1

RESEARCH ARTICLE

Kalanchoë PPC1 is Essential for Crassulacean Acid Metabolism and the Regulation of Core Circadian Clock and Guard Cell Signaling Genes

Susanna F. Boxall, Nirja Kadu, Louisa V. Dever, Jana Kneřová, Jade L. Waller,Peter J. D. Gould and James Hartwella

Department of Functional and Comparative Genomics, Institute of Integrative Biology, Crown Street, University of Liverpool, Liverpool L69 7ZB, UK. aCorresponding Author: james.hartwell@liverpool.ac.uk

Short Title: Silencing PPC1 in an obligate CAM plant

One-sentence Summary: Silencing phosphoenolpyruvate carboxylase in a Crassulacean acid metabolism species prevented nocturnal CO2 fixation and malate accumulation and perturbed the circadian clock and guard cell signalling.

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantcell.org) is: James Hartwell (james.hartwell@liverpool.ac.uk).

ABSTRACT

Unlike C3 plants, Crassulacean acid metabolism (CAM) plants fix CO2 in the dark using phosphoenolpyruvate (PEP) carboxylase (PPC; EC 4.1.1.31). PPC combines PEP with CO2 (as HCO3

-), forming oxaloacetate. The oxaloacetate is converted to malate, leading to malic acid accumulation in the vacuole, which peaks at dawn. During the light period, malate decarboxylation concentrates CO2 around RuBisCO for secondary fixation. CAM mutants lacking PPC have not been described. Here, we employed RNAi to silence the CAM isogene PPC1 in Kalanchoë laxiflora. Line rPPC1-B lacked PPC1 transcripts, PPC activity, dark period CO2 fixation, and nocturnal malate accumulation. Light period stomatal closure was also perturbed, and the plants displayed reduced but detectable dark period stomatal conductance and arrhythmia of the CAM CO2 fixation circadian rhythm under constant light and temperature free-running conditions. By contrast, the rhythm of delayed fluorescence was enhanced in plants lacking PPC1. Furthermore, a subset of gene transcripts within the central circadian oscillator were upregulated and oscillated robustly in this line. The regulation of guard cell genes involved in controlling stomatal movements was also perturbed in rPPC1-B. These findings provide direct evidence that the regulatory patterns of key guard cell signaling genes are linked with the characteristic inverse pattern of stomatal opening and closing during CAM.

INTRODUCTION1 2

Crassulacean acid metabolism (CAM) is a pathway of photosynthetic CO2 fixation 3

found in species adapted to low rainfall and/or periodic drought, such as the 4

Plant Cell Advance Publication. Published on February 12, 2020, doi:10.1105/tpc.19.00481

©2020 The author(s).

2

Madagascan-endemic succulent, Kalanchoë laxiflora Baker (Family: Crassulaceae; 5

Order: Saxifragales) (Hartwell et al., 2016). CAM species open their stomata for 6

primary atmospheric CO2 fixation in the dark, when their environment is cooler and 7

more humid, and close their stomata in the light, when the atmosphere is at its 8

hottest and driest (Osmond, 1978). The increased water use efficiency (WUE) and 9

CO2 fixation efficiency of CAM species have led to the proposal that the use of 10

productive CAM crop species, including certain Agave and Opuntia species, 11

represents a viable approach to generating biomass for biofuels and renewable 12

platform chemicals for industry through their cultivation on seasonally-dry lands that 13

are not well-suited to food crop production (Borland et al., 2009; Cushman et al., 14

2015). Furthermore, efforts are underway to engineer CAM into key C3 crops 15

(Borland et al., 2014; DePaoli et al., 2014; Borland et al., 2015; Lim et al., 2019). 16

Recently, genome, transcriptome, proteome, and metabolome datasets for a 17

phylogenetically diverse range of CAM plants of independent origin have started to 18

open up a large catalogue of putative CAM genes. CAM species represented by 19

published ‘omics datasets span orchids (Phalaenopsis equestris and Erycina pusilla, 20

Orchidaceae, monocots), pineapple (Ananas comosus, Bromeliaceae, monocots), 21

Agave (A. americana, A. deserti, A. tequilana, Agavaceae, monocots), Yucca (Y. 22

aloifolia, Asparagaceae, monocots), Kalanchoë (K. fedtschenkoi and K. laxiflora, 23

Crassulaceae, eudicots), Mesembryanthemum (M. crystallinum, Aizoaceae, 24

eudicots), and waterleaf ( T. triangulare, Portulacaceae, eudicots) (Cushman et al., 25

2008; Gross et al., 2013; Cai et al., 2015; Ming et al., 2015; Abraham et al., 2016; 26

Brilhaus et al., 2016; Hartwell et al., 2016; Yang et al., 2017; Heyduk et al., 2018; 27

Heyduk et al., 2019). The optimal exploitation of CAM will be facilitated through 28

decoding the molecular-genetic blueprint for CAM from these genomes and 29

transcriptomes. In turn, to be fully realised, this opportunity requires functional 30

genomics approaches using transgenic and/or mutant lines of model CAM species to 31

test and define in detail candidate CAM gene functions (Dever et al., 2015; Hartwell 32

et al., 2016; Boxall et al., 2017). 33

During CAM, primary nocturnal CO2 assimilation is catalyzed by 34

phosphoenolpyruvate (PEP) carboxylase (PPC), generating oxaloacetate, which is 35

rapidly converted to malate and stored in the vacuole as malic acid (Borland et al., 36

2009). At dawn, malic acid is transported out of the vacuole and malate is 37

decarboxylated in the mitochondria, chloroplasts and/or cytosol, and the released 38

3

CO2 is re-fixed by RuBisCO behind closed stomata (Borland et al., 2009). Strict 39

temporal control prevents a futile cycle between the enzymes and metabolite 40

transporters driving malate production in the dark and those driving malate 41

decarboxylation in the light (Hartwell, 2006). PPC regulation is central to this 42

temporal control. PPC is activated allosterically by glucose 6-phosphate (G6P) and 43

inhibited by malate, aspartate and glutamate (O’Leary et al., 2011). The circadian 44

clock optimizes the timing of the CAM carboxylation and decarboxylation pathways 45

to prevent futile cycling (Wilkins, 1992; Hartwell, 2005). 46

Temporal optimization of PPC involves protein phosphorylation in the dark 47

period, a process catalysed by the circadian clock-controlled protein kinase, 48

phosphoenolpyruvate carboxylase kinase (PPCK) (Carter et al., 1991; Hartwell et al., 49

1996; Hartwell et al., 1999; Taybi et al., 2000; Boxall et al., 2005). Phosphorylated 50

PPC is less sensitive to feedback inhibition by malate, which in turn ensures 51

sustained CO2 fixation as malic acid accumulates throughout the dark period 52

(Nimmo et al., 1984; Carter et al., 1991; Boxall et al., 2017). In the light, PPC 53

becomes more sensitive to inhibition by malate due to dephosphorylation by a 54

protein phosphatase type 2A (PP2A), which is not known to be subject to circadian 55

control (Carter et al., 1990). 56

In CAM species such as Kalanchoë, the PEP substrate required for nocturnal 57

atmospheric CO2 fixation by PPC is generated through starch breakdown and 58

glycolysis (Borland et al., 2016). In the C3 model species Arabidopsis thaliana, 59

nocturnal degradation of leaf starch begins with the phosphorylation of glucan chains 60

by GLUCAN WATER DIKINASE (GWD) and PHOSPHOGLUCAN WATER 61

DIKINASE (PWD) (Ritte et al., 2006). The phosphorylated glucan chains are then 62

further degraded by ALPHA-AMYLASES (AMYs) and BETA-AMYLASES (BAMs) to 63

maltose and glucose. Nocturnal starch hydrolysis by BAMs is the predominant 64

pathway in C3 leaves, with chloroplastic BAM3 being the major BAM isozyme driving 65

nocturnal starch degradation in photosynthetic leaf mesophyll cells of Arabidopsis 66

(Fulton et al., 2008). BAM1, BAM2 and BAM5-9 are not required for nocturnal starch 67

degradation in Arabidopsis leaf mesophyll cells (Santelia and Lunn, 2017). Maltose 68

and glucose are exported from chloroplasts by MALTOSE EXCESS1 (MEX1) and 69

PLASTIDIC GLUCOSE TRANSPORTER (pGlcT), respectively, with MEX1 being the 70

predominant C3 route for carbon export (Smith et al., 2005). In the facultative CAM 71

4

species M. crystallinum, chloroplasts possess transporters for triose phosphate 72

(TPT), G6P (GPT), glucose (pGlcT) and maltose (MEX1) (Neuhaus and Schulte, 73

1996; Kore-eda et al., 2005; Kore-eda et al., 2013). Chloroplasts from C3 leaves of 74

M. crystallinum exported maltose during starch degradation, whereas chloroplasts 75

isolated from CAM-induced leaves predominantly exported G6P, supporting the 76

proposal that starch is broken down via plastidic starch phosphorylase (PHS1) 77

during nocturnal CO2 fixation (Neuhaus and Schulte, 1996). 78

A further defining characteristic of CAM relates to nocturnal stomatal opening 79

and CO2 uptake, and light period stomatal closure during malate decarboxylation 80

and peak internal CO2 supply (Males and Griffiths, 2017). Stomatal control in CAM 81

species is the inverse of the stomatal regulation observed in C3 species (Borland et 82

al., 2014). The opening and closing of stomata are driven by the turgor of the guard 83

cell (GC) pair that surrounds the stomatal pore. High turgor drives stomatal opening, 84

and a reduction in turgor leads to stomatal closure. The increase in turgor during 85

opening is driven by the accumulation of K+, Cl- and malate2- ions plus sugars in the 86

GCs (Jezek and Blatt, 2017). The closure of stomata is driven by a reversal of GC 87

ion channels and metabolism, with K+ and Cl- being transported out, and metabolites 88

being turned over within the GCs. Stomatal aperture responds to changing light, 89

CO2, abscisic acid (ABA), solutes and water availability (Kim et al., 2010; Daloso et 90

al., 2016; Horrer et al., 2016; Zhang et al., 2018; Yoshida et al., 2019). 91

In addition to its role in CAM and C4 plants, PPC performs an anapleurotic 92

function by replenishing tricarboxylic acid cycle intermediates utilized for amino acid 93

biosynthesis (Chollet et al., 1996). PPC also functions in the formation of malate as a 94

counter anion for light period opening in C3 GCs and supports nitrogen fixation into 95

amino acids in legume root nodules (Chollet et al., 1996). The major leaf PPCs in 96

Arabidopsis, which are encoded by PPC1 (AT1G53310) and PPC2 (AT2G42600), 97

are crucial for leaf carbon and nitrogen metabolism (Shi et al., 2015). Compared to 98

the wild type, the double ppc1 ppc2 null mutant accumulates less starch and sucrose 99

and has reduced malate, citrate, and ammonium assimilation; these metabolic 100

changes lead to a severe, growth-arrested phenotype (Shi et al., 2015). 101

Although PPC catalyses primary CO2 fixation in CAM and C4 plants, the only 102

reported PPC mutants are for the C4 eudicot grain amaranth (Amaranthus edulis) 103

and the C4 monocot green foxtail (Setaria viridis) (Dever et al., 1995; Alonso-104

Cantabrana et al., 2018). C4 PPC catalyzes light period primary CO2 fixation in 105

5

mesophyll cells, generating malate or aspartate, which is shuttled to bundle sheath 106

cells for decarboxylation (von Caemmerer and Furbank, 2003). This leads to the 107

concentration of CO2 around RuBisCO, which is only present in bundle sheath cells. 108

Photorespiration is thus minimised. The loss of the C4 PPC isogene in A. edulis 109

caused a severe and lethal growth phenotype in normal air, with the homozygous 110

mutant plants only managing to reach flowering and set seed when grown at highly 111

elevated CO2 (Dever et al., 1995). In S. viridis, the C4 PPC expression was reduced 112

to very low levels using RNAi in transgenic lines (Alonso-Cantabrana et al., 2018). 113

These lines grew very slowly even at 2% CO2 (normal air is 0.04%) and developed 114

increased numbers of plasmodesmatal pit fields at the mesophyll-bundle sheath 115

interface (Alonso-Cantabrana et al., 2018). By contrast, no CAM mutants lacking 116

PPC have been described, but transgenic lines of Kalanchoë lacking the light-period, 117

decarboxylation pathway enzymes mitochondrial NAD-malic enzyme (NAD-ME) and 118

pyruvate orthophosphate dikinase (PPDK) displayed a near complete loss of dark 119

CO2 fixation and failed to turnover significant malate during the light period (Dever et 120

al., 2015). In Kalanchoë, NAD-ME catalyses the conversion of malate to pyruvate 121

and CO2 during the light period, and PPDK converts the pyruvate to PEP, allowing 122

subsequent recycling of the by-product of malate decarboxylation through 123

gluconeogenesis to stored starch (Dever et al., 2015). Another CAM mutant lacking 124

the starch synthesis pathway enzyme plastidic phosphoglucomutase has been 125

reported in the inducible CAM species M. crystallinum (Cushman et al., 2008). 126

In addition, the CAM-associated PPCK1 gene in Kalanchoë was silenced 127

using RNAi, which not only led to a reduction in dark period CO2 fixation, but also 128

perturbed the operation of the central circadian clock (Boxall et al., 2017). However, 129

even the strongest PPCK1 RNAi line was still able to achieve ~33% of the dark 130

period CO2 fixation observed in the wild type (Boxall et al., 2017). These findings led 131

us here to develop transgenic K. laxiflora lines in which the CAM-associated isogene 132

of PPC itself (isogene PPC1) was downregulated using RNAi. The most strongly 133

silenced line, rPPC1-B, lacked PPC1 transcripts and activity, and this resulted in the 134

complete loss of dark CO2 fixation associated with CAM, and arrhythmia of the CAM 135

CO2 fixation rhythm under constant light and temperature (LL) free-running 136

conditions. Growth of rPPC1-B plants was reduced relative to wild type under both 137

well-watered and drought-stressed conditions. The plants reverted to fixing CO2 in 138

the light, especially in their youngest leaf pairs. Although the circadian rhythm of CO2 139

6

fixation dampened rapidly towards arrhythmia in the rPPC1-B line, the distinct 140

circadian clock output of delayed fluorescence, and the oscillations of the transcript 141

abundances of a subset of core circadian clock genes, were enhanced. Furthermore, 142

the temporal phasing of a wide range of GC specific signaling genes involved in 143

opening and closing was perturbed relative to the wild type in rPPC1-B. These 144

findings shed light on important regulators underpinning the inverse stomatal control 145

associated with CAM. 146

147 RESULTS 148

149

Initial Screening and Characterisation of PPC1 RNAi Lines of K. laxiflora 150

151

As K. laxiflora is relatively slow-growing, with flowering and seed set taking 152

approximately 9-months seed-to-seed (Hartwell et al., 2016), data are presented for 153

independent primary transformants that were propagated clonally via leaf margin 154

plantlets and/or stem cuttings. We initially screened primary transformants using 155

high-throughput leaf disc tests for starch and acidity at dawn and dusk (Cushman et 156

al., 2008; Dever et al., 2015). We screened independent transgenic lines that 157

acidified less during the dark period than the wild type for the steady-state 158

abundance of PPC1 transcripts using RT-qPCR (Figure 1). Line rPPC1-B displayed 159

a complete loss of PPC1 transcripts, whereas rPPC1-A had an intermediate level of 160

PPC1 transcripts (Figure 1A). The other plant-type PPC genes (PPC2, PPC3 and 161

PPC4) were up-regulated relative to the wild type, with their peak phased to dawn 162

(Figure 1B to 1D). PPC2 was up-regulated in line rPPC1-B at 6 and 10 h into the 12 163

h dark period (Figure 1B). 164

In line rPPC1-B, PPCK1, encoding the protein kinase that phosphorylates the 165

CAM-associated protein PPC1, was down-regulated during its dark period phased 166

peak and appeared to be slightly up-regulated at 2 h after dawn (Figure 1E). The 167

other two detectable PPCK genes, PPCK2 and PPCK3, were up-regulated in rPPC1-168

B, with PPCK2 induced 5-fold when it reached its 24 h peak in the middle of the dark 169

period, 4 h after the wild-type peak (Figure 1F). PPCK3 peaked in the middle of the 170

light period, when it reached a level almost 8-fold greater than the wild type (Figure 171

