaded from

http://jvi.asm.org/

19

multiplicity of 10 PFU/cell and FACS for eGFP expression, we cultured the cells for 8 430 days, after which we treated the cells for an additional 2 days in the presence or absence 431 of TPA to induce viral reactivation. We removed residual TPA by washing the kasmui-3 432 cells so as to ensure this pharmacological agent would not influence infection of the 433 fibroblasts. We then seeded the Kasmumi-3 cells in 2-fold dilution from 1600 to 12.5 434 cells per well of a 96-well plate seeded with a monolayer of primary fibroblasts to 435 determine the number of reactivated Kasumi-3 cells required to form an infectious foci. 436 To control for any infectious intracellular particles within the Kasumi-3 cells prior to 437 reactivation, we included a lysate control, whereby the cells were disrupted by bath 438 sonication (12). We monitored and quantified plaque formation in the HFFs 8 days post 439 co-culture with the Kasumi-3 cells using the webtool interface developed by Hu and 440 Smyth (17) for analyses. We observed that the Kasumi-3 cells that were sonicated (i.e.: 441 the lysate control) failed to produce eGFP-positive wells in our assay further confirming 442 that the Kasumi-3 cells are not simply a carrier of pre-existing virus left from the primary 443 infection. We observed 1 eGFP-positive plaque for every 131 infected Kasumi-3 cells 444 treated with TPA or a frequency of 7.6 x 10-3 compared to that of the lysate control, 445 which was 1 in 38,400 cells or a frequency of 2.6 x 10-5 (data not shown). In cultures that 446 were not treated with TPA to induce viral reactivation, the frequency of reactivation was 447 only 2.8 x 10-3 or 1 eGPF-positive plaque per 349 cells. A log fraction plot of the limiting 448 dilution model derived from our assay shows distinct slopes with non-overlapping, 90% 449 confidence interval plots for latently infected Kasumi-3 cell reactivation in TPA-treated 450 versus untreated cultures, demonstrating that the addition of TPA significantly increases 451 viral reactivation (Fig. 6). Although there is a low-level of viral replication in the non-452


.org/D

ownloaded from

http://jvi.asm.org/

20

TPA treated cultures, TPA significantly reduces the number of Kasumi-3 cells required to 453 form plaques. Together, these results suggest that reactivation of HCMV in infected 454 Kasumi-3 cells produces infectious virus following the treatment of these cells with TPA. 455

456 PAA treatment of infected Kasumi-3 cells limits spontaneous reactivation of HCMV. 457 We observed a low-level accumulation of viral DNA in the absence of reactivation by 458 TPA treatment (Fig. 5A). Additionally, our limiting dilution assays suggest that infected 459 Kasumi-3 cells can produce infectious virus (although inefficiently) in the absence of 460 TPA stimulation (Fig 6). There are three possible scenarios that could account for these 461 observations: 1) infection with HCMV establishes a low-level, persistent infection that is 462 stimulated by TPA treatment, 2) a small population of infected Kasumi-3 cells fails to 463 enter a repressed state upon infection or 3) latency is established following infection that 464 demonstrates low levels of spontaneous lytic reactivation. In order to differentiate 465 between these three possibilities, we monitored the expression of a viral late protein, 466 pUL99, by immunofluorescence in Kasumi-3 cells infected for 20 days. If cells are 467 persistently infected or fail to initially undergo a quiescent state, the relative intensity of 468 pUL99 staining would increase with TPA treatment but the number of positive cells 469 would not significantly change. However, if a latent infection is established, the number 470 of pUL99 cells would increase in response to TPA treatment but the relative intensity of 471 antigen staining would not vary significantly. HCMV mCherry-positive Kasumi-3 cells 472 were sorted and maintained for 18 dpi, at which point cells were cultured for an 473 additional 2 days in the presence or absence of TPA. These cells were then harvested and 474 fixed for IFA, using an antibody to pUL99 as well as DAPI to identify nuclei. Forty 475


.org/D

ownloaded from

http://jvi.asm.org/

21

random fields of stained cells from three different experiments were counted for 476 expression of pUL99. A representative field of view is shown in Fig 7A. We observed 477 ~15% pUL99 positive cells in the infected Kasumi-3 cells that were not treated with TPA 478 (Fig 7B). Interestingly, we observe ~40% pUL99 staining in cells that are treated with 479 TPA indicating that the number of cells but not the staining intensity has increased upon 480 TPA treatment. This observation is consistent with a latent infection versus a persistent 481 infection or incomplete quiescence. 482 We next determined if background levels of viral transcripts in the absence of 483 TPA is the result of spontaneous reactivation of HCMV and/or the result of cells that 484 could not establish a complete latent state. We maintained infected, FACs sorted Kasumi-485 3 cells either in the presence or absence of phosphonoacetic acid (PAA) for 20 days. PAA 486 is a nucleoside analogue that in the presence of HCMV UL97, functions as an inhibitor 487 for both viral and cellular DNA polymerases (1). Thus, cells undergoing an active lytic 488 replication would be cleared from the population in the presence of PAA. In the absence 489 of PAA we can detect UL123 gene expression that is increased upon treatment with TPA 490 (Fig 7C). However, infected Kasumi-3 cells maintained in the presence of PAA display 491 near-undetectable levels of UL123 gene expression. This suggests that PAA treatment is 492 sufficient to eliminate cells that harbor a transcriptionally active viral genome. 493 494 Kasumi-3 cells require cell-to-cell contact with HCMV infected cells to establish an 495 infection. Although myeloid progenitor cells are an important cell type for HCMV 496 pathogenesis in vivo, this cell type is not likely the first to come in contact with the virus. 497 Cells at the epithelium such as endothelial and epithelial cells likely play an important 498