1G). 172

173

7

Loss of PPC1 Transcripts lead to Loss of PPC Protein and Activity 174

175

Immunoblotting using an antibody raised against purified CAM-specific PPC protein 176

from K. fedtschenkoi leaves (Nimmo et al., 1986) (Figure 2) revealed reduced levels 177

of PPC protein in rPPC1-A and no detectable PPC in rPPC1-B (Figure 2A). 178

We also measured the level of phospho-PPC using immunoblotting (Figure 179

2B). Phospho-PPC levels were lower in rPPC1-A than the wild type, whilst rPPC1-B 180

lacked detectable phospho-PPC (Figure 2B), which was consistent with the level of 181

PPC (Figure 2A). Although PPC2 was up-regulated in rPPC1-B (Figure 1B), it was 182

not detected at the protein level by the PPC antibody (Figure 2A). Furthermore, 183

despite PPCK2 and PPCK3 being up-regulated by 5- to 8-fold in rPPC1-B (Figure 1F 184

and 1G), any protein produced from these transcripts did not phosphorylate any 185

PPC2 protein that may have resulted from the induced PPC2 transcripts (Figure 2B), 186

at least not within the limits of detection with this immunoblotting technique. We used 187

rapidly desalted leaf extracts to measure the apparent Ki of PPC for L-malate. The Ki 188

was higher in the dark than the light for wild type and rPPC1-A, but no change in the 189

Ki was detected for rPPC1-B (Supplemental Figure 1). Furthermore, PPC activity 190

was not detected in rapidly desalted extracts from rPPC1-B leaves, whereas rPPC1-191

A displayed reduced but detectable PPC activity, at 43% of the wild-type level 192

(Figure 2C and Supplemental Table 1). 193

Pyruvate orthophosphate dikinase (PPDK), which functions in concert with 194

NAD-ME during the light-period as part of the CAM malate decarboxylation pathway 195

(Dever et al., 2015), was measured on immunoblots using specific antibodies against 196

PPDK and phospho-PPDK (Chastain et al., 2000; Chastain et al., 2002). The blots 197

showed a similar amount of PPDK protein over the diel cycle in wild type, rPPC1-A 198

and rPPC1-B (Figure 2D), confirming the even protein loading of the blots, which 199

was further supported by the images of Coomassie stained gels (Supplemental 200

Figure 1). In Kalanchoë, PPDK is inactivated in the dark by phosphorylation by 201

PPDK-regulatory protein (PPDK-RP), which also activates PPDK in the light through 202

dephosphorylation (Dever et al., 2015). In the wild type, immunoblotting of phospho-203

PPDK revealed that PPDK was dephosphorylated, and therefore likely to be fully 204

active, between 02:00 and 06:00 in the light when it is required for the conversion of 205

pyruvate, from malate decarboxylation, to PEP, thereby facilitating the recycling of 206

carbon through gluconeogenesis to starch (Figure 2E). Line rPPC1-A showed the 207

8

same pattern of PPDK phosphorylation/de-phosphorylation as the wild type (Figure 208

2E). However, PPDK was phosphorylated throughout the 24 h cycle in rPPC1-B 209

(Figure 2E), and was therefore likely to be inactive. Consistent with this prediction, 210

loss of the light period dephosphorylation of PPDK in rPPC1-B correlated with a 211

significant decrease in PPDK activity in the light, whereas the wild type and line 212

rPPC1-A showed strongly light-induced levels of PPDK activity that correlated with 213

the detected level of PPDK dephosphorylation in the light (Figure 2F and 214

Supplemental Table 2). 215

216

Malate, Starch, and Soluble Sugar Levels 217

218

During CAM in Kalanchoë, primary nocturnal fixation of atmospheric CO2 (as HCO3-) 219

results in vacuolar malic acid accumulation throughout the dark period. Starch 220

accumulates during the light period and is broken down during the dark period to 221

provide PEP as the substrate for carboxylation by PPC. Starch is also broken down 222

in a rapid burst at dawn to form soluble sugars (Wild et al., 2010; Boxall et al., 2017). 223

As the lack of CAM-associated PPC1 was predicted to prevent primary nocturnal 224

carboxylation, we measured metabolites including malate, starch and soluble sugars 225

every 4 h over the 24 h cycle (Figure 3). 226

Wild-type plants accumulated 130 µmols gFW-1 malate by dawn, whereas 227

rPPC1-A and rPPC1-B accumulated 75 µmol gFW-1 and 19.5 µmols gFW-1, 228

respectively (Figure 3A). The '-malate values for wild type, rPPC1-A and rPPC1-B 229

were 124.0, 64.3 and 16.2 µmol gFW-1, respectively (Figure 3A). During the diel 230

cycle, rPPC1-A and rPPC1-B synthesized 100% and 41% of the amount of starch 231

accumulated by the wild type, respectively (Figure 3B). The '-starch values for wild 232

type, rPPC1-A and rPPC1-B were 8.5, 8.5 and 3.5 mg starch gFW-1 (Figure 3B). 233

Lines rPPC1-A and rPPC1-B accumulated 51% and 15% of the amount of sucrose 234

accumulated by the wild type (Figure 3C), and 83% and 69% of the level of glucose, 235

respectively (Figure 3D). Glucose accumulated 4 h after the sucrose peak in the wild 236

type, whereas glucose levels peaked at the same time as sucrose in lines rPPC1-A 237

and rPPC1-B (Figure 3C and 3D). Finally, lines rPPC1-A and rPPC1-B accumulated, 238

respectively, 113% and 61% of the amount of fructose compared with the wild type 239

(Figure 3E). In rPPC1-B, the daily maxima for fructose and glucose coincided with 240

9

that of sucrose at 2 h after dawn (Figure 3C to 3E). Whilst no direct evidence was 241

obtained to explain these shifts in the timing of the sucrose, glucose and fructose 242

daily maxima, the most straightforward explanation is that the observed changes in 243

the timing of photosynthetic CO2 fixation and starch accumulation and turnover in the 244

rPPC1-B transgenic line resulted in the observed changes in the timing of the soluble 245

sugar peaks. 246

247

Growth Analysis in Well-Watered versus Drought-Stressed Conditions 248

249

CAM is widely regarded as an adaptation to drought, and so it was important to 250

compare the growth performance of wild type (full CAM) with that of rPPC1-A (small 251

reduction in CAM) and rPPC1-B plants (no CAM) under both well-watered (WW) and 252

drought-stressed (D-S) conditions (Figure 3F, Supplemental Figure 2 and 253

Supplemental Data Set 1). rPPC1-B plants were significantly smaller than wild type 254

in both WW and D-S conditions (Figure 3F and Supplemental Figure 2). In WW 255

conditions, the shoot dry weight of rPPC1-B was 21% less than that of the wild type 256

(Figure 3F), but the shoot dry weight of rPPC1-A was not significantly different from 257

that of the wild type. Under D-S, the shoot dry weight of line rPPC1-B was 12% lower 258

than that of the wild type (Figure 3F). A visual inspection of representative 4-month-259

old plants demonstrated that rPPC1-B was smaller than wild type and rPPC1-A 260

(Figure 3G), which is consistent with the shoot dry weight data (Figure 3F). Shoot 261

fresh weight was also significantly reduced in WW and D-S rPPC1-B, whereas the 262

only significant difference in below-ground root tissues was for rPPC1-B under 263

drought-stress, which displayed an increase in root fresh weight that was only just 264

significant (p = 0.0483; Supplemental Figure 2). Furthermore, rPPC1-B displayed a 265

reduced degree of leaf in-rolling in response to drought relative to the wild type 266

(Supplemental Figure 3), even though it lost just as much water during drought as 267

the wild type (Supplemental Figure 2). 268

269

Gas Exchange Characteristics under Light/Dark Cycles 270

271

We measured gas exchange in mature CAM leaves (leaf pair 6, LP6) of each line 272

over a 12-h-light, 25˚C, 60% humidity/ 12-h-dark, 15˚C, 70% humidity cycle using an 273

infra-red gas analyser (IRGA; LI-COR LI-6400XT) (Figure 4; 4A to 4C). Over the 24 274

10

h diel cycle, wild type fixed 297 µmol CO2 m-2, rPPC1-A fixed 320 µmol CO2 m-2, and 275

rPPC1-B fixed 230 µmol CO2 m-2 (Figure 4A). Net CO2 fixation was 23% less than 276

the wild type in line rPPC1-B, whereas it was 15% greater in line rPPC1-A (Figure 277

4A). 278

The four phases of CAM (Osmond, 1978) are indicated on the CO2 exchange 279

graph in Figure 4A. Phase I corresponds to the period of nocturnal atmospheric CO2 280

fixation to vacuolar malic acid in the wild type, and phases II, III and IV define the 281

peaks and trough of CO2 fixation and stomatal conductance across the 12-h-light 282

period (Figure 4A and 4B). Specifically, phase II refers to the sharp peak of CO2 283

fixation in the 1 to 2 hours after dawn, phase III defines the period of refixation CO2 284

from malate decarboxylation by RuBisCO behind closed stomata that spans the 285

middle of the light period, and phase IV occurs in younger leaves of well-watered 286

plants and corresponds to the period in the late afternoon when stomata re-open and 287

atmospheric CO2 is fixed directly by RuBisCO (Osmond, 1978). Note that the data in 288

blue for rPPC1-A provide the best example of this four phases framework for CAM 289

CO2 fixation and stomatal physiology (Figure 4A). By contrast, LP6 of the wild type 290

perform full CAM defined by phase I in the dark and phase III in the light (Figure 4A). 291

By calculating the total area under or over the CO2 exchange curves in Figure 4A, 292

and calculating these areas separately for the 12-h-light and the 12-h-dark periods, it 293

was possible to quantify the amounts of CO2 fixed by each line during either the light 294

period or the dark period. In the light period (phases II through IV), wild type leaves 295

fixed negligible amounts of atmospheric CO2, whereas rPPC1-B fixed a total of 265 296

µmol m-2, and rPPC1-A fixed 89 µmol m-2 (Figure 4A). In the dark period (phase I), 297

wild type fixed 297 µmol CO2 m-2 and rPPC1-A fixed 226 µmol CO2 m-2, but rPPC1-B 298

respired 35 µmol CO2 m-2 (Figure 4A). The loss of nocturnal CO2 fixation in rPPC1-B 299

(Figure 4A) corresponded with the lack of the CAM-associated PPC1 (Figure 1 and 300

2). LP6 of rPPC1-A fixed 24% less nocturnal CO2 than wild type, but, in contrast to 301

wild type, continued some light period CO2 capture (Figure 4A). 302

Apart from opening briefly for phase II, just after lights-on, the attached LP6 of 303

the wild type closed its stomata in the light and opened them throughout the dark, 304

when stomatal conductance (gs) tracked CO2 uptake (Figure 4B). In rPPC1-B, 305

stomata stayed open in the light, closed briefly at dusk, and opened slightly 306

throughout the dark, with a small peak prior to dawn (Figure 4B). The dark 307

conductance of rPPC1-B corresponded with the release of respiratory CO2 (Figure 308

11

4A). The calculated internal partial pressure of CO2 inside the leaf (Ci) was highest 309

for the wild type in the light period, when stomata were closed, which is consistent 310

with the expected high level of CO2 inside the leaf during malate decarboxylation 311

(Figure 4C). By contrast, in rPPC1-B, Ci peaked during the dark period, when 312

stomata were slightly open, but the leaves failed to fix atmospheric CO2, and 313

respiratory CO2 escaped (Figure 4C). 314

315

Impact of Drought on CO2 uptake in Plants lacking PPC1 316

To test the importance of PPC1 for carbon assimilation during drought, we measured 317

CO2 uptake continuously in whole, young plants (9-leaf-pairs; 2-months-old) over 22-318

days of drought, followed by re-watering (Figure 4D). The soil was watered to its 319

holding capacity prior to placing the plants in the gas exchange cuvettes at the start 320

of the experiment, and then no further water was added until re-watering occurred on 321

day 22. CAM develops with leaf age in K. laxiflora; the leaves gradually reduce light 322

period CO2 fixation and increase nocturnal CO2 fixation as they mature 323

(Supplemental Figure 4). A 2-month-old wild-type plant with 9-leaf-pairs thus 324

includes young leaves fixing CO2 mainly in the light via the C3 pathway, and older 325

leaves fixing the majority of their atmospheric CO2 in the dark via PPC and CAM. 326

When WW on day 1, wild type, rPPC1-A and rPPC1-B fixed, respectively, 7%, 327

6% and -26% of their CO2 during the dark period and 93%, 94% and 126% during 328

the light period (Table 1). This indicated that, in well-watered conditions, the young 329

leaves of these young plants performed the majority of the 24 h CO2 uptake (Table 330

1). On day 1, wild type, rPPC1-A and rPPC1–B fixed a total of 1093, 1008 and 1078 331

µmol of atmospheric CO2 m-2 over 24 h, respectively (Table 1). After 7-days without 332

watering, 24 h CO2 fixation was 1345, 1367 and 1506 µmol m-2, respectively. It 333

should be noted that total leaf area was measured at the end of the experiment, so 334

leaf growth and expansion during the experiment could not be accounted for. 335

After 7-days without water, there was a substantial increase in nocturnal CO2 336

uptake in wild type and rPPC1-A relative to day 1 (52% and 40% of CO2 fixation 337

occurred in the dark, respectively; Table 1). rPPC1-B respired less (-14%) after 7-338

days of drought relative to the -26% dark respired CO2 level on day 1 (Table 1). After 339

13-days of drought, wild type, rPPC1-A and rPPC1-B fixed, respectively, 795, 802 340

and 145 µmol CO2 m-2 over the 24 h cycle (Table 1). Thus, plants performing CAM 341

(wild type and rPPC1-A) were able to fix over 5-fold more CO2 after 13-days of 342

12

drought compared to rPPC1-B. Furthermore, after 22-days of drought, wild type, 343

rPPC1-A and rPPC1-B fixed 76, 130 and -30 µmol m-2 during the 24 h light/dark 344

cycle, respectively. 345

On day 22 without water, the drought-stressed plants were re-watered (see 346

photos in Supplemental Figure 3). After re-watering, CO2 fixation increased rapidly 347

for all plants (Figure 4D). In addition, wild type and rPPC1-A displayed pronounced 348

phase III of CAM after re-watering (Figure 4D). Following soil rehydration, the wild 349

type fixed 931 µmol m-2 CO2 in the dark, compared to 768 µmol m-2 for rPPC1-A, 350

whereas prior to drought, rPPC1-A fixed more atmospheric CO2 (Table 1). rPPC1-B 351

fixed CO2 throughout the light period following re-watering, and it also resumed 352

respiratory CO2 loss throughout the dark period (Figure 4D). 353

As there was an increase in C3 photosynthesis in rPPC1-B, we measured 354

chlorophyll a and b levels in LP2 through LP7 (Figure 4E and 4F and Supplemental 355

Table 3). Line rPPC1-A contained significantly more chlorophyll a and b than wild 356

type in LP2 (Figure 4E and 4F). rPPC1-B contained significantly more chlorophyll a 357

than the wild type in LP2, but significantly less chlorophyll a in LP3 through LP7, and 358

significantly less chlorophyll b in LP3 to LP6 (Figure 4E and 4F). This decreased 359

level of chlorophyll a and b in LP3 to LP7 or LP6 in rPPC1-B was a surprising 360

finding. In general, CAM species contain reduced levels of gene transcripts and 361

encoded proteins associated with C3 photosynthesis, such as RuBisCO and light 362

harvesting complex components, when the level of CAM is induced by stress. Thus, 363

reducing the level of CAM in leaf pair 3 through 7 due to the silencing of PPC1 was 364

predicted to result in the induction of core C3 photosynthesis genes and chlorophyll 365

content in parallel with the measured increase in light period atmospheric CO2 366

fixation via the C3 pathway. Further elucidation of the reasons for this unexpected 367

chlorophyll response may come from transcriptome-wide analysis of the differentially 368

abundant transcripts in rPPC1-B compared to the wild type. 369

370

Characterisation of CAM Gene Transcript Abundance in rPPC1 Lines 371

372

Having established that rPPC1-B lacked nocturnal CO2 fixation (Figure 4A), it was 373

important to investigate the temporal regulation of other CAM-associated genes in 374

the rPPC1 RNAi lines. We investigated the transcript abundance of CAM genes in 375