.org/D

ownloaded from

http://jvi.asm.org/

22

role in primary HCMV infection in the host (6). Thus, we asked if endothelial and 499 epithelial cells, as well as fibroblasts, could transfer HCMV to Kasumi-3 cells. We 500 infected HUVECs (endothelial cells), ARPE19s (epithelial cells) or HFFs with TB40/E-501 wtGFP at a multiplicity of 1.0 PFU/cell for 2 days, after which we removed virus that had 502 bound but not entered by trypsin treatment so as to neutralize any remaining extracellular 503 virus that may influence our results. We then co-cultured these cells with uninfected 504 Kasumi-3 cells either with direct contact or separated by transwells for 5 days. The non-505 adherent Kasumi-3 cells were then collected and cultured in the presence or absence of 506 TPA. We assessed whole-cell DNA content of the Kasumi-3 cells, and found the TPA-507 treated cells that were cultured in the absence of the transwells harbored a significantly 508 increased quantity of viral genomes when compared to co-cultured cells that were mock-509 treated with the phorbol ester (Fig. 8). In addition, our results indicate that cell-to-cell 510 contact is required for HCMV to transfer from fibroblasts, endothelial, or epithelial cells 511 to Kasumi-3 cells, as Kasumi-3 cells co-cultured in transwells with these various cell 512 types did not yield cell-associated viral DNA, even following TPA treatment (Fig.8). 513 Taken together, these results suggest that we are able to infect cells that likely represent 514 sites of primary infection in vivo, and transfer virus to Kasumi-3 cells, where the virus 515 requires TPA for reactivation. These data further support our findings shown in Fig. 5, 516 whereby transfer of virus between Kasumi-3 cells and fibroblasts is necessitated by cell-517 to-cell contact. 518 519 Inflammatory cytokines reactivate IE gene expression in Kasumi-3 cells. Although 520 TPA is sufficient to induce lytic reactivation in our in vitro model system, phorbol esters 521


.org/D

ownloaded from

http://jvi.asm.org/

23

are not responsible for HCMV reactivation within a host. As tumor necrosis factor-alpha 522 (TNF-α) or interleukin-1 beta (IL-1β) promote reactivation of MCMV in vivo, we sought 523 to determine if these inflammatory cytokines are sufficient for inducing lytic viral gene 524 expression from the MIEP. The MIEP drives expression of both UL122 and UL123 viral 525 mRNAs (60) and activation of this promoter is considered the initial step in the switch 526 between a latent to a lytic infection (11). We observed that TNF-α or IL-1β treatment of 527 infected Kasumi-3 cells resulted in the induction of UL123 IE gene expression by 48 528 hours post-treatment where TNF-α treatment was more efficient at inducing viral 529 transcriptional activation (Fig. 9A). Although each of these inflammatory cytokines, as 530 well as the pharmacological agent TPA, are sufficient for inducing UL123 expression, it 531 is possible that the differentiation of these progenitor cells by these factors plays a role in 532 viral reactivation. This is not without precedent - ex vivo systems utilizing monocytes 533 display increased viral production as these cells differentiate down the myeloid pathway 534 following induction by specific growth factor treatments (16, 56-58). We therefore 535 assessed IE gene expression within the first 30 hours post-treatment with either TPA, 536 TNF-α, or IL-1β treatment and found that TNF-α induces the transcription of UL123 537 mRNA beginning as early as 2 hours post-treatment, whereas IL-1β induced UL123 538 expression does not increase until 30 hours post-treatment (Fig. 9B). The different 539 kinetics of promoter activation by TNF-α compared to IL-1β suggests that the 540 mechanisms of activation by these inflammatory cytokines may differ however each are 541 sufficient for activating HCMV transcription within our Kasumi-3 model system. 542 543 DISCUSSION 544


.org/D

ownloaded from

http://jvi.asm.org/

24

In the present study, we have established a novel in vitro system with which to 545 investigate HCMV latency. Our system utilizes a readily available clonal cell line termed 546 Kasumi-3 cells. We have shown that the Kasumi-3 cell line is capable of harboring a non-547 productive HCMV infection that can be reactivated to produce infectious viral progeny. 548 Importantly we have shown that HCMV-infected Kasumi-3 cells recapitulate the key 549 hallmarks of latency. These criteria include initial infection, minimal expression of viral 550 transcripts coupled with viral genome maintenance, reactivation due to stimuli resulting 551 in viral lytic transcription, and importantly the production of infectious viral progeny. 552 The development of this system serves as a significant vertical advancement to the field 553 of HCMV biology that will function as a powerful tool to complement current ex vivo 554 model systems. 555 556 This is the first description of a myeloid cell line that meets all of the criteria for 557 HCMV latency. To our knowledge, the only other cell line capable of full permissive 558 infection by HCMV is the human glioblastoma-astrocytoma cell line U373 MG cells (44), 559 which are no longer available from the ATCC as there are questions as to their 560 authenticity (21). Using the homogenous population of Kasumi-3 cells we were able to 561 infect over 11% of viable cells, which when cultured long-term, were capable of 562 maintaining the viral genome in an environment of repressed viral gene transcription. 563 Interestingly, when we treated these cells with the phorbol ester TPA to induce viral gene 564 expression, we found that several of the representative viral genes of the IE, E, and L 565 gene classes were transcribed in the temporal order observed during traditional lytic gene 566 expression. These findings suggest that TPA-reactivated HCMV in the Kasumi-3 system 567