CAM leaves (LP6) using samples collected every 4 h over a 12-h-light/12-h-dark 376

13

cycle (Figure 5). PPDK transcript levels were unchanged relative to the wild type in 377

both rPPC1 lines (Figure 5A), but its regulator gene PPDK-RP was up-regulated in 378

line rPPC1-B (Figure 5B), which is consistent with the continuous phosphorylation 379

and inactivation of PPDK (Figure 2E and 2F). E-NAD-ME transcript levels appeared 380

to be only slightly different from the wild type in the rPPC1 lines but appeared to be 381

lower in rPPC1-B at 22:00 (Figure 5C). 382

In light of the marked reduction in starch to half the wild-type level in rPPC1-B 383

(Figure 3B), we also measured transcripts associated with starch turnover. In rPPC1-384

B, dusk-phased starch breakdown-associated genes (GWD, AMY3a and 3b, PHS1; 385

Figure 5D to 5F and 5J) and sugar transporter genes (MEX1, pGlcT; Figure 5L and 386

5M) were up-regulated, whereas dawn-phased starch breakdown genes (BAM1, 387

BAM3, BAM9; Figure 5G to 5I) and sugar transporter genes (GPT2; Figure 5K) were 388

down-regulated compared to the wild type. 389

Finally, a CHLOROPHYLL A/B BINDING PROTEIN (CAB1) gene was up-390

regulated in rPPC1-B at dawn (Figure 5N), whereas a gene encoding a potential 391

sucrose sensor connecting growth and development to metabolic status, 392

TREHALOSE 6-PHOSPHATE SYNTHASE7 (TPS7) (Schluepmann et al., 2003), 393

was down-regulated relative to the wild type at 6 and 10 h into the 12-h-dark period 394

(Figure 5O). 395

396

Characterisation of Diel Regulation of Circadian Clock Genes in rPPC1 Lines 397

398

Recent studies using PPCK1 RNAi lines in Kalanchoë reported that a reduced 399

temporal peak of sucrose content phased to 2 h after dawn correlated with 400

perturbation of the central circadian clock (Boxall et al., 2017). Of the two 401

CIRCADIAN CLOCK ASSOCIATED1 (CCA1) genes in K. laxiflora, each of which is 402

represented by two homeologous copies in the tetraploid genome, only the two 403

homeologs of CCA1-2 were down-regulated in rPPC1-B (Figure 5P and 5Q), 404

whereas both homeologs of both TIMING OF CHLOROPHYLL A/B BINDING 405

PROTEIN1 (TOC1) genes were up-regulated in both rPPC1-A and rPPC1-B (Figure 406

5R and 5S). Two other pseudo-response regulators (PRRs) related to TOC1, namely 407

PRR7 and PRR3/7, were up-regulated in both rPPC1-A and rPPC1-B (Figure 5T and 408

14

5U), and PRR9 was induced almost 5-fold in the middle of the light period, 409

specifically in line rPPC1-B (Figure 5V). 410

Other clock associated genes, including JUMONJI DOMAIN 411

CONTAINING30/5 (JMJ30/ JMJD5), EARLY FLOWERING3 (ELF3) and CYCLING 412

DOF-FACTOR2 (CDF2) were also up-regulated in line rPPC1-B (Figure 5W to 5Y) 413

vs. the wild type, whereas the single MYB-repeat transcription factor genes 414

REVEILLE1-like (RVE1-like) and EARLY-PHYTOCHROME-RESPONSIVE1 (EPR1), 415

and LIGHT NIGHT-INDUCIBLE AND CLOCK-REGULATED3-like (LNK3-like) were 416

down-regulated (Figure 5Z to 5BB). Finally, CCA1-1, FLAVIN-BINDING KELCH-417

REPEAT F-BOX PROTEIN1 (FKF1) and GIGANTEA (GI) transcript levels were 418

consistent among all three lines (Figure 5P, 5CC and 5DD). 419

420

Gas Exchange Characteristics of rPPC1 Lines under Circadian Free Running 421

Conditions 422

423

Under constant light and temperature (LL) free-running conditions, detached K. 424

laxiflora wild type CAM leaves (LP6) with their petioles in water displayed a robust 425

circadian rhythm of CO2 uptake with a period of approximately 20 h (Figure 6; 6A). 426

This rhythm was entirely consistent with CAM rhythms reported previously for 427

detached LP6 of closely related Kalanchoë species with obligate CAM (Lüttge and 428

Ball, 1978; Anderson and Wilkins, 1989). The rhythm dampened rapidly in line 429

rPPC1-B, whereas rPPC1-A maintained a rhythm that was very similar to that of the 430

wild type (Figure 6A). 431

When LL CO2 uptake was measured for well-watered whole plants (2 months 432

old; 9-leaf pairs), rPPC1-B fixed more CO2 than the wild type and line rPPC1-A, with 433

levels of 11,269, 7414, 8383 µmol CO2 m-2, respectively (Figure 6B). Wild type 434

maintained robust oscillations of CO2 exchange under LL conditions, whereas 435

rPPC1-A dampened to arrhythmia after 3-days, and rPPC1-B was arrhythmic (Figure 436

6B). It should be noted that the LL CO2 exchange data for intact young plants with 437

their roots in soil (Figure 6B) differs from the data for detached LP6 (Figure 6A) 438

because the whole plants measured in Figure 6B included leaf pairs from very young 439

LP1, which perform C3, through to LP6 to LP9 that perform full CAM (phase I in the 440

dark and III in the light). The detached LP6 measured in Figure 6A were full CAM 441

leaves only, at least for the wild type (Supplemental Figure 4). Thus, the more rapid 442

15

and substantial dampening of the free-running CO2 fixation rhythm towards 443

arrhythmia in lines rPPC1-A and rPPC-1B relative to the wild type (Figure 6B), 444

suggests that the younger leaves (LP1 to LP5) made a dominant contribution to the 445

robust circadian rhythm in wild-type whole plants. 446

447

Delayed Fluorescence Rhythms are Enhanced in rPPC1-B Despite the Loss of 448

CAM-Associated CO2 Uptake Rhythms 449

450

Delayed fluorescence (DF) displays a robust circadian rhythm in Kalanchoë and 451

provides a measure of a chloroplast-derived clock-output that can be used for 452

statistical analysis of circadian period, robustness and accuracy (Gould et al., 2009; 453

Boxall et al., 2017). We therefore measured and analysed DF under LL (Figure 6C) 454

to calculate rhythm statistics using Biodare (Moore et al., 2014; Zielinski et al., 2014). 455

Wild type DF oscillations were very similar to those reported previously for K. 456

fedtschenkoi (Figure 6C; Gould et al., 2009; Boxall et al., 2017). rPPC1-A and 457

rPPC1-B had more robust oscillations than the wild type (Figure 6C). The rhythm 458

amplitude increased slightly with time in rPPC1-A and rPPC1-B but remained 459

relatively constant in the wild type. The relative amplitude error (RAE) plot showed a 460

wider spread of period for the wild type than for the rPPC1 lines (Figure 6D). Mean 461

periods were between 21.5 h and 22.1 h when calculated using spectral resampling 462

or fast Fourier transform (nonlinear least squares) methods, respectively (Figure 6E). 463

Average periods were similar between wild type and the rPPC1 lines. A lower mean 464

RAE was calculated for rPPC1-A and rPPC1-B compared to the wild type (Figure 465

6F), supporting statistically the visibly robust and high-amplitude DF rhythm in the 466

rPPC1 lines (Figure 6C). 467

468

Rhythm Characteristics of Core Circadian Clock and Clock-Controlled Genes 469

470

Having established that circadian control of CO2 fixation was dampened under LL in 471

plants lacking PPC1, whereas the circadian control of DF was enhanced under LL 472

(Figure 6A to 6F), it was important to investigate the regulation of both core clock 473

genes and circadian clock-controlled genes in the rPPC1 lines under LL (Figure 7). 474

Wild type displayed a rhythm in the transcript abundance of PPC1 that was 475

absent in rPPC1-B (Figure 7A). PPC2 was rhythmic in wild type and rPPC1-B, but its 476

16

abundance was lower in rPPC1-B (Figure 7B). The PPCK1 rhythm was of greater 477

amplitude in rPPC1-B, and the daily transcript peaks occurred 4 to 8 h later than the 478

wild type after the first 24 h of LL (Figure 7C). PPCK2 and PPCK3 were induced in 479

line rPPC1-B and oscillated with higher amplitude (Figure 7D and 7E). PPCK2 480

peaked after the wild type on the second and third 24 h cycles under LL (Figure 7D 481

and 7E), which is consistent with the induction detected under light/dark cycles 482

(Figure 1F and 1G). GPT2, which is involved in the transport of G6P across the 483

chloroplast membrane, was down-regulated and had lower amplitude in rPPC1-B 484

than the wild type (Figure 7F), whereas CAB1 was induced and oscillated robustly 485

(Figure 7G). 486

In rPPC1-B, the core clock gene CCA1-1 was down-regulated, phase 487

delayed, and had lower amplitude than the wild type (Figure 7H), whereas CCA1-2, 488

TOC1-1 and TOC1-2 were all up-regulated and phase delayed relative to the wild 489

type for the latter two peaks of LL (Figure 7I, 7J and 7K). PRR7 was up-regulated 490

and more robustly rhythmic in rPPC1-B (Figure 7L), whereas the rhythms of PRR3/7 491

and PRR9 dampened in rPPC1-B (Figure 7M and 7N). Finally, JMJ30/JMJD5, ELF3, 492

CDF2, RVE1-like, EPR1, FKF1 and GI were up-regulated in rPPC1-B, displaying 493

higher amplitude, phase delays and/or period lengthening during the LL time course 494

(Figure 7P to 7V), whereas LNK3-like was down-regulated but remained rhythmic, 495

with a lengthening period compared to the wild type (Figure 7O). 496

497

Diel Regulation of GC-Signalling and Ion Channel Genes in GC-Enriched 498

Epidermal Peels of rPPC1-B 499

500

As CO2 fixation and associated stomatal opening were shifted to the light period in 501

rPPC1-B, it was important to investigate the temporal regulation of known guard cell 502

signalling genes in wild type and the rPPC1-B line (Figure 8). Since epidermal peels 503

of Kalanchoë leaves are enriched for intact guard cells, we isolated RNA from 504

epidermal peels from the upper and lower leaf surfaces of LP6 every 4 h over the 12-505

h-light/12-h-dark cycle and used them for RT-qPCR. 506

PHOTOTROPIN1 (PHOT1) encodes a protein kinase that acts as a blue light 507

(BL) photoreceptor in the signal-transduction pathway leading to BL-induced 508

stomatal movements (Kinoshita et al., 2001). In rPPC1-B, PHOT1 transcripts were 509

up-regulated relative to the wild type and peaked 8 h into the 12-h-light period 510

17

(Figure 8A). CRYPTOCHROME2 (CRY2) encodes a photoreceptor that regulates BL 511

responses, including the entrainment of endogenous circadian rhythms (Somers et 512

al., 1998), and stomatal conductance via an indirect effect on ABA levels 513

(Boccalandro et al., 2012). In rPPC1-B epidermal peels, CRY2 transcript levels were 514

up-regulated and peaked at dusk, whereas CRY2 peaked 8 h into the dark in the 515

wild type (Figure 8B). 516

In Arabidopsis, GC-localised E-CARBONIC ANHYDRASE1 (CA1) and CA4 517

are involved in CO2 sensing in GCs, with the ca1 ca4 mutant displaying impaired 518

stomatal control in response to CO2 (Hu et al., 2010). In rPPC1-B, a E-carbonic 519

anhydrase gene was much more strongly induced at dawn relative to the wild type 520

(Figure 8C). PATROL1 controls the tethering of the proton ATPase AHA1 to the 521

plasma membrane and is essential for stomatal opening in response to low CO2 and 522

light levels (Hashimoto-Sugimoto et al., 2013). The cycle of PATROL1 in epidermal 523

peels was slightly different between rPPC1-B and wild type, with rPPC1-B peaking 4 524

h into the dark, but the wild type peak at 4 h into the light period (Figure 8D). 525

CONVERGENCE OF BLUE LIGHT AND CO2 1/2 (CBC1/2) stimulate stomatal 526

opening by inhibiting S-type anion channels in response to both BL and low CO2 and 527

connect BL signals perceived by PHOT1 with the protein kinase HIGH LEAF 528

TEMPERATURE1 (HT1) (Hiyama et al., 2017). Both proteins interact with and are 529

phosphorylated by HT1. In rPPC1-B, CBC1/2 was up-regulated compared to the wild 530

type both in the second half of the dark period and at dawn (Figure 8E). HT1 acts as 531

a negative regulator of high CO2 induced stomatal closure (Hashimoto et al., 2006). 532

HT1 transcript levels were reduced throughout the light/dark cycle relative to the wild 533

type in rPPC1-B (Figure 8F). OPEN STOMATA1 (OST1), encoding a protein kinase 534

that acts downstream of HT1 (Imes et al., 2013), was up-regulated in rPPC1-B both 535

at 8h into the dark period and at dawn, the time of the daily trough in the wild type 536

(Figure 8G). 537

Genes involved in ion transport across the plasma membrane and tonoplast 538

play a crucial role in the changes in cell turgor pressure that drive stomatal 539

movements (Jezek and Blatt, 2017). SLOW ACTIVATED ANION CHANNEL1 540

(SLAC1) is a key player in the closure of stomata in response to high CO2 541

concentrations (Hedrich and Geiger, 2017). SLAC1 is regulated by ABA signalling, 542

which requires de-phosphorylation steps catalysed by protein phosphatase type 2C 543

18

(PP2C). In rPPC1-B, SLAC1 was up-regulated and peaked during the light (Figure 544

8H), and PP2C was up-regulated relative to the wild type during the dark period 545

(Figure 8I). ABA is recognized and bound by the REGULATORY COMPONENT OF 546

ABA RECEPTORS (RCARs)/PYRABACTIN RESISTANCE1 (PYR1/PYL), which 547

interact with PP2C to stimulate ABA signalling (Ma et al., 2009; Park et al., 2009; 548

Santiago et al., 2009). In rPPC1-B epidermal peels, RCAR3 transcripts were induced 549

spanning dusk and the first half of the dark period, and peaked at least 4 h earlier 550

than the wild type (Figure 8J). 551

In rPPC1-B, the transcript level of GUARD CELL OUTWARD RECTIFYING 552

K+ CHANNEL (GORK), which is involved in regulating stomatal movement according 553

to water status (Ache et al., 2000), peaked 4 h earlier than wild type (Figure 8K). 554

STELAR K+ OUTSIDE RECTIFIER (SKOR) encodes a selective outward-rectifying 555

potassium channel (Gaymard et al., 1998). SKOR transcript levels peaked at dawn 556

in the wild type, whereas in rPPC1-B, SKOR transcript levels reached their daily 557

minimum at dawn (Figure 8L). The transcript level of plasma-membrane localised 558

ALUMINIUM ACTIVATED MALATE TRANSPORTER12 (ALMT12), which is involved 559

in dark-, CO2-, ABA- and water deficit-induced stomatal closure, was elevated 560

relative to the wild type at dawn in rPPC1-B (Figure 8M). The E3 UBIQUITIN-561

PROTEIN LIGASE RMA1 promotes the ubiquitination and proteasomal degradation 562

of the aquaporin PIP2:1, which plays a role in GC regulation (Grondin et al., 2015). 563

RMA1 was induced 3-fold at dawn in rPPC1-B compared to the wild type (Figure 564

8N). EMBRYO SAC DEVELOPMENT ARREST39 (EDA39) is a calmodulin binding 565

protein that promotes stomatal opening (Zhou et al., 2012). In rPPC1-B, EDA39 was 566

up-regulated relative to the wild type and peaked at dusk (Figure 8O). 567

SALT OVERLY SENSITIVE2 (SOS2) is a Calcineurin B-Like (CBL)-interacting 568

protein kinase involved in the regulatory pathway for intracellular Na+ and K+ 569

homeostasis and salt tolerance (Liu et al., 2000). SOS2 interacts with and activates 570

the vacuolar H+/Ca2+ antiporter CAX1, thereby functioning in cellular Ca2+ 571

homeostasis, an important function during stomatal opening and closing (Cheng et 572

al., 2004). SOS2 transcript levels were elevated relative to the wild type at all time 573

points, and, in particular, it was induced ~5-fold at its peak 4 h into the dark period in 574

epidermal peels of rPPC1-B relative to the wild type (Figure 8P). Ca2+-ATPase2 575