.org/D

ownloaded from

http://jvi.asm.org/

25

results in lytic gene expression, consistent with that observed during de novo lytic 568 infection with HCMV in culture. Further strengthening our model is the finding that 569 Kasumi-3 cells infected with HCMV and subsequently treated with TPA are capable of 570 transferring virus to primary fibroblasts by a cell-to-cell contact mechanism. While we 571 observe robust transcriptional activation upon TPA treatment, production of infectious 572 virus is not as equally robust. The efficiency of virus assembly is often cell type specific 573 as one observes different particle to PFU ratios for HCMV depending on the source of 574 infected cell. However, we are able to detect a significant increase in the amount of viral 575 production upon TPA stimulation, a defining hallmark of herpesviral reactivation. Thus 576 this model system represents a significant advancement, as Kasumi-3 cells are a suitable 577 platform for use in investigations on the complete reactivation lifecycle of HCMV, a 578 prospect that was only available in ex vivo model systems. 579 580

In support of the idea that Kasumi-3 cells allow for the establishment of latency as 581 opposed to a smoldering, persistent infection, we removed lytically infected cells from 582 our population by the addition of PAA. In cells treated with this anti-viral factor we did 583 not see background expression from the MIEP. Upon treatment with TPA we observed a 584 significant activation of the MIEP in this population of cells, suggesting that latency was 585 established in the Kasumi-3 cells. If the Kasumi-3 cells were persistently infected, we 586 would not observe an increase in UL123 expression with TPA treatment, as these cells 587 would have been cleared from the population. Taken together, these experiments suggest 588 that Kasumi-3 cells establish a latent infection. 589

590


.org/D

ownloaded from

http://jvi.asm.org/

26

Additionally we have found that our Kasumi-3 model system is well suited for 591 monitoring mechanisms of viral transmission between cell lines important during in vivo 592 infections. While myeloid cells in vivo reactivate and transmit virus to other cell types 593 and can be infected with virus ex vivo, it is likely that cells of the endothelium and 594 epithelium come in contact and are infected first during a primary infection of the host 595 (6). We tested this mode of infection within our Kasumi-3 system by infecting 596 endothelial and epithelial cells, as well as fibroblasts and asking if these cell types could 597 transmit virus to naïve Kasumi-3 cells. We found that indeed this was the case and that 598 this transmission of virus required cell-to-cell contact. Additionally treatment with TPA 599 was required for viral replication within these cells. There is a possibility that infected, 600 non-adherent HUVECs, ARPE19s or HFFs could contribute to the source of viral DNA 601 we observed, however under visual inspection, the GFP-positive cells we analyzed were 602 consistent in size and shape with Kasumi-3 cells. These data suggest that HCMV favors a 603 latent infection in Kasumi-3 cells, whether the mode of infection is primary (i.e.: direct 604 infection of the Kasumi-3 cells with HCMV) or secondary (i.e.: viral transmission to the 605 Kasumi-3 cells from other cell types). 606 607 Immunologically stressed individuals who are latently infected with HCMV 608 undergo lytic reactivation of the virus, leading to a productive infection and subsequent 609 disease. Although the direct factors that impact reactivation of HCMV in vivo remain to 610 be elucidated, an increase in inflammatory cytokines due to immune stress have been 611 strongly implicated, at least in part, in HCMV reactivation. Evidence supporting this 612 comes from studies utilizing ex vivo hematopoietic cells from healthy, sero-positive 613


.org/D

ownloaded from

http://jvi.asm.org/

27

patients, where inflammatory cytokines function to impact HCMV reactivation (18, 19). 614 Additionally, in vitro systems that utilize latently infected THP-1 cells, for example, 615 respond to inflammatory cytokines by inducing IE gene expression (31). Strong evidence 616 for the involvement of inflammatory cytokines comes from the murine model for CMV 617 reactivation. Mice latently infected with murine cytomegalovirus (MCMV) undergo viral 618 reactivation following TNF-α or IL-1β treatment (9). Finally, in transgenic mice that 619 express a HCMV MIEP-driven reporter construct, the MIEP is transcriptionally activated 620 upon treatment with these cytokines either directly or by the addition of 621 lipopolysaccharides (19). When we evaluated the ability of either TNF-α or IL-1β to 622 induce HCMV IE gene expression in our model system, we discovered that both of these 623 inflammatory cytokines induced IE gene expression, although TNF-α caused a more 624 robust response compared to IL1-β. This difference reflects perhaps distinct pathways 625 influenced by these two inflammatory cytokines that in the end, independently induce 626 transcription of the IE genes. Alternatively our observations may be due to differential 627 cell surface expression of the receptors for these cytokines, a prospect we are actively 628 pursuing. It is enticing to speculate that perhaps HCMV uses two, independent yet 629 redundant mechanisms to ensure reactivation in its host. 630

631 To further characterize the differences observed in the cytokine treatment 632

protocols we monitored the timing of MIEP activation upon treatment. There have been 633 several studies that have described the production of infectious HCMV as latently 634 infected ex vivo cells are promoted to differentiate towards mature cells of the myeloid 635 lineage (12, 57, 61). We assessed IE gene activation within the first 30 hours following 636


.org/D

ownloaded from

http://jvi.asm.org/

28

inflammatory cytokine treatment to begin to distinguish whether the viral reactivation in 637 our system is due differentiation caused by the various treatments or due to activation of 638 specific biological factors (e.g.: transcription factor/signaling pathway activation). IE 639 gene expression due to TNF-α begins at least 2 hours post-treatment, whereas IL-1β 640 confers its effects after 24 hours of treatment. This suggests that at least TNF-α alone is 641 sufficient for at least “jump-starting” lytic replication. Additionally, this further supports 642 the possibility that each of these inflammatory cytokines functions through a distinct 643 mechanism to induce the IE genes. 644 645 The in vitro latency system we have described herein provides a critical resource 646 that will function to complement current ex vivo systems. Our novel Kasumi-3 model 647 system is well suited for high-throughput molecular techniques amenable for 648 identification of both cellular factors critical for reactivation as well as pharmacological 649 agents that inhibit viral reactivation. Additionally, the Kasumi-3 model for HCMV 650 latency affords one the ability to generate stable cell lines for analysis of targeted 651 manipulation of cellular and viral components to assess their role in viral reactivation. 652 Investigators can extrapolate and extend findings from the HCMV Kasumi-3 latency 653 model system into ex vivo systems. We favor the clonal Kasumi-3 model described herein 654 as a suitable in vitro model system to investigate key aspects of HCMV latency and 655 reactivation. 656 657 ACKNOWLEDGEMENTS 658


.org/D

ownloaded from

http://jvi.asm.org/

29

The authors would like to thank the Cleveland Clinic Flow Cytometry Core Facility for 659 their assistance with cell sorting, as well as Judy Drazba and John Peterson of the 660 Cleveland Clinic Image Core for their assistance with the immunofluorescence assays. 661 C.M.O’C. was supported by a Postdoctoral Fellowship, Award #119028-PF-10-164-01-662 MPC, from the American Cancer Society. 663 664 REFERENCES 665 666 1. Alain, S., M. C. Mazeron, J. M. Pepin, F. Morinet, L. Raskine, and M. J. 667

Sanson-Le Pors. 1993. Rapid detection of cytomegalovirus strains resistant 668 to ganciclovir through mutations within the gene UL97. Mol Cell Probes 669 7:487-495. 670 2. Andrews, P. W., I. Damjanov, D. Simon, G. S. Banting, C. Carlin, N. C. 671 Dracopoli, and J. Fogh. 1984. Pluripotent embryonal carcinoma clones 672 derived from the human teratocarcinoma cell line Tera-2. Differentiation in 673 vivo and in vitro. Lab Invest 50:147-162. 674 3. Asou, H., K. Suzukawa, K. Kita, K. Nakase, H. Ueda, K. Morishita, and N. 675 Kamada. 1996. Establishment of an undifferentiated leukemia cell line 676 (Kasumi-3) with t(3;7)(q27;q22) and activation of the EVI1 gene. Jpn J 677 Cancer Res 87:269-274. 678 4. Bego, M. G., L. R. Keyes, J. Maciejewski, and S. C. St Jeor. 2011. Human 679 cytomegalovirus latency-associated protein LUNA is expressed during HCMV 680 infections in vivo. Arch Virol 156:1847-1851. 681 5. Beisser, P. S., L. Laurent, J. L. Virelizier, and S. Michelson. 2001. Human 682 cytomegalovirus chemokine receptor gene US28 is transcribed in latently 683 infected THP-1 monocytes. J Virol 75:5949-5957. 684 6. Britt, W. 2008. Manifestations of human cytomegalovirus infection: 685 proposed mechanisms of acute and chronic disease. Curr Top Microbiol 686 Immunol 325:417-470. 687 7. Chan, G., E. R. Bivins-Smith, M. S. Smith, P. M. Smith, and A. D. Yurochko. 688 2008. Transcriptome analysis reveals human cytomegalovirus reprograms 689 monocyte differentiation toward an M1 macrophage. Journal of Immunology 690 181:698-711. 691 8. Cohrs, R. J., and D. H. Gilden. 2001. Human herpesvirus latency. Brain 692 Pathol 11:465-474. 693 9. Cook, C. H., J. Trgovcich, P. D. Zimmerman, Y. Zhang, and D. D. Sedmak. 694 2006. Lipopolysaccharide, tumor necrosis factor alpha, or interleukin-1beta 695