(ACA2) and ENDOMEMBRANE-TYPE Ca2+-ATPASE4 (ECA4) catalyze the 576

hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the 577

19

endoplasmic reticulum and/or an endomembrane compartment (Jezek and Blatt, 578

2017). ACA2 and ECA4 were induced by ~4-fold to ~8-fold in rPPC1-B epidermal 579

peels relative to the wild type, particularly when they reached peak levels at 4 h into 580

the 12-h-dark period (Figure 8Q and 8R). 581

Finally, the transcription factor MYB60 is involved in stomatal opening in 582

response to light and promotes GC deflation in response to water deficit (Cominelli et 583

al., 2005). In rPPC1-B, MYB60 was induced ~5-fold relative to the wild type at dawn, 584

although it also maintained a dusk-phased peak of transcript abundance like the wild 585

type (Figure 8S). MYB61 functions as a transcriptional regulator of stomatal closure 586

(Liang et al., 2005). MYB61 was down-regulated in rPPC1-B relative to wild type and 587

peaked 8 h later in rPPC1-B, 4 h into the dark period, whereas in the wild type, 588

MYB61 peaked in the light 4 h before dusk (Figure 8T). 589

590

Diel Regulation of GC-Metabolism Genes in GC-Enriched Epidermal Peels of 591

rPPC1-B 592

PPC1 and PPC2 transcript levels were low in epidermal peels (Supplemental Figure 593

5A and 5B) compared to whole leaves (Figure 1A). PPC3 and PPC4 transcripts were 594

more abundant in wild type epidermal peels (Supplemental Figure 5C and 5D) 595

relative to whole leaves (Figure 1C and 1D). Furthermore, PPC3 and PPC4 were up-596

regulated in epidermal peels of rPPC1-B compared to the wild type, and their 597

transcript abundance peaked 4 h into the dark period, whereas in the wild type, the 598

abundance of both transcripts peaked at the end of the dark period or dawn 599

(Supplemental Figures 5A to 5D). 600

CAM-specific PPCK1 was up-regulated in rPPC1-B epidermal peels 601

compared to wild type, whereas the expression of PPCK2, which does not currently 602

have a proposed role in the regulation of CAM-specific PPC1 in the mesophyll, was 603

unchanged (Supplemental Figure 5E and 5F). Both PPCK2 and PPCK3 transcripts 604

were more abundant than PPCK1 in epidermal peels, suggesting their encoded 605

proteins might regulate the activity of the GC PPC(s) (Supplemental Figure 5F and 606

5G). Most strikingly, PPCK3 was up-regulated ~5-fold at 4 h after lights-on in rPPC1-607

B epidermal peels relative to the wild type (Supplemental Figure 5G). 608

In C3 plants, starch is degraded before dawn to fuel stomatal opening (Blatt, 609

2016). In Arabidopsis GCs, BAM1 encodes the major starch-degrading enzyme 610

(Valerio et al., 2010; Prasch et al., 2015; Horrer et al., 2016; Santelia and Lunn, 611

20

2017) that functions with AMY3 to mobilize starch at dawn, releasing maltose in the 612

chloroplasts (Horrer et al., 2016). In rPPC1-B epidermal peels, GWD transcript levels 613

were halved relative to wild type at its peak, i.e., 8 h into the 12 h light period 614

(Supplemental Figure 5H). AMY3a and AMY3b were up-regulated at dusk and in the 615

second half of the light period, respectively (Supplemental Figure 5I and 5J). BAM1 616

was up-regulated at dawn compared to wild type, and peaked with a very similar 617

transcript abundance to wild type at 20:00 h, 8 h into the dark period (Supplemental 618

Figure 5K), whereas BAM3 transcript levels were ~3-fold lower in rPPC1-B relative 619

to the wild type at the time of its nocturnal peak, which also occurred 8 h into the 620

dark (Supplemental Figure 5L). BAM9 expression in rPPC1-B rose later than the wild 621

type, lagging behind the wild type at dusk and 4 h into the dark, and it stayed ~5-fold 622

higher at dawn and 4 h into the light period, when the wild type reached its daily 623

trough (Supplemental Figure 5M). BAM9 in Arabidopsis is predicted to be 624

catalytically inactive and has no known function to date (Monroe and Storm, 2018). 625

The peak of PHS1 was delayed by 4 h, peaking at the light/dark transition 626

(Supplemental Figure 5N), and MEX1 was down-regulated in epidermal peels of 627

rPPC1-B, peaking at 08:00 in the light, 4 h after the wild type peak (Supplemental 628

Figure 5O). 629

630

Diel Regulation of Core Circadian Clock genes in Epidermal Peels of rPPC1-B 631

632

The circadian clock genes PRR3/7 and PRR7 were up-regulated in epidermal 633

peels of rPPC1-B relative to wild type (Supplemental Figure 5P and 5Q), with a 634

similar diel pattern to that measured in whole CAM leaves (Figure 5S and 5T). 635

PRR3/7 peaked 4 h earlier in rPPC1-B, whereas PRR7 transcript levels were greater 636

throughout the light period in rPPC1-B (Supplemental Figure 5P and 5Q). LUX is a 637

component of the morning transcriptional feedback circuit within the clock, encoding 638

a transcription factor that directly regulates the expression of PRR9 by binding to 639

specific sites in its promoter (Helfer et al., 2011). In epidermal peels, LUX was 640

downregulated >7-fold in rPPC1-B compared to the wild type at its peak, 4 h into the 641

light period, and also peaked 4 h later than the wild type (Supplemental Figure 5R). 642 643 Diel Regulation of Additional GC-Signalling Genes in GC-Enriched Epidermal 644

Peels of rPPC1-B 645

21

GCs perceive CO2 and regulate stomatal aperture via ABA and reactive oxygen 646

species signaling, with low CO2 levels mediating stomatal opening and high CO2 647

levels causing closure (Chater et al., 2015). NADP OXIDOREDUCTASE encodes an 648

NADP-binding Rossman-fold super-family protein that we only detected in epidermal 649

peels in Kalanchoë. The enzyme encoded by this gene might generate the H2O2 650

burst induced by ABA as part of the stomatal closure signalling pathway 651

(Daszkowska-Golec and Szarejko, 2013). This transcript was up-regulated ~3-fold in 652

rPPC1-B at dawn (Supplemental Figure 5S). 653

In Arabidopsis, the transcription factors MYB94 and MYB96 function together 654

in the activation of cuticular wax biosynthesis under drought stress (Lee et al., 2016). 655

MYB96 may also be involved in the response to drought stress in Arabidopsis 656

through ABA signalling that mediates stomatal closure via the RD22 pathway (Seo et 657

al., 2011). Both MYB94 and MYB96 were induced by as much as 3-fold in rPPC1-B 658

compared to wild type (Supplemental Figure 5T and 5U). Specifically, MYB94 659

transcript levels rose 8 h earlier than they did in the wild type and were already close 660

to peak levels by the light-to-dark transition, whereas in the wild type, MYB94 levels 661

peaked sharply 8 h into the dark period (Supplemental Figure 5T). MYB96 662

transcription was induced relative to the wild type at both dawn and dusk, but the 663

peak of MYB96 transcription at dawn represented the largest fold-change relative to 664

the wild type (Supplemental Figure 5U). 665

666

667

DISCUSSION 668

669

CAM Provides a Selective Advantage in the Face of Drought 670

671

The data presented here for CO2 fixation during progressive drought demonstrate 672

very clearly the importance of a fully functional CAM system for continued 673

atmospheric CO2 fixation throughout a period of drought lasting just over 3-weeks 674

(Figure 4D). Although the intermediate line rPPC1-A continued to perform 675

atmospheric CO2 fixation and malate accumulation in the dark and stomatal closure 676

in the light period, it was less able to adapt to drought by inducing CAM compared to 677

the wild type. Thus, by comparing the impacts of the different levels of PPC1 678

silencing in these transgenic lines of Kalanchoë, it is possible to conclude that the 679

22

wild type level of PPC1 transcript enables the plant to adapt to drought more rapidly 680

by increasing nocturnal CO2 fixation and malate accumulation and by decreasing the 681

magnitude and duration of phases II and IV of CAM in the light. These swift 682

adaptations allow the wild type to curtail excessive water-loss more rapidly than 683

either of the transgenic lines with reduced PPC1 transcript levels, suggesting that the 684

high level of PPC1 transcript in the wild type provides a genuine adaptive advantage 685

in terms of allowing the plant to prevent excessive water loss during gradual soil 686

drying. 687

Upon re-watering on day 23, both wild type and rPPC1-A plants returned to 688

performing strong, four-phase CAM, including pronounced phase II and IV at the 689

start and end of the light period, respectively (Figure 4D). Line rPPC1-B also 690

bounced back to its normal, pre-drought physiology after re-watering, which is 691

consistent with the re-watering response reported previously for a range of 692

facultative, weak-CAM species, including M. crystallinum, purslane (Portulaca 693

oleracea), P. umbraticola, T. triangulare, and various Calandrinia species (Winter 694

and Holtum, 2014; Holtum et al., 2017; Winter, 2019). Overall, the response of 695

rPPC1-B to progressive drought stress and subsequent re-watering is reminiscent of 696

the physiological response of facultative CAM species such as T. triangulare and M. 697

crystallinum, although both of these true facultative CAM species did achieve net 698

atmospheric CO2 fixation in the dark period following approximately 12 to 13 days of 699

drought (Winter and Holtum, 2014). 700

Although the rPPC1-B plants fixed all of their CO2 in the light, especially 701

during a pronounced and extended phase II in the hours after dawn, the CO2 uptake 702

pattern was not constant over the light period (Figure 4A). For example, in LP6 of a 703

well-watered plant, CO2 fixation dropped from ~8 µmol m-2 s-1 during phase II after 704

dawn to ~2 to 3 µmol m-2 s-1 around 4 h after lights on (Figure 4A), and stomatal 705

conductance decreased to a similar extent (Figure 4B). The observed stomatal 706

closure could not have been due to a high malate concentration and associated 707

internal release of CO2 in the mesophyll (Figure 3A). These data are consistent with 708

the current hypothesis that a signal from the core circadian clock drives the closure 709

of CAM stomata in the light and the associated decline in atmospheric CO2 fixation, 710

even when a CAM leaf has not produced malate during the preceding dark period 711

(Von Caemmerer and Griffiths, 2009). 712

23

Overall, with respect to CAM physiology, the data presented here provide 713

strong support for the long-held view that the ability to use CAM, and to use it 714

increasingly in response to drought stress, provides a genuine adaptive advantage in 715

terms of prolonging net atmospheric CO2 fixation during drought progression (Figure 716

4D) (Kluge and Fischer, 1967; Osmond, 1978). The wild type and line rPPC1-A 717

achieved, respectively, net atmospheric CO2 fixation of 18,568 and 19,071 µmoles 718

m-2 over the 22-day drought progression, whereas line rPPC1-B only achieved 719

13,983 µmoles m-2 net atmospheric CO2 fixation (Supplemental Table 4). Thus, the 720

wild type, with its fully functional CAM system, was able to fix 33% more CO2 over 721

the entire drought treatment period than the mutant. 722

723

Insights into the Evolutionary Trajectory from C3 to CAM 724

725

The discovery that the very low level of PPC activity in the rPPC1-B transgenic line 726

was associated with nocturnal refixation of respiratory CO2 revealed that even a 727

small increase in PPC activity in the dark period may be sufficient to support a 728

minimal, but functional, CAM cycle. Thus, during CAM evolution from ancestral C3 729

species, small increases in nocturnal PPC activity in photosynthetic mesophyll cells 730

behind closed stomata may have been sufficient to support the refixation of 731

respiratory CO2 to stored vacuolar malic acid, allowing its subsequent 732

decarboxylation in the light, leading to partial stomatal closure, enhanced WUE, and 733

improved RuBisCO carboxylation efficiency relative to the oxygenase (Edwards, 734

2019). However, despite our data for Kalanchoë supporting this evolutionary 735

perspective on the progression to CAM, initial attempts to increase the expression of 736

core CAM pathway enzymes in the C3 model species Arabidopsis thaliana have not 737

reciprocated the phenotype of even the most strongly silenced rPPC1-B line reported 738

here. Constitutive over-expression of the CAM-specific PPC isogene from M. 739

crystallinum in A. thaliana led to increased stomatal conductance and titratable 740

acidity (Lim et al., 2019). However, the increased stomatal conductance was 741

measured in the middle of the light period, and the timing of the titratable acidity 742

measurements relative to the light/dark cycle was not mentioned (Lim et al., 2019). 743

Therefore, it is difficult to compare these results with the results presented here 744

documenting alterations in nocturnal stomatal opening and atmospheric CO2 fixation 745

and dawn-phased malate accumulation in the rPPC1 transgenic lines of Kalanchoë. 746

24

It should be noted, however, that the K. laxiflora lines with reduced CAM-specific 747

PPC1 transcript levels still possessed succulent leaves with large mesophyll cells, 748

plus wild type levels of key CAM transcripts and enzymes such as PPDK. Thus, the 749

rPPC1 plants were by no means directly comparable to the transgenic A. thaliana 750

lines reported by Lim et al. (2019). 751

752

Impact of PPC1 Silencing on the CAM Circadian Rhythm of CO2 Fixation 753

754

The circadian rhythm of CO2 fixation observed for CAM species of Kalanchoë under 755

constant free-running conditions is a classic example of a plant clock output rhythm 756

driven by the underlying multi-gene-loop, autoregulatory core oscillator mechanism 757

in the nucleus that sets the time (Hartwell, 2006). Under continuous light and 758

temperature (LL) conditions, the CAM-associated circadian rhythm of CO2 fixation 759

dampened towards almost complete arrhythmia in detached leaves and whole, 760

young plants of rPPC1-B, and CO2 was fixed continuously (Figure 6A and 6B). The 761

collapse of the CO2 circadian rhythm suggests that CO2 fixation by RuBisCO in 762

rPPC1-B was not subject to robust and high amplitude circadian control, certainly not 763

in comparison to the rhythm of atmospheric CO2 fixation during CAM in the wild type 764

(Figure 6B). In K. daigremontiana, RuBisCO is thought to make a large contribution 765

to the observed rhythm of CO2 assimilation under LL conditions, as the level of 766

malate does not oscillate (Wyka and Lüttge, 2003). By contrast, online carbon 767

isotope discrimination measurements demonstrated that the LL CO2 rhythm of CAM 768

leaves of M. crystallinum had a RuBisCO carbon isotope discrimination early in each 769

subjective dark period, which then transitioned to a PPC carbon isotope ratio later in 770

the subjective dark (Davies and Griffiths, 2012). In rPPC1-B (with no detectable 771

PPC), the remaining RuBisCO-mediated rhythm displayed, at best, only a very weak 772

rhythm of CO2 assimilation (Figure 6A). This suggests that C3 carboxylation via 773

RuBisCO only makes a small contribution to the LL rhythm in K. laxiflora CAM 774

leaves, or perhaps the robust, high amplitude CO2 rhythm of the wild type depends 775

on interplay between high PPC activity and RuBisCO, which ceases in the absence 776

of PPC1. Overall, the weakly rhythmic to arrhythmic pattern of CO2 assimilation in 777

rPPC1-B under LL was very similar to that of C3 M. crystallinum (Davies and 778

Griffiths, 2012). 779

780

25

Regulation of Core Clock Genes in rPPC1-B 781

782

Previous reports for other CAM species have emphasised that most core circadian 783

clock genes share their pattern and phasing of diel transcript regulation between 784

Arabidopsis and, for example, Agave, pineapple (Ananas comosus), and white 785

stonecrop (Sedum album) (Sharma et al., 2017; Yin et al., 2018; Wai et al., 2019). 786

These reports therefore emphasise that the timing of core clock genes is conserved 787

between widely divergent species, regardless of the underlying mechanism of 788

photosynthetic CO2 fixation, which is consistent with the ancestral role of the core 789

circadian clock in the temporal control and optimisation of many biological processes 790

in plants. However, individual studies have identified specific core clock genes, or 791

genes closely associated with the core clock, that were differentially expressed 792

and/or temporally phased in certain CAM species relative to Arabidopsis. For 793

example, RNA-seq based transcriptome analysis in A. americana identified a gene 794

related to the clock-associated output pathway gene RVE1 (Rawat et al., 2009), 795

which was rescheduled to the dark period in Agave, but peaked phased to dawn in 796