.org/D

ownloaded from

http://jvi.asm.org/

30

triggers reactivation of latent cytomegalovirus in immunocompetent mice. J 696 Virol 80:9151-9158. 697 10. Delannoy, A. S., D. Hober, A. Bouzidi, and P. Wattre. 1997. A macrophage-698 like cell model for testing anti-CMV drugs. Pathol Biol (Paris) 45:394-399. 699 11. Dosa, R., K. Burian, and E. Gonczol. 2005. Human cytomegalovirus latency 700 is associated with the state of differentiation of the host cells: an in vitro 701 model in teratocarcinoma cells. Acta Microbiol Immunol Hung 52:397-406. 702 12. Goodrum, F., C. T. Jordan, S. S. Terhune, K. High, and T. Shenk. 2004. 703 Differential outcomes of human cytomegalovirus infection in primitive 704 hematopoietic cell subpopulations. Blood 104:687-695. 705 13. Goodrum, F., M. Reeves, J. Sinclair, K. High, and T. Shenk. 2007. Human 706 cytomegalovirus sequences expressed in latently infected individuals 707 promote a latent infection in vitro. Blood 110:937-945. 708 14. Goodrum, F. D., C. T. Jordan, K. High, and T. Shenk. 2002. Human 709 cytomegalovirus gene expression during infection of primary hematopoietic 710 progenitor cells: a model for latency. Proc Natl Acad Sci U S A 99:16255-711 16260. 712 15. Hahn, G., R. Jores, and E. S. Mocarski. 1998. Cytomegalovirus remains 713 latent in a common precursor of dendritic and myeloid cells. Proc Natl Acad 714 Sci U S A 95:3937-3942. 715 16. Hargett, D., and T. E. Shenk. 2010. Experimental human cytomegalovirus 716 latency in CD14+ monocytes. Proc Natl Acad Sci U S A 107:20039-20044. 717 17. Hu, Y., and G. K. Smyth. 2009. ELDA: extreme limiting dilution analysis for 718 comparing depleted and enriched populations in stem cell and other assays. J 719 Immunol Methods 347:70-78. 720 18. Hummel, M., and M. M. Abecassis. 2002. A model for reactivation of CMV 721 from latency. J Clin Virol 25 Suppl 2:S123-136. 722 19. Hummel, M., Z. Zhang, S. Yan, I. DePlaen, P. Golia, T. Varghese, G. Thomas, 723 and M. I. Abecassis. 2001. Allogeneic transplantation induces expression of 724 cytomegalovirus immediate-early genes in vivo: a model for reactivation 725 from latency. J Virol 75:4814-4822. 726 20. Ioudinkova, E., M. C. Arcangeletti, A. Rynditch, F. De Conto, F. Motta, S. 727 Covan, F. Pinardi, S. V. Razin, and C. Chezzi. 2006. Control of human 728 cytomegalovirus gene expression by differential histone modifications during 729 lytic and latent infection of a monocytic cell line. Gene 384:120-128. 730 21. Ishii, N., D. Maier, A. Merlo, M. Tada, Y. Sawamura, A. C. Diserens, and E. 731 G. Van Meir. 1999. Frequent co-alterations of TP53, p16/CDKN2A, p14ARF, 732 PTEN tumor suppressor genes in human glioma cell lines. Brain pathology 733 9:469-479. 734 22. Jarvis, M. A., and J. A. Nelson. 2007. Human cytomegalovirus tropism for 735 endothelial cells: not all endothelial cells are created equal. J Virol 81:2095-736 2101. 737 23. Jarvis, M. A., and J. A. Nelson. 2007. Molecular basis of persistence and 738 latency. In A. Arvin, Campadelli-Fiume, G., Mocarski E., Moore, P.S., Roizman, 739 B., Whitley, R., Yamanishi, K. (ed.), Human Herpesviruses: Biology, Therapy, 740 and Immunoprophylaxis. Cambridge University Press, Cambridge. 741


.org/D

ownloaded from

http://jvi.asm.org/

31

24. Jenkins, C., A. Abendroth, and B. Slobedman. 2004. A novel viral transcript 742 with homology to human interleukin-10 is expressed during latent human 743 cytomegalovirus infection. J Virol 78:1440-1447. 744 25. Keller, M. J., A. W. Wu, J. I. Andrews, P. W. McGonagill, E. E. Tibesar, and J. 745 L. Meier. 2007. Reversal of human cytomegalovirus major immediate-early 746 enhancer/promoter silencing in quiescently infected cells via the cyclic AMP 747 signaling pathway. J Virol 81:6669-6681. 748 26. Khaiboullina, S. F., J. P. Maciejewski, K. Crapnell, P. A. Spallone, A. Dean 749 Stock, G. S. Pari, E. D. Zanjani, and S. S. Jeor. 2004. Human cytomegalovirus 750 persists in myeloid progenitors and is passed to the myeloid progeny in a 751 latent form. Br J Haematol 126:410-417. 752 27. Khan, K. A., A. Coaquette, C. Davrinche, and G. Herbein. 2009. Bcl-3-753 regulated transcription from major immediate-early promoter of human 754 cytomegalovirus in monocyte-derived macrophages. Journal of Immunology 755 182:7784-7794. 756 28. Kondo, K., H. Kaneshima, and E. S. Mocarski. 1994. Human 757 cytomegalovirus latent infection of granulocyte-macrophage progenitors. 758 Proc Natl Acad Sci U S A 91:11879-11883. 759 29. Kondo, K., and E. S. Mocarski. 1995. Cytomegalovirus latency and latency-760 specific transcription in hematopoietic progenitors. Scand J Infect Dis Suppl 761 99:63-67. 762 30. Lashmit, P. E., M. F. Stinski, E. A. Murphy, and G. C. Bullock. 1998. A cis 763 repression sequence adjacent to the transcription start site of the human 764 cytomegalovirus US3 gene is required to down regulate gene expression at 765 early and late times after infection. J Virol 72:9575-9584. 766 31. Lee, C. H., G. C. Lee, Y. J. Chan, C. J. Chiou, J. H. Ahn, and G. S. Hayward. 767 1999. Factors affecting human cytomegalovirus gene expression in human 768 monocyte cell lines. Molecules and Cells 9:37-44. 769 32. Maciejewski, J. P., E. E. Bruening, R. E. Donahue, E. S. Mocarski, N. S. 770 Young, and S. C. St Jeor. 1992. Infection of hematopoietic progenitor cells by 771 human cytomegalovirus. Blood 80:170-178. 772 33. McCormick, A. L., L. Roback, D. Livingston-Rosanoff, and C. St Clair. 2010. 773 The human cytomegalovirus UL36 gene controls caspase-dependent and -774 independent cell death programs activated by infection of monocytes 775 differentiating to macrophages. J Virol 84:5108-5123. 776 34. Meier, J. L. 2001. Reactivation of the human cytomegalovirus major 777 immediate-early regulatory region and viral replication in embryonal NTera2 778 cells: role of trichostatin A, retinoic acid, and deletion of the 21-base-pair 779 repeats and modulator. J Virol 75:1581-1593. 780 35. Meyer-Konig, U., F. T. Hufert, and D. M. von Laer. 1997. Infection of blood 781 and bone marrow cells with the human cytomegalovirus in vivo. Leuk 782 Lymphoma 25:445-454. 783 36. Miller, G., L. Heston, E. Grogan, L. Gradoville, M. Rigsby, R. Sun, D. Shedd, 784 V. M. Kushnaryov, S. Grossberg, and Y. Chang. 1997. Selective switch 785 between latency and lytic replication of Kaposi's sarcoma herpesvirus and 786


.org/D

ownloaded from

http://jvi.asm.org/

32

Epstein-Barr virus in dually infected body cavity lymphoma cells. J Virol 787 71:314-324. 788 37. Nucifora, G., L. Laricchia-Robbio, and V. Senyuk. 2006. EVI1 and 789 hematopoietic disorders: history and perspectives. Gene 368:1-11. 790 38. O'Connor, C. M., and T. Shenk. Under review. Human Cytomegalovirus 791 pUL78 G protein-coupled receptor homologue is required for timely nuclear 792 accumulation of virion constituents in epithelial cells by not fibroblsts. J Virol. 793 39. O'Connor, C. M., and T. Shenk. 2011. Human cytomegalovirus pUS27 G 794 protein-coupled receptor homologue is required for efficient spread by the 795 extracellular route but not for direct cell-to-cell spread. J Virol 85:3700-3707. 796 40. Prosch, S., W. D. Docke, P. Reinke, H. D. Volk, and D. H. Kruger. 1999. 797 Human cytomegalovirus reactivation in bone-marrow-derived 798 granulocyte/monocyte progenitor cells and mature monocytes. Intervirology 799 42:308-313. 800 41. Reeves, M., D. Woodhall, T. Compton, and J. Sinclair. 2010. Human 801 cytomegalovirus IE72 protein interacts with the transcriptional repressor 802 hDaxx to regulate LUNA gene expression during lytic infection. J Virol 803 84:7185-7194. 804 42. Reeves, M. B., P. J. Lehner, J. G. Sissons, and J. H. Sinclair. 2005. An in vitro 805 model for the regulation of human cytomegalovirus latency and reactivation 806 in dendritic cells by chromatin remodelling. J Gen Virol 86:2949-2954. 807 43. Reeves, M. B., and J. H. Sinclair. 2010. Analysis of latent viral gene 808 expression in natural and experimental latency models of human 809 cytomegalovirus and its correlation with histone modifications at a latent 810 promoter. Journal of General Virology 91:599-604. 811 44. Reis, B., E. Bogner, M. Reschke, A. Richter, T. Mockenhaupt, and K. 812 Radsak. 1993. Stable constitutive expression of glycoprotein B (gpUL55) of 813 human cytomegalovirus in permissive astrocytoma cells. J Gen Virol 74 ( Pt 814 7):1371-1379. 815 45. Sacher, T., C. A. Mohr, A. Weyn, C. Schlichting, U. H. Koszinowski, and Z. 816 Ruzsics. 2012. The role of cell types in cytomegalovirus infection in vivo. Eur 817 J Cell Biol 91:70-77. 818 46. Sanchez, V., and J. J. Dong. 2010. Alteration of lipid metabolism in cells 819 infected with human cytomegalovirus. Virology. 820 47. Sarid, R., O. Flore, R. A. Bohenzky, Y. Chang, and P. S. Moore. 1998. 821 Transcription mapping of the Kaposi's sarcoma-associated herpesvirus 822 (human herpesvirus 8) genome in a body cavity-based lymphoma cell line 823 (BC-1). J Virol 72:1005-1012. 824 48. Silva, M. C., Q. C. Yu, L. Enquist, and T. Shenk. 2003. Human 825 cytomegalovirus UL99-encoded pp28 is required for the cytoplasmic 826 envelopment of tegument-associated capsids. J Virol 77:10594-10605. 827 49. Sing, G. K., and F. W. Ruscetti. 1995. The role of human cytomegalovirus in 828 haematological diseases. Baillieres Clin Haematol 8:149-163. 829 50. Sinzger, C., M. Digel, and G. Jahn. 2008. Cytomegalovirus cell tropism. Curr 830 Top Microbiol Immunol 325:63-83. 831