Arabidopsis (Yin et al., 2018). The K. laxiflora RVE1-like gene measured here 797

reached its 24 h transcript peak phased to dawn in LD cycles (Figure 5) and was 798

repressed in rPPC1-B relative to wild type. Under LL, RVE1-like was induced in 799

rPPC1-B relative to wild type, and its transcript abundance oscillated robustly, with a 800

higher amplitude oscillation than the wild type (Figure 7). These findings suggest that 801

the RVE1-like gene measured here does not likely share a role in the circadian 802

coordination of the daily CAM cycle, as has been hypothesised for Agave RVE1. In 803

fact, based on our current data for the rPPC1 lines, it is possible that RVE1-like 804

might function in coupling the core clock to the robust rhythm of DF observed in the 805

rPPC1 transgenic lines (Figure 6C). 806

In pineapple, the core clock genes PRR5 and PRR9 are rhythmic specifically 807

in the green leaf tip tissue that performs CAM (Sharma et al., 2017). By contrast, the 808

PRR7, PRR3/7 and PRR9 transcripts measured in the current study were rhythmic 809

over the LD cycle in wild type, rPPC1-A and rPPC1-B, although the levels of all three 810

PRR transcripts were higher in rPPC1-B relative to the wild type (Figure 5). 811

However, the abundance and rhythmicity of PRR3/7 and PRR9 collapsed in rPPC1-812

B under LL conditions, whereas PRR7 was induced and rhythmic (Figure 7). In S. 813

album, a member of the Crassulaceae along with Kalanchoë, the induction of weak 814

26

CAM-cycling in response to drought stress led to the repression of transcripts related 815

to GI and FKF1 and the induction of transcripts related to CCA1 and TOC1 (Wai et 816

al., 2019). However, the timing of peak transcript abundance for core clock gene 817

orthologs was largely consistent between C3 and CAM-cycling leaf samples of S. 818

album, with phase delays of 2 to 4 h at most for PRR1_A, and PRR5_A, PRR5_B 819

and PRR5_D (Wai et al., 2019). In rPPC1-B under LD cycles, only changes in the 820

transcript peaks of CCA1-2 (down), TOC1-1 (up) and TOC1-2 (up) were detected 821

(Figure 5). The timing of the peaks and troughs of these transcripts remained the 822

same between wild type and both rPPC1 lines. GI and FKF1 transcript oscillations 823

and peak abundance were remarkably similar between wild type and the two rPPC1 824

lines under LD cycles (Figure 5). However, under LL conditions, CCA1-2, TOC1-1, 825

TOC1-2, GI and FKF1 were all induced relative to the wild type and oscillated more 826

robustly, with lengthening periods as the LL time course progressed (Figure 7). 827

Overall, there were no clear and consistent correlations between the transcript 828

abundance cycles of core clock gene transcripts reported here for K. laxiflora wild 829

type and RNAi lines with reduced PPC1 levels and the published RNA-seq data for 830

the LD cycles of transcript abundance of the orthologous genes in Agave, pineapple 831

and S. album. Furthermore, it was not possible to detect any temporal patterns of 832

regulation of core clock gene transcripts between different species or between C3 833

and CAM tissues in individual species, which would suggest that conserved 834

alterations in the core clock have accompanied the evolution of CAM in these 835

diverse CAM lineages. 836

837

Contrasting Core Clock Responses Between rPPC1 and rPPCK1 RNAi Lines 838

839

Similar to the LL CO2 fixation phenotype reported here for rPPC1-B, transgenic K. 840

fedtschenkoi lines lacking PPCK1 also lost the CO2 fixation rhythm, and the 841

transcript oscillations of many core clock genes were altered (Boxall et al., 2017). 842

However, different core clock genes were perturbed in rPPC1-B compared to those 843

whose rhythmic regulation changed in the rPPCK1 lines of K. fedtschenkoi (Boxall et 844

al., 2017 cf. Figure 7). In rPPC1-B, CCA1-1 transcript oscillations dampened, and 845

both TOC1-1 and TOC1-2 transcripts were up-regulated and oscillated with a 846

delayed peak phase relative to the wild type (Figure 7H, 7J and 7K). By contrast, in 847

line rPPCK1-3, the transcription of clock genes CCA1-1, CCA1-2 and TOC1-2 848

27

dampened rapidly towards arrhythmia under LL free-running conditions, whereas 849

TOC1-1 was up-regulated and rhythmic (Boxall et al., 2017). Furthermore, whilst 850

PRR7 was up-regulated and rhythmic in rPPC1-B (Figure 7), the same gene 851

dampened to arrhythmia in rPPCK1-3 after an initial induced peak during the first 6 h 852

of LL (Boxall et al., 2017). The evening phased genes GI and FKF1 were induced 853

and rhythmic under LL conditions in both rPPC1-B and rPPCK1-3, but the level of 854

transcript induction and the rhythm amplitude were much greater in rPPC1-B (Figure 855

7U and 7V), suggesting that these two clock genes are more important for robust 856

oscillations in C3 leaves. 857

Overall, these differences between the rhythms of core clock genes in rPPC1-858

B and rPPCK1-3 revealed that the clock responded very differently to the silencing of 859

two interconnected genes that lie at the heart of the circadian control of nocturnal 860

CO2 fixation. Elucidating the mechanistic basis for these differences should be a 861

fruitful avenue for further investigation, especially in light of the proposed cross-talk 862

between CAM-associated metabolites and regulation within the core clock (Boxall et 863

al., 2017), which was further supported by the clock gene phenotypes reported here 864

(Figure 7). 865

866

Interactions Between Sugars Linked to CAM and the Core Circadian Clock 867

868

In Arabidopsis, sugars associated with primary photosynthetic metabolism play a 869

role in the entrainment of the core circadian oscillator in the nucleus (Haydon et al., 870

2013). In particular, PRR7 is thought to be required for sensing metabolic status and 871

coordinating the clock with photosynthesis (Haydon et al., 2013). In rPPC1-B, the 872

low sucrose levels at 2 h after dawn (Figure 3C) may be sensed via a mechanism 873

involving PRR7 (Boxall et al., 2017). However, in Kalanchoë, a second PRR7-related 874

gene, PRR3/7, produced the more abundant transcript and displayed a transcript 875

peak 2 h before dusk under LD (Figure 5T). In the wild type, PRR3/7 may function as 876

part of a signal transduction pathway that senses metabolic status at dusk when 877

primary CO2 fixation begins (Haydon et al., 2013; Boxall et al., 2017). 878

879

rPPC1 and rPPCK1 Mutants Display Contrasting Levels of Delayed 880

Fluorescence Circadian Rhythms 881

882

28

Delayed fluorescence (DF) circadian rhythms were more robust than the wild type in 883

rPPC1-A and rPPC1-B (Figure 6C). This result represents one of the most striking 884

contrasts to the previous finding of arrhythmic DF in the K. fedtschenkoi rPPCK1-3 885

line (Boxall et al., 2017). This fundamental difference provides important insights into 886

the regulatory signal transduction network underpinning the DF rhythm, which 887

originates from inside the chloroplasts due to the changing redox state of the 888

plastoquinone pool (Gould et al., 2009). In terms of core clock gene regulation under 889

both LD and LL, CCA1-2, TOC1-2, PRR7 and the clock-controlled gene CDF2 were 890

all induced and rhythmic in rPPC1-B. Thus, CCA1-2, TOC1-2, PRR7 and CDF2 are 891

the most likely candidates for driving the induction and robust LL rhythmicity of DF in 892

rPPC1-B. Conversely, the decline in the amount and rhythmicity of these transcripts 893

in rPPCK1-3 may play a role in the dampening of the DF rhythms in the absence of 894

nocturnal phosphorylation of PPC1 (Boxall et al., 2017). 895

These results also allow us to propose that robust rhythmicity of the CAM-896

associated CO2 fixation rhythm in wild type Kalanchoë is most likely driven by an 897

underlying oscillator consisting of CCA1-1, PRR3/7, PRR9, and LNK3-like. This 898

hypothesis is supported by the finding that the rhythmicity of these core clock 899

components responded in the same way in both rPPC1-B and the previously 900

reported rPPCK1-3 transgenic lines of Kalanchoë (Boxall et al., 2017). However, 901

only a limited set of core clock and clock-associated genes has been profiled under 902

LL in rPPC1-B and rPPCK1-3, making it likely that other clock-associated genes are 903

also involved in driving robust CAM CO2 fixation rhythms and robust DF rhythms. 904

905

Perturbation of diel rhythms of gene transcript oscillations in GCs 906

907

A key gap in the current understanding of the molecular genetics underpinning the 908

physiology associated with CAM centres on the cell signalling mechanisms that 909

mediate the inverse pattern, relative to C3, of stomatal opening and closing (Borland 910

et al., 2014; Males and Griffiths, 2017). The GCs of CAM leaves and stems are 911

thought to respond directly to the internal supply of CO2. This theory has recently led 912

several groups to use whole leaf RNA-seq datasets to investigate alterations, relative 913

to C3 leaves, in the temporal phasing of known GC regulatory genes and membrane 914

transporters (Abraham et al., 2016; Wai and VanBuren, 2018; Yin et al., 2018; 915

Heyduk et al., 2019; Moseley et al., 2019). However, these studies did not use 916

29

enriched GCs as the source of RNA, and therefore the data that were mined 917

represented all leaf cell types, including palisade and spongy mesophyll, GCs, 918

subsidiary cells, phloem, phloem companion cells, xylem, bundle sheath, and water 919

storage parenchyma in Agave and pineapple. Thus, the re-scheduling of the 920

temporal patterns of candidate GC genes in these datasets may have been 921

complicated by transcripts from the same genes that were functional in other leaf cell 922

types. 923

Separated epidermal peels from Kalanchoë CAM leaves are enriched for 924

intact GCs. We leveraged this feature in order to compare the temporal pattern of 925

transcript regulation between GC-enriched epidermal peels of the wild type and 926

rPPC1-B (Figure 8). Relative to the wild type, a wide range of genes known to be 927

involved in stomatal opening and closing displayed alterations in transcript 928

abundance and/or the timing of the daily transcript peak (Figure 8A to 8U). These 929

results support the theory that the measured changes in transcript abundance and 930

temporal patterns for a range of guard cell regulatory genes were connected to the 931

measured changes in stomatal opening and closing (Figure 4B). 932

Thus, the up-regulation of HT1, SKOR and MYB61 in the wild type relative to 933

rPPC1-B, and the down-regulation of a wide range of genes in the wild type, 934

including SLAC1, PP2C, SOS2, ACA2, ECA4, and MYB60, are likely important 935

regulatory changes that facilitate nocturnal stomatal opening and light period closure 936

(Figure 4 and 8). As MYB60 is required for stomatal opening in response to light in 937

C3 Arabidopsis (Cominelli et al., 2005), it is particularly noteworthy that its transcript 938

abundance in wild type K. laxiflora GC-enriched epidermal peels peaked at dusk, 939

when stomata open in the wild type (Figure 8LL). Furthermore, in rPPC1-B, MYB60 940

also had a dramatic 3- to 4-fold induction at dawn relative to the wild type, 941

suggesting that high MYB60 transcript levels at the start of the light period may play 942

a key role in the observed light period stomatal opening of the rPPC1-B line (Figure 943

4B). It was also notable that rPPC1-B continued to have a peak of MYB60 transcripts 944

phased to dusk, as observed for the wild type, which is in agreement with the 945

observation that rPPC1-B did open its stomata slightly throughout the dark period 946

(Figure 4B). However, this nocturnal stomatal opening was futile in terms of 947

atmospheric CO2 fixation, as rPPC1-B released respired CO2 from its leaves 948

throughout the dark period (Figure 4A). Overall, MYB60, as well as several other 949

mis-regulated guard cell signalling, ion channel, and metabolite transporter genes 950

30

(Figure 8 and Supplemental Figure 5), represent key targets for future genetic 951

manipulation experiments in transgenic Kalanchoë aimed at understanding the 952

important regulators underpinning the inverse stomatal control associated with CAM. 953

954

Informing Biodesign Strategies for Engineering CAM into C3 crops 955

956

Efforts are underway to engineer CAM and its associated increased WUE into C3 957

species as a means to develop more climate-resilient crop varieties that can 958

continue to fix CO2 and grow in the face of drought, whilst using water more wisely 959

than C3 varieties (Borland et al., 2014; Borland et al., 2015; Lim et al., 2019). The 960

data presented here for the rPPC1 loss-of-function lines of K. laxiflora confirm 961

experimentally the proposed core role of PPC1 for efficient and optimised CAM. Our 962

results also provide encouragement that the level of over-expression of a CAM-963

recruited PPC1 gene introduced into an engineered C3 species may not need to be 964

as high as the level found in extant obligate CAM species, because reducing PPC1 965

levels to only 43% of wild type activity in line rPPC1-A led to plants that were still 966

capable of full CAM and fixed more CO2 than the wild type over 3 weeks of drought 967

(Figure 4D). 968

The results presented here also emphasise that only certain sub-components 969

of the core circadian clock are essential for the temporal optimisation of CAM in 970

Kalanchoë, which in turn further simplifies the challenge of achieving correct 971

temporal control of an engineered CAM pathway introduced into a C3 species. It is 972

clear from our current RT-qPCR data that the transgenic manipulation of the 973

expression and regulation of CCA1-1, PRR3/7, PRR9 and LNK3-like in Kalanchoë 974

using RNAi, over-expression and/or CRISPR-Cas mediated gene editing, will allow 975

the further refinement of the evolving model for the subset of core clock genes that 976

form the transcription-translation feedback loop that underpins the temporal 977

optimisation of CAM. However, in addition, transcriptome-wide analysis of the light/ 978

dark regulation of all detectable transcripts in LP6 of rPPC1-B compared to the wild 979

type will allow the identification of other candidate core clock genes that were not 980

profiled in the targeted RT-qPCR analysis presented here. 981

982 METHODS 983 984

31

Plant Materials 985

986

Kalanchoë laxiflora plants were propagated clonally from adventitious plantlets in the 987

leaf margin using the same clonal stock originally obtained from the Royal Botanic 988

Gardens (RBG), Kew in 2008: accession number 1982-6028, which was kindly 989

provided by the RBG-Kew Living Collection but mis-identified under the name K. 990

fedtschenkoi. Plants were initially grown in a heated transgenic greenhouse with 991

supplementary lighting (Gavita reflector lamps HPS-R Agro 600 W S-281) providing 992

year round 16-h-light/ 8-h-dark, minimum light intensity at plant height of 300–400 993

µmoles photons m-2 s-1, and a minimum temperature of 20˚C. Prior to all experiments, 994

clonal populations of developmentally synchronised plants raised under greenhouse 995

conditions were entrained in a Snijders Microclima MC-1000 growth cabinet for 7-days 996

under 12-h-light/ 12-h-dark and/ or subsequently released into constant light and 997

temperature conditions according to Boxall et al. (2017). 998

999

Time Course Experiments 1000

1001

For both light/dark and LL time course experiments, opposite pairs of leaf pair 6 (LP6) 1002

were collected every 4 h over a 12-h-light/12-h-dark cycle (12:12 LD), starting 2 h 1003

(02:00) after the lights came on at 00:00 h. Plants were entrained for 7-days in a 1004

Snijders Microclima MC-1000 growth cabinet with fluorescent lamps (20 Phillips TL5-1005

HO and 3 Phillips TLD-90 providing a mixed spectrum from 400 – 650 nm) set to 12-h-1006

light (450 µmoles photons m-2 s-1), 25˚C, 60% humidity/12-h-dark, 15˚C, 70% 1007

humidity. For constant light, constant temperature, constant humidity (LL) free-running 1008

circadian time course experiments, plants were entrained under 12-h-light/ 12-h-dark 1009

(LD) conditions as above and switched to LL after a dark period. For LL, the constant 1010

conditions were: light 100 µmoles photons m-2 s-1, temperature 15˚C and humidity 1011