.org/D

ownloaded from

http://jvi.asm.org/

33

51. Sinzger, C., K. Eberhardt, Y. Cavignac, C. Weinstock, T. Kessler, G. Jahn, 832 and J. L. Davignon. 2006. Macrophage cultures are susceptible to lytic 833 productive infection by endothelial-cell-propagated human cytomegalovirus 834 strains and present viral IE1 protein to CD4+ T cells despite late 835 downregulation of MHC class II molecules. Journal of General Virology 836 87:1853-1862. 837 52. Sinzger, C., G. Hahn, M. Digel, R. Katona, K. L. Sampaio, M. Messerle, H. 838 Hengel, U. Koszinowski, W. Brune, and B. Adler. 2008. Cloning and 839 sequencing of a highly productive, endotheliotropic virus strain derived from 840 human cytomegalovirus TB40/E. Journal of General Virology 89:359-368. 841 53. Slobedman, B., and A. K. Cheung. 2008. Microarrays for the study of viral 842 gene expression during human cytomegalovirus latent infection. Methods 843 Mol Med 141:153-175. 844 54. Slobedman, B., and E. S. Mocarski. 1999. Quantitative analysis of latent 845 human cytomegalovirus. J Virol 73:4806-4812. 846 55. Smith, M. S., G. L. Bentz, J. S. Alexander, and A. D. Yurochko. 2004. Human 847 cytomegalovirus induces monocyte differentiation and migration as a 848 strategy for dissemination and persistence. J Virol 78:4444-4453. 849 56. Soderberg-Naucler, C., K. N. Fish, and J. A. Nelson. 1997. Reactivation of 850 latent human cytomegalovirus by allogeneic stimulation of blood cells from 851 healthy donors. Cell 91:119-126. 852 57. Soderberg-Naucler, C., D. N. Streblow, K. N. Fish, J. Allan-Yorke, P. P. 853 Smith, and J. A. Nelson. 2001. Reactivation of latent human cytomegalovirus 854 in CD14(+) monocytes is differentiation dependent. J Virol 75:7543-7554. 855 58. Stein, J., H. D. Volk, C. Liebenthal, D. H. Kruger, and S. Prosch. 1993. 856 Tumour necrosis factor alpha stimulates the activity of the human 857 cytomegalovirus major immediate early enhancer/promoter in immature 858 monocytic cells. Journal of General Virology 74 ( Pt 11):2333-2338. 859 59. Stern, J. L., and B. Slobedman. 2008. Human cytomegalovirus latent 860 infection of myeloid cells directs monocyte migration by up-regulating 861 monocyte chemotactic protein-1. Journal of Immunology 180:6577-6585. 862 60. Stinski, M. F., D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein. 1983. 863 Organization and expression of the immediate early genes of human 864 cytomegalovirus. J Virol 46:1-14. 865 61. Taylor-Wiedeman, J., P. Sissons, and J. Sinclair. 1994. Induction of 866 endogenous human cytomegalovirus gene expression after differentiation of 867 monocytes from healthy carriers. J Virol 68:1597-1604. 868 62. Terhune, S., E. Torigoi, N. Moorman, M. Silva, Z. Qian, T. Shenk, and D. Yu. 869 2007. Human cytomegalovirus UL38 protein blocks apoptosis. J Virol 870 81:3109-3123. 871 63. Turtinen, L. W., and B. J. Seufzer. 1994. Selective permissiveness of TPA 872 differentiated THP-1 myelomonocytic cells for human cytomegalovirus 873 strains AD169 and Towne. Microb Pathog 16:373-378. 874 64. Warming, S., N. Costantino, D. L. Court, N. A. Jenkins, and N. G. Copeland. 875 2005. Simple and highly efficient BAC recombineering using galK selection. 876 Nucleic Acids Res 33:e36. 877


.org/D

ownloaded from

http://jvi.asm.org/

34

65. Weinshenker, B. G., S. Wilton, and G. P. Rice. 1988. Phorbol ester-induced 878 differentiation permits productive human cytomegalovirus infection in a 879 monocytic cell line. Journal of Immunology 140:1625-1631. 880 66. Yee, L. F., P. L. Lin, and M. F. Stinski. 2007. Ectopic expression of HCMV 881 IE72 and IE86 proteins is sufficient to induce early gene expression but not 882 production of infectious virus in undifferentiated promonocytic THP-1 cells. 883 Virology 363:174-188. 884 67. Yu, D., G. A. Smith, L. W. Enquist, and T. Shenk. 2002. Construction of a 885 self-excisable bacterial artificial chromosome containing the human 886 cytomegalovirus genome and mutagenesis of the diploid TRL/IRL13 gene. J 887 Virol 76:2316-2328. 888 68. Yurochko, A. D., and E. S. Huang. 1999. Human cytomegalovirus binding to 889 human monocytes induces immunoregulatory gene expression. Journal of 890 Immunology 162:4806-4816. 891 69. Zaia, J. A. 1990. Epidemiology and pathogenesis of cytomegalovirus disease. 892 Semin Hematol 27:5-10; discussion 28-19. 893 70. Zydek, M., C. Hagemeier, and L. Wiebusch. 2010. Cyclin-dependent kinase 894 activity controls the onset of the HCMV lytic cycle. Plos Pathogens 6. 895 896 897 898


.org/D

ownloaded from

http://jvi.asm.org/

35

FIGURE LEGENDS 899 900 Fig. 1. HCMV infection of Kasumi-3 cells results in approximately 11% infectivity 901 rate. Kasumi-3 cells were (A) mock or (B) HCMV infected with TB40/E-wtGFP at an 902 moi of 10 pfu/cell. Infected cells were gated first on viability and then gated for eGFP 903 expression. 904 905 Fig. 2. HCMV infected Kasumi-3 cells maintain viral genomes with restricted viral 906 gene expression. Viral RNA (gray bars) and viral DNA (white bars) were assayed over 907 the indicated times for UL123. RNA transcripts were normalized to cellular GAPDH and 908 DNA was normalized to cellular MDM2. Each sample was performed in triplicate. AU, 909 arbitrary units. 910 911 Fig. 3. Repression of HCMV transcripts is released by TPA treatment. Kasumi-3 912 cells were infected with TB40/E-wtGFP in the presence or absence of TPA. RNA was 913 harvested at the indicated time points, and representative transcripts from each class of 914 viral gene expression were assessed. UL123 and UL122 (IE, top panel), UL44 and 915 UL54 (E, middle panel), and UL99 and UL83 (L, bottom panel) transcripts were 916 increased with the addition of TPA to the infected cultures. Each sample was performed 917 in triplicate and normalized to cellular GAPDH. AU, arbitrary units. 918 919 Fig. 4. The latent transcript LUNA is expressed while UL123 transcription is 920 repressed, which is reversed with the addition of TPA. Infected Kasumi-3 cells were 921


.org/D

ownloaded from

http://jvi.asm.org/

36

sorted 2 dpi, and cultured for an additional 18 d, at which point cells were cultured for an 922 additional 2 d with or without TPA. Cells were then harvested and total RNA was 923 collected. LUNA-specific primers were used in the RT reaction to subsequently quantify 924 the LUNA transcript. To quantify UL123, total cDNA was reverse transcribed using 925 random hexamers. Each sample was analyzed in triplicate. AU, arbitrary units. 926 927 Fig. 5. TPA-induced reactivation of HCMV-infected Kasumi-3 cells results in the 928 production of infectious viral particles. (A) Extracellular viral production of HCMV-929 infected Kasumi-3 cells is increased with TPA treatment. Cell-free viral particles were 930 harvested from TB40/E-wtGFP infected cells cultured in the presence or absence of TPA. 931 Encapsidated viral DNA was assessed by qPCR using primers directed at UL123. (B-C) 932 To determine if the viral particles were infectious, infected Kasumi-3 cells were cultured 933 in the presence or absence of TPA for 6 d, after which the cells were washed with PBS 934 and co-cultured with HFFs for 2 d. Kasumi-3 cells were then removed from the co-935 cultures, the HFFs were washed twice with PBS, and the HFFs were cultured for an 936 additional 4 d. (B) Fluorescence microscopy reveals eGFP positive plaques in the HFF 937 monolayer co-cultured with TPA-reactivated Kasumi-3 infected cells. (C) HFF-938 associated DNA was assayed for viral genomes using primers directed at UL44. Each 939 sample was normalized to cellular MDM2 and assessed in triplicate. AU, arbitrary units. 940 941 Fig. 6. Frequency of reactivation in infected Kasumi-3 cultures in the presence and 942 absence of TPA. Limiting dilution (ELDA) using fibroblasts reveals 131 infected 943 Kasumi-3 cells treated with TPA are required for 1 plaque, compared to untreated 944


.org/D

ownloaded from

http://jvi.asm.org/

37

infected cells, which require 349 cells to generate 1 plaque (p-value < 0.0005). Black 945 lines denote cultures treated with TPA; gray lines denote cultures not treated with TPA. 946 Solid lines represent the trend line estimating the active cell frequency. Dashed lines 947 represent the 90% confidence interval. Circles symbolize data points of the log 948 proportion of negative cultures. Upside-down triangles symbolize data with zero negative 949 response. 950 951 Fig. 7. PAA treatment of infected Kasumi-3 cells limits spontaneous reactivation of 952 HCMV. (A) Infected Kasumi-3 cells were sorted 2 dpi, cultured for 18 d, at which time 953 the cells were cultured for an additional 2 d in the presence or absence of TPA. Cells 954 were then harvested for IFA using an antibody to the late protein, pUL99, as well as 955 DAPI. (B) Infected Kasumi-3 cells that did not receive TPA treatment show a 956 significantly less number of pUL99 positive cells when compared to those that received 957 TPA (p-value < 0.05). Additionally, the fluorescent intensity of pUL99 observed in the 958 infected cells that were not treated with TPA did not vary between the infected cultures 959 treated with TPA (A). (C) Kasumi-3 cells were infected and sorted as above, and then 960 cultured for 18 d in the presence or absence of PAA. These cells were then cultured for 961 an additional 2 d in the presence or absence of TPA. Total RNA was harvested and 962 quantified by RT-qPCR for UL123 expression. Each sample was normalized to cellular 963 GAPDH, and analyzed in triplicate. AU, arbitrary units. 964 965 Fig. 8. Cell-to-cell contact is required for infected endothelial, epithelial and 966 fibroblasts to transfer virus to Kasumi-3 cells. Primary (A) HUVECs (endothelial 967


.org/D

ownloaded from

http://jvi.asm.org/

38

cells) (B) ARPE19s (epithelial cells) or (C) HFFs (fibroblasts) were infected and then co-968 cultured with Kasumi-3 cells for 5 d. Kasumi-3 cells were removed from the co-culture, 969 and cultured in the presence or absence of TPA for 2 d. Kasumi-3 cell-associated DNA 970 was harvested to quantify viral genomes by qPCR using primers recognizing UL99. 971 Samples were normalized to cellular MDM2 and analyzed in triplicate. AU, arbitrary 972 units. 973 974 Fig. 9. Inflammatory cytokines increase HCMV IE transcription. (A) Either TNF-α 975 or IL-1β treatment induces UL123 gene expression in infected Kasumi-3 cells. Cells were 976 treated with either cytokine for 48 h, after which cells were harvested for RT-qPCR for 977 UL123. (B) TNF-α induced IE gene expression as soon as 2 h post-treatment. Infected 978 Kasumi-3 cells (10 dpi) were treated with TNF-α, IL-1β, or TPA for the indicated times. 979 Cells were collected for RT-qPCR for UL123. In all cases, samples were analyzed in 980 triplicate with primers towards UL123. Each sample was normalized to cellular GAPDH 981 and then normalized to the NT control. NT, no treat; AU, arbitrary units. 982 983 984 985


.org/D

ownloaded from

http://jvi.asm.org/


.org/D

ownloaded from

http://jvi.asm.org/

jvi accepts, published online ahead of print on 3 july...

Documents