70%. For both LD and LL experiments, LP6 were sampled every 4 h from three 1012

individual (clonal) plants, starting at 02:00 (2 h after lights on). All leaf samples were 1013

immediately frozen in liquid nitrogen and stored at -80°C until use. 1014

1015

Generation of Transgenic K. laxiflora Lines 1016

1017

32

An intron-containing hairpin RNAi construct was designed to target the silencing of 1018

both copies of the CAM-associated PPC1 gene in the tetraploid K. laxiflora genome 1019

(JGI Phytozome accession numbers: Kalax.0018s0056.1 and Kalax.0021s0061.1, 1020

which are the K. laxiflora orthologues of the previously characterised K. fedtschenkoi 1021

CAM-associated PPC1, GenBank accession: KM078709). A 323 bp fragment was 1022

amplified from CAM leaf cDNA using high fidelity PCR with KOD Hot Start DNA 1023

Polymerase (Merck, Germany). The amplified fragment spanned the 3' end of the 1024

PPC1 coding sequence and extended into the 3' untranslated region to ensure 1025

specificity of the silencing to both of the aforementioned CAM-associated PPC1 1026

gene copies. Alignment of the 323 bp region with the homologous regions from the 1027

three other plant-type PPC genes, and their homeologs, in the K. laxiflora genome 1028

demonstrated that none of the other PPC genes shared any 21 nucleotide stretches 1029

that were an exact match for the 323 bp PPC1 RNAi fragment. Thus, the RNAi 1030

construct in the hairpin RNA binary vector used to generate the stable transgenic 1031

lines was predicted to silence only the two homeologous copies of the CAM-1032

associated PPC1, and to be equally specific and efficient at silencing both copies. 1033

This specificity and equality of silencing efficiency was confirmed by the RT-qPCR 1034

data in Figure 1, as the qPCR primers targeted both copies of the CAM-associated 1035

PPC1 (Supplemental Figure 1), and so the quantitative signal is representative of the 1036

averaged signal for the transcript abundance of the two gene copies. 1037

The primers used for the amplification of the PPC1 gene fragment cloned to 1038

generate the hairpin RNAi binary construct were: PPC1 RNAi F 5’ 1039

CACCAAGCTACCAAGTGCCGGTG 3’, and PPC1 RNAi R 5’ 1040

CCCTCCTGCTGCTGCTGCTGC 3’. The PCR product was cloned into the pENTR/D 1041

Gateway-compatible entry vector, as described previously (Dever et al., 2015). 1042

Following confirmation of the correct sequence and orientation of the PPC1 fragment 1043

in the ENTRY vector using Sanger sequencing, the pENTR/D PPC1 RNAi clone was 1044

recombined into intron-containing hairpin RNAi binary vector pK7GWIWG2(II) 1045

(Karimi et al., 2002) using LR Clonase II enzyme mix (Life Technologies). 1046

Agrobacterium-mediated stable transformation of K. laxiflora was achieved using a 1047

method described previously for the very closely related species K. fedtschenkoi 1048

(Dever et al., 2015), with the following changes. For K. laxiflora transformation, the 1049

initial sterile leaf explants used for dipping in Agrobacterium tumefaciens GV3101 1050

carrying the engineered binary vector were generated by germinating surface-1051

33

sterilised K. laxiflora seeds on Murashige and Skoog medium with Gamborgs B-5 1052

vitamins (Murashige and Skoog, 1962; Gamborg et al., 1968) and 3% sucrose. 4- to 1053

6-week-old seedlings grown by tissue culture were chopped into explants for 1054

transformation in a sterile laminar flow bench using a sterile scalpel. The explants 1055

were dipped in the Agrobacterium suspension carrying the PPC1 RNAi binary vector, 1056

and co-cultivated and regenerated as described previously (Dever et al., 2015). 1057

1058

High-Throughput Leaf Acidity and Starch Content Screens 1059

1060

Leaf acidity (as a proxy for leaf malate content) and leaf starch content were 1061

screened in stained leaf discs using chlorophenol red and iodine solution at both 1062

dawn and dusk as described by Cushman et al. (2008). For each transgenic line, leaf 1063

discs were sampled from LP6 in triplicate at 1 hour before dawn and 1 hour before 1064

dusk and stained in a 96 well plate format. 1065

1066

Net CO2 Exchange Measurement Using Whole Young Plants 1067

1068

Whole plant gas exchange measurements were collected over a period of 27-days 1069

using 2-month-old plants at the 9-leaf-pairs stage (results shown in Figure 4D). Four 1070

individual clones per line were potted in 150 ml beakers of compost mix, which was 1071

initially watered to field capacity, and the beakers were sealed with Parafilm around 1072

the rim of the beaker and the base of the stem. Beakers with potted plants were 1073

lowered into the lower half of each of the 12 gas exchange cuvettes. Lids were sealed 1074

over each plant using bulldog clips to create a gas tight seal due to compression of 1075

foam rubber that lined the joint between the lower and upper half of each gas 1076

exchange cuvette. During the 27-day time period, the progression into drought of 1077

young, initially well-watered, wild type plants was documented as they transitioned 1078

from displaying all four phases of CAM with a relatively low proportion of dark period 1079

CO2 fixation in phase I on day 1, through to full CAM (only phase I dark CO2 fixation 1080

and phase III CO2 refixation behind closed stomata throughout the light) from day 12, 1081

followed by recovery of all 4 phases of CAM after re-watering on day 22. 1082

Measurements were made using a custom-built, 12-channel IRGA system (PP 1083

Systems, Hitchin, UK), which allowed for individual environmental control (CO2/H2O) 1084

and measurement of the rates of CO2 uptake for each of 12 gas exchange cuvettes, 1085

34

with measurements collected every ~18 min. The system was described in full by 1086

Dever et al. (2015), but was expanded here with the addition of 6 gas exchange 1087

cuvettes, thereby doubling the scope for replication and throughput. The experiment 1088

was performed using four individual clonal young plants (2 months old, 9-leaf-pairs) 1089

per line: wild type, rPPC1-A and rPPC1-B. The four-fold replicated wild type and 1090

rPPC1 lines were compared in neighbouring gas exchange cuvettes during each 1091

experimental run, such that the data are directly comparable between each line. As 1092

the entire gas exchange system was housed in a Snijders Microclima MC-1000 1093

growth cabinet, all 12 gas exchange cuvettes were under identical conditions in terms 1094

of light intensity and temperature. 1095

1096

Measurement of Circadian Rhythms of Net CO2 Exchange Under Constant Light 1097

and Temperature Free-Running Conditions 1098

Various Kalanchoë species display a persistent and robust circadian rhythm of CO2 1099

exchange when detached CAM leaves are measured with their petiole in distilled 1100

water (Wilkins, 1959). This discovery led to the current understanding that the 1101

endogenous circadian clock underpins the optimised temporal control of CAM in 1102

Kalanchoë (Hartwell, 2006; Boxall et al., 2017). The circadian rhythm of CO2 1103

exchange was measured for wild type, rPPC1-A and rPPC1-B using both detached 1104

LP6 sampled from 4-month-old mature plants and intact young plants at the 9-leaf-1105

pairs stage (2 months old). The 12-cuvette gas-switching CIRAS-DC based gas 1106

exchange system (Dever et al., 2015) was used to measure both the detached LP6 1107

and the intact young plants with their roots in compost mix. For detached LP6, leaves 1108

were detached from each line at the base of their petiole using a scalpel, and the cut 1109

petiole was immediately immersed in distilled water by pushing the petiole through a 1110

small hole cut in Parafilm covering a 150 ml beaker of distilled water. The gas 1111

exchange cuvettes were designed to hold a 150 ml beaker in the lower half of the 1112

cuvette such that the leaves were enclosed in the clear, upside-down 1 l beaker that 1113

formed the upper section of the cuvette in which gas exchange was measured. After 1114

the upper section of each cuvette was placed over the leaves or intact young plants, 1115

the upper and lower sections of the cuvettes were sealed using bulldog clips to clamp 1116

the join, which was coated in foam-rubber sealing material to generate a gas tight 1117

seal. To measure intact young plants, individual clones of each line at the 9-leaf pairs 1118

stage were potted in compost mix in 150 ml pots that fit into the base of the gas 1119

35

exchange cuvettes, and Parafilm was used to seal around the upper rim of the beaker 1120

and the central stem of the young plant to prevent soil and root respiration from 1121

interfering with the gas exchange measured for the above ground leaf pairs (LP1 to 1122

LP9). Plants were pre-entrained to 12-h-light/ 12-h-dark cycles in a Snijders 1123

Microclima MC-1000 growth cabinet for 7-days as described above prior to release 1124

into LL free-running conditions at the end of the last dark period. For LL, the constant 1125

conditions were: light 100 µmoles photons m-2 s-1, temperature 15˚C and humidity 1126

70%. The entire gas exchange system was housed inside a Snijders Microclima MC-1127

1000 growth cabinet, so all 12 cuvettes were under identical conditions. 1128

1129

Measuring Net CO2 Exchange in Attached Leaf Pair 6 Using the LI-COR 6400XT 1130

System 1131

1132

The gas exchange of mature CAM leaves (LP6) was measured over a 12-h-light, 1133

25˚C, 60% humidity: 12-h-dark, 15˚C, 70% humidity cycle using an infra-red gas 1134

analyser (LI-6400XT, LI-COR, Inc.) attached to a large CO2 gas cylinder. Data were 1135

logged every 10 minutes using an auto-program that tracked the light and temperature 1136

regimes of the growth cabinet. 1137

1138

Measuring Leaf Malate, Starch and Sucrose Contents 1139

1140

LP6 (full CAM in wild type) from mature plants were sampled into liquid nitrogen every 1141

4 hours and at dawn and dusk and stored at -80˚C until use. Biological triplicates were 1142

sampled, where each replicate was a pair of leaves of the designated developmental 1143

age from a separate, developmentally synchronised, clonal plant of each line. The 1144

frozen leaf samples were prepared and assayed for malate and starch as described 1145

by Dever et al. (2015) using the published methods for assaying malate in an enzyme-1146

linked spectrophotometric assay (Möllering, 1985) and starch (Smith and Zeeman, 1147

2006). Sucrose, glucose, and fructose were assayed according to the manufacturer’s 1148

protocol (Megazyme Technologies). 1149

1150

Chlorophyll Assays 1151

1152

36

Chlorophyll was assayed from mature greenhouse-grown plants from leaf pairs 2-7. 1153

Biological triplicates were sampled, where each replicate was a pair of leaves of the 1154

designated developmental age from a separate, developmentally synchronised, 1155

clonal plant of each line. Chlorophyll was extracted twice from 0.5 cm diameter leaf 1156

discs in 2 ml 80% (v/v) acetone and homogenised in a bead beater (PowerLyzer 24; 1157

Mo-Bio, Inc). The tubes were centrifuged at full speed in a bench top microfuge at 1158

4˚C for 2 min, and the supernatants were combined and transferred to a new tube 1159

and protected from the light. Absorbance was read at 663 nm and 645 nm, and 1160

chlorophyll contents were calculated according to the published method (Arnon, 1161

1949). 1162

1163

Total RNA Isolation and RT-qPCR 1164

Leaf samples (LP6) for RNA isolation were collected from wild type, rPPC1-A and 1165

rPPC1-B plants every 4 h starting at 2 h after dawn for both 12-h-light/ 12-h-dark 1166

cycles, and continuous light (LL) experiments. Biological triplicates were sampled, 1167

where each replicate was a pair of leaves of the designated developmental age from 1168

a separate, developmentally synchronised, clonal plant of each line. Total RNA was 1169

isolated from 100 mg of frozen, ground leaf tissue using a Qiagen RNeasy kit 1170

(Qiagen, Germany) following the manufacturer’s protocol with the addition of 13.5 µL 1171

50 mg mL-1 PEG 20000 to the 450 µL RLC buffer used for each extraction. cDNA 1172

was synthesised from the total RNA using a Qiagen Quantitect RT kit according to 1173

the manufacturer’s instructions (Qiagen, Germany). The resulting cDNA was diluted 1174

1:4 with molecular biology grade water prior to use in RT-qPCR. Transcript levels 1175

were determined using a SensiFAST SYBR No Rox kit (Bioline) in an Agilent 1176

MX3005P qPCR System Cycler. The results for each target gene transcript of 1177

interest were normalized to the reference gene THIOESTERASE/THIOL ESTER 1178

DEHYDRASE-ISOMERASE SUPERFAMILY PROTEIN (TED; Kalax.0134s0055.1 1179

and Kalax.1110s0007.1; Arabidopsis orthologue AT2G30720.1). Gene expression in 1180

a pool of RNA generated from LP6 samples collected every 4 hours over a 12-h-1181

light/12-h-dark cycle was set to 1. Primers used for RT-qPCR analyses are listed in 1182

Supplemental Data Set 2 and were designed to target both homeologs of each gene 1183

present in the tetraploid genome. It should be noted that primers that were specific to 1184

both homeologs of CCA1-1 did not target the two CCA1-2 homeologs in the K. 1185

37

laxiflora genome. Likewise, the primers that we used to quantify transcripts from both 1186

homeologs of TOC1-1 did not target the two TOC1-2 homeologs. 1187

1188

Immunoblotting 1189

1190

Total protein extracts of K. laxiflora leaves were prepared according to Dever et al. 1191

(2015). One-dimensional SDS-PAGE and immunoblotting of leaf proteins was carried 1192

out following standard methods. Blots were developed using the ECL system (GE 1193

Healthcare, UK). Immunoblot analysis was carried out using antisera to PPC raised 1194

against purified CAM leaf PPC from K. fedtschenkoi (diluted 1:5000), kindly supplied 1195

by Prof. Hugh G. Nimmo, University of Glasgow (Nimmo et al., 1986), and the 1196

phosphorylated form of PPC (diluted 1:1000) raised against a phospho-PPC peptide 1197

from wheat, and kindly supplied by Prof. Cristina Echevarría, Universidad de Sevilla, 1198

Spain (González et al., 2002; Feria et al., 2008). The PPDK antibody (diluted 1:1000) 1199

was raised against maize (Zea mays) C4 PPDK, and the phospho-PPDK antibody 1200

(diluted 1:3000) was raised against a synthetic phospho-peptide spanning the PPDK 1201

phosphorylation site in the Z. mays C4 PPDK. Both PPDK antibodies were kindly 1202

provided by Prof. Chris J. Chastain, University of Minnesota, Moorhead, USA 1203

(Chastain et al., 2000; Chastain et al., 2002). The specificity of the antibodies used 1204

and, in the case of the phospho-peptide specific antibodies for PPC and PPDK, their 1205

target phospho-site amino acid sequences are described in the Supplemental 1206

Methods. 1207

1208

Growth Measurements 1209

1210

Mature plants of wild type and the two rPPC1 lines were grown from developmentally 1211

synchronized clonal leaf plantlets in greenhouse conditions for 4 months. At the start 1212

of the drought treatment, all the plants were watered to full capacity. Water was 1213

withheld from at least six replicate plants of each line for 28-days, and at least six 1214

plants were maintained well-watered over the same period. The plants were 1215

harvested as separated above-ground (shoot) and below-ground (root) tissues, 1216

weighed to determine fresh weight, and dried in an oven at 60˚C until they reached a 1217

constant dry weight. 1218

1219

38

PPC Assays 1220

1221

LP6 samples were taken at 6 h into the light period and frozen in liquid nitrogen. 1222

Biological triplicates were sampled, where each replicate was LP6 from a separate, 1223

developmentally synchronised, clonal plant of each line. Frozen leaf tissue was 1224

ground in liquid nitrogen with a small quantity of acid washed sand and the relevant 1225

enzyme specific extraction buffer (approximately 1 g tissue to 3 ml of extraction 1226

buffer). Extracts were prepared and PPC assays were performed according to the 1227

extraction, desalting and assay buffer conditions described previously (Dever et al., 1228

2015). 1229

1230

Determination of the Apparent Ki of PPC for L-Malate in Rapidly Desalted Leaf 1231

Extracts 1232

1233

The apparent Ki of PPC for L-malate was determined using leaf extracts that were 1234

rapidly desalted as described by Carter et al. (1991). LP6 were collected at 10:00 (2 1235

h before the end of the 12-h-light period) and 18:00 (middle of the 12-h-dark period) 1236

from three biological replicates of wild type, rPPC1-A and rPPC1-B. Each biological 1237

replicate was LP6 from a separate, developmentally synchronised, clonal plant of 1238

each line. The apparent Ki of PPC activity for feedback inhibition by L-malate was 1239

determined as described by Nimmo et al. (1984), with the modifications to the range 1240

of L-malate concentrations added to the assays as described by Boxall et al. (2017). 1241

1242

PPDK Assays 1243

1244

PPDK assays were performed using the extraction and assay buffers described 1245

previously (Kondo et al., 2000; Dever et al., 2015), with the addition of NADH and 1246

G6P (Salahas et al., 1990), and Cibercron Blue (Burnell and Hatch, 1986). Biological 1247

triplicates were sampled, where each replicate was LP6 from a separate, 1248

developmentally synchronised, clonal plant of each line. Briefly, 0.3 g of powdered 1249

leaf tissue that had previously been ground to a fine powder in liquid nitrogen was 1250

extracted in 1 ml of ice-cold extraction buffer (containing 100 mM Tris pH 8.0, 10 mM 1251

DTT, 1 mM EDTA, 1% Triton, 2.5% w/v PVPP, 2% PEG-20000, 10 mM MgCl2, 1 mM 1252

PMSF, 2 µM orthovanadate, and 10 µM Cibercron Blue) by grinding with a small 1253

39

quantity of acid washed sand in a pestle and mortar. Extracts were vortexed for 30 s 1254

and the pH was adjusted to pH 8.0. Extracts were then placed on ice for 10 min 1255

before spinning them at full speed in a benchtop microfuge at 4˚C. The supernatant 1256

(500 µl) was desalted using PD minitrap Sephadex-G25 columns (GE Healthcare). 1257

The desalting buffer contained: 100 mM Tris-HCl pH 8.0, 10 mM MgCl2, 10 mM DTT, 1258

0.1 mM EDTA, 10 µM Cibercron Blue. The desalted extracts were assayed in a plate 1259

reader at 340 nm using the following assay buffer: 100 mM Tris pH 8.0, 5 mM DTT, 1260

10 mM MgCl2, 1.25 mM Pyruvic acid, 2.5 mM NaHCO3, 2.5 mM K2HPO4, 0.25 mM 1261

NADH, 2 U Malate dehydrogenase, and 6 mM glucose 6-phosphate. The reactions 1262

were started by the addition of 0.2 U of phosphoenolpyruvate carboxylase followed 1263

by 1.25 mM ATP (pH 8.0). 1264

1265

Delayed Fluorescence (DF) Measurements 1266

1267

The imaging system for DF was identical to the luciferase and delayed fluorescence 1268

imaging system described previously (Gould et al., 2009) with the exception of the 1269

CCD camera (Retiga LUMO™ CCD Camera; Qimaging). DF was quantified using 1270

Imaris image analysis software (Bitplane) to measure mean intensity for specific 1271

regions within each image. Background intensities were calculated for each image 1272

and subtracted to calculate a final DF value for each image (Gould et al., 2009). 1273

1274

DF Rhythm Analysis 1275

1276

K. laxiflora plants were grown in greenhouse conditions for 4 months and then 1277

entrained in 12-h light (450 µmoles m-2 s-1), 25°C, 60% humidity/ 12-h dark, 15°C, 1278

70% humidity cycles in a Snijders Microclima MC-1000 (Snijders Scientific) growth 1279

cabinet for 7-days as described previously (Dever et al., 2015). At dawn on the 8th 1280

day, 1.5-cm leaf discs were punched from each LP6 for three biological replicates 1281

(i.e., 7 leaf discs from each biological replicate, totalling 21 leaf discs per line) and 1282

placed on 0.3% Phytoagar (Duchefa Biochemie) on a 10-cm square Petri dish. The 1283

Petri dish was left under 12-h light/25˚C: 12-h dark/15°C for a further 24 h to 1284

synchronise the leaf discs. At subjective dawn, the Petri dish was placed in the 1285

imaging system at 14°C in constant red-blue light (LL). DF images were collected 1286

every hour for 120 h as described previously (Gould et al., 2009; Boxall et al., 2017). 1287

40

The DF images were processed as described by Gould et al. (2009). The 1288

luminescence was normalized by subtracting the Y value of the best straight line 1289

from the raw Y value. Biodare was used to carry out fast Fourier transform (nonlinear 1290

least square) analysis and spectral resampling on each DF time-course series using 1291

the time window from 24 to 120 h in order to generate period estimates and calculate 1292

the associated relative amplitude error (RAE) (Moore et al., 2014; Zielinski et al., 1293

2014). 1294

1295

Accession Numbers 1296

1297

Sequence data associated with this article are available via the JGI Phytozome 1298

portal for the K. laxiflora genome: https://phytozome.jgi.doe.gov Kalanchoë1299

laxiflora v1.1. The specific gene IDs for each gene measured in this work are 1300

provided in Supplemental Data Set 2. 1301

1302

Supplemental Data 1303

Supplemental Figure 1. Loading control for immunoblot analyses and PPC malate 1304

sensitivity assays. 1305

Supplemental Figure 2. Impact of loss of PPC activity on vegetative yield during 1306

growth under well-watered and drought-stressed conditions.1307

Supplemental Figure 3. Photographs demonstrating the visual appearance of small 1308

plants after 22 d drought prior to re-watering. 1309

Supplemental Figure 4. Impact of leaf age on the development of the characteristic 1310

24 h light/ dark pattern of CAM-associated CO2 exchange. 1311

Supplemental Figure 5. Impact of the loss of PPC1 on the light/dark regulation of 1312

the transcript abundance of CAM-, starch-, and circadian clock-associated genes in 1313

the CAM leaf epidermis. 1314

Supplemental Table 1. Student’s t-test analysis of PPC activity. 1315

Supplemental Table 2. Student’s t-test analysis of PPDK activity.1316

Supplemental Table 3. Student’s t-tests for chlorophyll a and b. 1317

Supplemental Table 4. Calculations for the cumulative total CO2 fixation (area 1318

under the curve) by each line during the 27-day drought-stress and re-watering 1319

experiment.1320

Supplemental Methods. 1321

41

Supplemental Data Set. 1. Student's t-test results for relative growth measurements 1322

between wild type (WT) and rPPC1-B. 1323

Supplemental Data Set 2. Primers used for RT-qPCR. 1324

1325

ACKNOWLEDGEMENTS1326

We thank Prof. Hugh Nimmo (University of Glasgow, UK), Prof. Cristina Echevarria 1327

(Universidad de Sevilla, Spain) and Prof. Chris Chastain (Minnesota State University, 1328

Moorhead, USA) for providing the antibodies used in this study. This work was 1329

supported by the U.S. Department of Energy (DOE) Office of Science, Genomic 1330

Science Program under Award Number DE-SC0008834, and in part by the 1331

Biotechnology and Biological Sciences Research Council, U.K. (BBSRC grant no. 1332

BB/F009313/1 awarded to J.H.). The contents of this article are solely the 1333

responsibility of the authors and do not necessarily represent the official views of the 1334

DOE. 1335

1336

AUTHOR CONTRIBUTIONS 1337

J.H. and S.F.B. designed the research. S.F.B. performed all of the experiments except1338

some of the tissue culture work for the regeneration of the transgenic lines, which was 1339

performed by N.K., and the statistical analysis of the delayed fluorescence data, which 1340

was performed by P.J.D.G. J.K. generated the RNAi binary construct for PPC1. L.V.D. 1341

performed the PPDK assays. J.L.W. grew and maintained the plants and helped with 1342

grinding and processing of leaf samples. P.J.D.G. helped S.F.B. with the delayed 1343

fluorescence experiments and the analysis and interpretation of the associated data. 1344

S.F.B. and J.H. wrote the manuscript.1345

1346

1347

Table 1. Analysis of CO2 uptake in wild type (WT), rPPC1-A and rPPC1-B during 1348 22-d of progressive drought-stress and for 4-days following re-watering.1349

1350 Night 1

Day 1

Total diel 1

Night 7

Day 7

Total diel 7

Night 13

Day 13

Total diel 13

Night 22

Day 22

Total diel 22

Night 27

Day 27

Total diel 27

WT (% of diel CO2 uptake)

7 93 100 52 48 100 111 -11 100 133 -33 100 56 44 100

WT CO2 uptake (µmol m-2)

78 1015 1093 698 647 1345 908 -113

795 152 -76 76 931 735 1666

rPPC1-A (% of diel CO2 uptake)

6 94 100 40 60 100 112 -12 100 128 -28 100 46 54 100

42

rPPC1-A CO2 uptake (µmol m-2)

73 1081 1008 553 814 1367 922 120 802 209 -81 130 768 889 1657

rPPC1-B (% of diel CO2 uptake)

-26 126 100 -14 114 100 -6 106 100 -27 -73 100 -17 117 100

rPPC1-B CO2 uptake (µmol m-2)

-575 1653 1078 -254 1759 1506 -17 161 145 -8 -22 -30 -385 1825 1440

Table Footnote: Data are presented for selected days (1, 7, 13, 22 and 27) throughout the 1351 27-day drought-stress and re-watering experiment. Results expressed as percentages were1352 calculated separately for the 12-h-light and 12-h-dark periods by determining the percentage 1353 of the total diel/ 24 h CO2 uptake that occurred in that period. The actual CO2 uptake over 1354 the 12-h-light and 12-h-dark period is also presented for each line. 1355

1356 REFERENCES 1357

1358 Abraham, P.E., Yin, H., Borland, A.M., Weighill, D., Lim, S.D., De Paoli, H.C., Engle, 1359

N., Jones, P.C., Agh, R., Weston, D.J., Wullschleger, S.D., Tschaplinski, T., 1360 Jacobson, D., Cushman, J.C., Hettich, R.L., Tuskan, G.A., and Yang, X. 1361 (2016). Transcript, protein and metabolite temporal dynamics in the CAM 1362 plant Agave. Nat Plants 2: Art. No. 16178. 1363

Ache, P., Becker, D., Ivashikina, N., Dietrich, P., Roelfsema, M.R.G., and Hedrich, R. 1364 (2000). GORK, a delayed outward rectifier expressed in guard cells of 1365 Arabidopsis thaliana, is a K+-selective, K+-sensing ion channel. FEBS Lett. 1366 486: 93-98. 1367

Alonso-Cantabrana, H., Cousins, A.B., Danila, F.R., Ryan, T., Sharwood, R.E., von 1368 Caemmerer, S., and Furbank, R.T. (2018). Diffusion of CO2 across the 1369 mesophyll-bundle sheath cell interface in a C4 plant with genetically reduced 1370 PEP carboxylase activity. Plant Physiol. 178: 72 - 81. 1371

Anderson, C.M., and Wilkins, M.B. (1989). Period and Phase Control by 1372 Temperature in the Circadian Rhythm of Carbon Dioxide Fixation in 1373 Illuminated Leaves of Bryophyllum fedtschenkoi. Planta 177: 456-469. 1374

Arnon, D.I. (1949). Copper enzymes in isolated chloroplasts. Polyphenol oxidase in 1375 Beta vulgaris. Plant Physiol. 24: 1-15. 1376

Blatt, M.R. (2016). Plant Physiology: Redefining the Enigma of Metabolism in 1377 Stomatal Movement. Curr. Biol. 26: R107-R109. 1378

Boccalandro, H.E., Giordano, C.V., Ploschuk, E.L., Piccoli, P.N., Bottini, R., and 1379 Casal, J.J. (2012). Phototropins But Not Cryptochromes Mediate the Blue 1380 Light-Specific Promotion of Stomatal Conductance, While Both Enhance 1381 Photosynthesis and Transpiration under Full Sunlight. Plant Physiol. 158: 1382 1475-1484. 1383

Borland, A.M., Griffiths, H., Hartwell, J., and Smith, J.A.C. (2009). Exploiting the 1384 potential of plants with crassulacean acid metabolism for bioenergy 1385 production on marginal lands. J. Exp. Bot. 60: 2879-2896. 1386

Borland, A.M., Guo, H.B., Yang, X., and Cushman, J.C. (2016). Orchestration of 1387 carbohydrate processing for crassulacean acid metabolism. Curr. Opin. Plant 1388 Biol. 31: 118-124. 1389

Borland, A.M., Wullschleger, S.D., Weston, D.J., Hartwell, J., Tuskan, G.A., Yang, 1390 X., and Cushman, J.C. (2015). Climate-resilient agroforestry: physiological 1391 responses to climate change and engineering of crassulacean acid 1392 metabolism (CAM) as a mitigation strategy. Plant, Cell Environ. 38: 1833-1393 1849. 1394

43

Borland, A.M., Hartwell, J., Weston, D.J., Schlauch, K.A., Tschaplinski, T.J., Tuskan, 1395 G.A., Yang, X., and Cushman, J.C. (2014). Engineering crassulacean acid 1396 metabolism to improve water-use efficiency. Trends Plant Sci. 19: 327-338. 1397

Boxall, S.F., Dever, L.V., Knerova, J., Gould, P.D., and Hartwell, J. (2017). 1398 Phosphorylation of Phosphoenolpyruvate Carboxylase Is Essential for 1399 Maximal and Sustained Dark CO2 Fixation and Core Circadian Clock 1400 Operation in the Obligate Crassulacean Acid Metabolism Species Kalanchoë 1401 fedtschenkoi. Plant Cell 29: 2519-2536. 1402

Boxall, S.F., Foster, J.M., Bohnert, H.J., Cushman, J.C., Nimmo, H.G., and Hartwell, 1403 J. (2005). Conservation and divergence of circadian clock operation in a 1404 stress-inducible Crassulacean acid metabolism species reveals clock 1405 compensation against stress. Plant Physiol. 137: 969-982. 1406

Brilhaus, D., Brautigam, A., Mettler-Altmann, T., Winter, K., and Weber, A.P.M. 1407 (2016). Reversible Burst of Transcriptional Changes during Induction of 1408 Crassulacean Acid Metabolism in Talinum triangulare. Plant Physiol. 170: 1409 102-122. 1410

Burnell, J.N., and Hatch, M.D. (1986). Activation and inactivation of an enzyme 1411 catalyzed by a single, bifunctional protein - a new example and why. Arch 1412 Biochem Biophys 245: 297-304. 1413

Cai, J., Liu, X., Vanneste, K., Proost, S., Tsai, W.C., Liu, K.W., Chen, L.J., He, Y., 1414 Xu, Q., Bian, C., Zheng, Z.J., Sun, F.M., Liu, W.Q., Hsiao, Y.Y., Pan, Z.J., 1415 Hsu, C.C., Yang, Y.P., Hsu, Y.C., Chuang, Y.C., Dievart, A., Dufayard, J.F., 1416 Xu, X., Wang, J.Y., Wang, J., Xiao, X.J., Zhao, X.M., Du, R., Zhang, G.Q., 1417 Wang, M.N., Su, Y.Y., Xie, G.C., Liu, G.H., Li, L.Q., Huang, L.Q., Luo, Y.B., 1418 Chen, H.H., de Peer, Y.V., and Liu, Z.J. (2015). The genome sequence of the 1419 orchid Phalaenopsis equestris. Nat. Genet. 47: 65-72. 1420

Carter, P.J., Nimmo, H.G., Fewson, C.A., and Wilkins, M.B. (1990). Bryophyllum 1421 fedtschenkoi protein phosphatase type 2A can dephosphorylate 1422 phosphoenolpyruvate carboxylase. FEBS Lett. 263: 233-236. 1423

Carter, P.J., Nimmo, H.G., Fewson, C.A., and Wilkins, M.B. (1991). Circadian 1424 Rhythms in the Activity of a Plant Protein Kinase. EMBO J. 10: 2063-2068. 1425

Chastain, C.J., Botschner, M., Harrington, G.E., Thompson, B.J., Mills, S.E., Sarath, 1426 G., and Chollet, R. (2000). Further analysis of maize C4 1427 pyruvate,orthophosphate dikinase phosphorylation by its bifunctional 1428 regulatory protein using selective substitutions of the regulatory Thr-456 and 1429 catalytic His-458 residues. Arch Biochem Biophys 375: 165-170. 1430

Chastain, C.J., Fries, J.P., Vogel, J.A., Randklev, C.L., Vossen, A.P., Dittmer, S.K., 1431 Watkins, E.E., Fiedler, L.J., Wacker, S.A., Meinhover, K.C., Sarath, G., and 1432 Chollet, R. (2002). Pyruvate,orthophosphate dikinase in leaves and 1433 chloroplasts of C3 plants undergoes light-/dark-induced reversible 1434 phosphorylation. Plant Physiol. 128: 1368-1378. 1435

Chater, C., Peng, K., Movahedi, M., Dunn, J.A., Walker, H.J., Liang, Y.K., 1436 McLachlan, D.H., Casson, S., Isner, J.C., Wilson, I., Neill, S.J., Hedrich, R., 1437 Gray, J.E., and Hetherington, A.M. (2015). Elevated CO2-Induced Responses 1438 in Stomata Require ABA and ABA Signaling. Curr. Biol. 25: 2709-2716. 1439

Cheng, N.-H., Pittman, J.K., Zhu, J.-K., and Hirschi, K.D. (2004). The Protein Kinase 1440 SOS2 Activates the Arabidopsis H+/Ca2+ Antiporter CAX1 to Integrate 1441 Calcium Transport and Salt Tolerance. J. Biol. Chem. 279: 2922-2926. 1442

44

Chollet, R., Vidal, J., and O’Leary, M.H. (1996). Phosphoenolpyruvate carboxylase: 1443 A ubiquitous, highly regulated enzyme in plants. Annu. Rev. Plant Physiol. 1444 Plant Mol. Biol. 47: 273-298. 1445

Cominelli, E., Galbiati, M., Vavasseur, A., Conti, L., Sala, T., Vuylsteke, M., 1446 Leonhardt, N., Dellaporta, S.L., and Tonelli, C. (2005). A guard-cell-specific 1447 MYB transcription factor regulates stomatal movements and plant drought 1448 tolerance. Curr. Biol. 15: 1196-1200. 1449

Cushman, J.C., Davis, S.C., Yang, X., and Borland, A.M. (2015). Development and 1450 use of bioenergy feedstocks for semi-arid and arid lands. J. Exp. Bot. 66: 1451 4177 - 4193. 1452

Cushman, J.C., Agarie, S., Albion, R.L., Elliot, S.M., Taybi, T., and Borland, A.M. 1453 (2008). Isolation and characterization of mutants of common ice plant 1454 deficient in Crassulacean acid metabolism. Plant Physiol. 147: 228-238. 1455

Daloso, D.M., Williams, T.C.R., Antunes, W.C., Pinheiro, D.P., Muller, C., Loureiro, 1456 M.E., and Fernie, A.R. (2016). Guard cell-specific upregulation of sucrose1457 synthase 3 reveals that the role of sucrose in stomatal function is primarily1458 energetic. New Phytol. 209: 1470-1483.1459

Daszkowska-Golec, A., and Szarejko, I. (2013). Open or close the gate - stomata 1460 action under the control of phytohormones in drought stress conditions. Front 1461 Plant Sci 4: 138-138. 1462

Davies, B.N., and Griffiths, H. (2012). Competing carboxylases: circadian and 1463 metabolic regulation of Rubisco in C3 and CAM Mesembryanthemum1464 crystallinum L. Plant, Cell Environ. 35: 1211-1220. 1465

DePaoli, H.C., Borland, A.M., Tuskan, G.A., Cushman, J.C., and Yang, X. (2014). 1466 Synthetic biology as it relates to CAM photosynthesis: challenges and 1467 opportunities. J. Exp. Bot. 65: 3381-3393. 1468

Dever, L.V., Boxall, S.F., Knerova, J., and Hartwell, J. (2015). Transgenic 1469 Perturbation of the Decarboxylation Phase of Crassulacean Acid Metabolism 1470 Alters Physiology and Metabolism But Has Only a Small Effect on Growth. 1471 Plant Physiol. 167: 44-59. 1472

Dever, L.V., Blackwell, R.D., Fullwood, N.J., Lacuesta, M., Leegood, R.C., Onek, 1473 L.A., Pearson, M., and Lea, P.J. (1995). The Isolation and Characterization of1474 Mutants of the C4 Photosynthetic Pathway. J. Exp. Bot. 46: 1363-1376.1475

Feria, A.B., Alvarez, R., Cochereau, L., Vidal, J., García-Mauriño, S., and 1476 Echevarría, C. (2008). Regulation of phosphoenolpyruvate carboxylase 1477 phosphorylation by metabolites and abscisic acid during the development and 1478 germination of barley seeds. Plant Physiology 148: 761-774. 1479

Fulton, D.C., Stettler, M., Mettler, T., Vaughan, C.K., Li, J., Francisco, P., Gil, D., 1480 Reinhold, H., Eicke, S., Messerli, G., Dorken, G., Halliday, K., Smith, A.M., 1481 Smith, S.M., and Zeeman, S.C. (2008). ß-AMYLASE4, a noncatalytic protein 1482 required for starch breakdown, acts upstream of three active ß-amylases in 1483 Arabidopsis chloroplasts. Plant Cell 20: 1040-1058. 1484

Gamborg, O.L., Miller, R.A., and Ojima, K. (1968). Nutrient requirements of 1485 suspension cultures of soybean root cells. Exp. Cell Res. 50: 151-158. 1486

Gaymard, F., Pilot, G., Lacombe, B., Bouchez, D., Bruneau, D., Boucherez, J., 1487 Michaux-Ferriere, N., Thibaud, J.B., and Sentenac, H. (1998). Identification 1488 and disruption of a plant shaker-like outward channel involved in K+ release 1489 into the xylem sap. Cell 94: 647-655. 1490

45

González, M.-C., Echevarria, C., Vidal, J., and Cejudo, F.J. (2002). Isolation and 1491 characterisation of a wheat phosphoenolpyruvate carboxylase gene. 1492 Modelling of the encoded protein. Plant Science 162: 233-238. 1493

Gould, P.D., Diaz, P., Hogben, C., Kusakina, J., Salem, R., Hartwell, J., and Hall, A. 1494 (2009). Delayed fluorescence as a universal tool for the measurement of 1495 circadian rhythms in higher plants. Plant J. 58: 893-901. 1496

Grondin, A., Rodrigues, O., Verdoucq, L., Merlot, S., Leonhardt, N., and Maurel, C. 1497 (2015). Aquaporins Contribute to ABA-Triggered Stomatal Closure through 1498 OST1-Mediated Phosphorylation. Plant Cell 27: 1945-1954. 1499

Gross, S.M., Martin, J.A., Simpson, J., Abraham-Juarez, M.J., Wang, Z., and Visel, 1500 A. (2013). De novo transcriptome assembly of drought tolerant CAM plants, 1501 Agave deserti and Agave tequilana 1502

. BMC Genomics 14: Art. No. 563. 1503 Hartwell, J. (2005). The co-ordination of central plant metabolism by the circadian 1504

clock. Biochem. Soc. Trans. 33: 945-948. 1505 Hartwell, J. (2006). The circadian clock in CAM plants. In Endogenous Plant 1506

Rhythms, A.J.W. Hall and H.G. McWatters, eds (Oxford, UK: Blackwell 1507 Publishing Ltd), pp. 211 - 236. 1508

Hartwell, J., Dever, L.V., and Boxall, S.F. (2016). Emerging model systems for 1509 functional genomics analysis of Crassulacean acid metabolism. Curr. Opin. 1510 Plant Biol. 31: 100-108. 1511

Hartwell, J., Smith, L., Wilkins, M., Jenkins, G., and Nimmo, H. (1996). Higher plant 1512 phosphoenolpyruvate carboxylase kinase is regulated at the level of 1513 translatable mRNA in response to light or a circadian rhythm. Plant J. 10: 1514 1071-1078. 1515

Hartwell, J., Gill, A., Nimmo, G.A., Wilkins, M.B., Jenkins, G.L., and Nimmo, H.G. 1516 (1999). Phosphoenolpyruvate carboxylase kinase is a novel protein kinase 1517 regulated at the level of expression. Plant J. 20: 333-342. 1518

Hashimoto, M., Negi, J., Young, J., Israelsson, M., Schroeder, J.I., and Iba, K. 1519 (2006). Arabidopsis HT1 kinase controls stomatal movements in response to 1520 CO2. Nat. Cell Biol. 8: 391-397. 1521

Hashimoto-Sugimoto, M., Higaki, T., Yaeno, T., Nagami, A., Irie, M., Fujimi, M., 1522 Miyamoto, M., Akita, K., Negi, J., Shirasu, K., Hasezawa, S., and Iba, K. 1523 (2013). A Munc13-like protein in Arabidopsis mediates H+-ATPase 1524 translocation that is essential for stomatal responses. Nature Communications 1525 4: Art. No. 2215. 1526

Haydon, M.J., Mielczarek, O., Robertson, F.C., Hubbard, K.E., and Webb, A.A.R. 1527 (2013). Photosynthetic entrainment of the Arabidopsis thaliana circadian 1528 clock. Nature 502: 689-692. 1529

Hedrich, R., and Geiger, D. (2017). Biology of SLAC1-type anion channels - from 1530 nutrient uptake to stomatal closure. New Phytol. 216: 46-61. 1531

Helfer, A., Nusinow, D.A., Chow, B.Y., Gehrke, A.R., Bulyk, M.L., and Kay, S.A. 1532 (2011). LUX ARRHYTHMO encodes a nighttime repressor of circadian gene 1533 expression in the Arabidopsis core clock. Curr. Biol. 21: 126-133. 1534

Heyduk, K., Ray, J.N., Ayyampalayam, S., and Leebens-Mack, J. (2018). Shifts in 1535 gene expression profiles are associated with weak and strong Crassulacean 1536 acid metabolism. Am. J. Bot. 105: 587-601. 1537

Heyduk, K., Hwang, M., Albert, V., Silvera, K., Lan, T.Y., Farr, K., Chang, T.H., 1538 Chan, M.T., Winter, K., and Leebens-Mack, J. (2019). Altered Gene 1539 Regulatory Networks Are Associated With the Transition From C3 to 1540

46

Crassulacean Acid Metabolism in Erycina (Oncidiinae: Orchidaceae). Front 1541 Plant Sci 9: Art. No. 2000. 1542

Hiyama, A., Takemiya, A., Munemasa, S., Okuma, E., Sugiyama, N., Tada, Y., 1543 Murata, Y., and Shimazaki, K. (2017). Blue light and CO2 signals converge to 1544 regulate light-induced stomatal opening. Nature Communications 8: Art. No. 1545 1284. 1546

Holtum, J.A.M., Hancock, L.P., Edwards, E.J., and Winter, K. (2017). Facultative 1547 CAM photosynthesis (crassulacean acid metabolism) in four species of 1548 Calandrinia, ephemeral succulents of arid Australia. Photosynthesis Res. 134: 1549 17-25. 1550

Horrer, D., Fluetsch, S., Pazmino, D., Matthews, J.S.A., Thalmann, M., Nigro, A., 1551 Leonhardt, N., Lawson, T., and Santelia, D. (2016). Blue Light Induces a 1552 Distinct Starch Degradation Pathway in Guard Cells for Stomatal Opening. 1553 Curr. Biol. 26: 362-370. 1554

Hu, H.H., Boisson-Dernier, A., Israelsson-Nordstrom, M., Bohmer, M., Xue, S.W., 1555 Ries, A., Godoski, J., Kuhn, J.M., and Schroeder, J.I. (2010). Carbonic 1556 anhydrases are upstream regulators of CO2-controlled stomatal movements in 1557 guard cells. Nat. Cell Biol. 12: 87-93. 1558

Imes, D., Mumm, P., Bohm, J., Al-Rasheid, K.A., Marten, I., Geiger, D., and Hedrich, 1559 R. (2013). Open stomata 1 (OST1) kinase controls R-type anion channel 1560 QUAC1 in Arabidopsis guard cells. Plant J. 74: 372-382. 1561

Jezek, M., and Blatt, M.R. (2017). The Membrane Transport System of the Guard 1562 Cell and Its Integration for Stomatal Dynamics. Plant Physiol. 174: 487-519. 1563

Karimi, M., Inze, D., and Depicker, A. (2002). GATEWAYTM vectors for 1564 Agrobacterium-mediated plant transformation. Trends Plant Sci. 7: 193-195. 1565

Kim, T.-H., Böhmer, M., Hu, H., Nishimura, N., and Schroeder, J.I. (2010). Guard 1566 Cell Signal Transduction Network: Advances in Understanding Abscisic Acid, 1567 CO2, and Ca2+ Signaling. Annu. Rev. Plant Biol. 61: 561-591. 1568

Kinoshita, T., Doi, M., Suetsugu, N., Kagawa, T., Wada, M., and Shimazaki, K. 1569 (2001). phot1 and phot2 mediate blue light regulation of stomatal opening. 1570 Nature 414: 656-660. 1571

Kluge, M., and Fischer, K. (1967). Relations between CO2-Exchange and 1572 Transpiration in Bryophyllum daigremontianum Berg. Planta 77: 212-223. 1573

Kondo, A., Nose, A., Yuasa, H., and Ueno, O. (2000). Species variation in the 1574 intracellular localization of pyruvate, Pi dikinase in leaves of crassulacean-1575 acid-metabolism plants: an immunogold electron-microscope study. Planta 1576 210: 611-621. 1577

Kore-eda, S., Noake, C., Ohishi, M., Ohnishi, J., and Cushman, J.C. (2005). 1578 Transcriptional profiles of organellar metabolite transporters during induction 1579 of crassulacean acid metabolism in Mesembryanthemum crystallinum. Funct. 1580 Plant Biol. 32: 451-466. 1581

Kore-eda, S., Nozawa, A., Okada, Y., Takashi, K., Azad, M.A., Ohnishi, J., 1582 Nishiyama, Y., and Tozawa, Y. (2013). Characterization of the plastidic 1583 phosphate translocators in the inducible crassulacean acid metabolism plant 1584 Mesembryanthemum crystallinum. Biosci Biotech Bioch 77: 1511-1516. 1585

Lee, S.B., Kim, H.U., and Suh, M.C. (2016). MYB94 and MYB96 Additively Activate 1586 Cuticular Wax Biosynthesis in Arabidopsis. Plant Cell Physiol 57: 2300-2311. 1587

Liang, Y.K., Dubos, C., Dodd, I.C., Holroyd, G.H., Hetherington, A.M., and Campbell, 1588 M.M. (2005). AtMYB61, an R2R3-MYB transcription factor controlling stomatal 1589 aperture in Arabidopsis thaliana. Curr. Biol. 15: 1201-1206. 1590

47

Lim, S.D., Lee, S., Choi, W.-G., Yim, W.C., and Cushman, J.C. (2019). Laying the 1591 Foundation for Crassulacean Acid Metabolism (CAM) Biodesign: Expression 1592 of the C4 Metabolism Cycle Genes of CAM in Arabidopsis. Front Plant Sci 10: 1593 Art. No 101. 1594

Liu, J., Ishitani, M., Halfter, U., Kim, C.S., and Zhu, J.K. (2000). The Arabidopsis 1595 thaliana SOS2 gene encodes a protein kinase that is required for salt 1596 tolerance. P Natl Acad Sci USA 97: 3730-3734. 1597

Lüttge, U., and Ball, E. (1978). Free Running Oscillations of Transpiration and CO2 1598 Exchange in CAM Plants without a Concomitant Rhythm of Malate Levels. Z 1599 Pflanzenphysiol 90: 69-77. 1600

Ma, Y., Szostkiewicz, I., Korte, A., Moes, D., Yang, Y., Christmann, A., and Grill, E. 1601 (2009). Regulators of PP2C Phosphatase Activity Function as Abscisic Acid 1602 Sensors. Science 324: 1064-1068. 1603

Males, J., and Griffiths, H. (2017). Stomatal Biology of CAM Plants. Plant Physiol. 1604 174: 550-560. 1605

Ming, R., VanBuren, R., Wai, C.M., Tang, H.B., Schatz, M.C., Bowers, J.E., Lyons, 1606 E., Wang, M.L., Chen, J., Biggers, E., Zhang, J.S., Huang, L.X., Zhang, L.M., 1607 Miao, W.J., Zhang, J., Ye, Z.Y., Miao, C.Y., Lin, Z.C., Wang, H., Zhou, H.Y., 1608 Yim, W.C., Priest, H.D., Zheng, C.F., Woodhouse, M., Edger, P.P., Guyot, R., 1609 Guo, H.B., Guo, H., Zheng, G.Y., Singh, R., Sharma, A., Min, X.J., Zheng, Y., 1610 Lee, H., Gurtowski, J., Sedlazeck, F.J., Harkess, A., McKain, M.R., Liao, Z.Y., 1611 Fang, J.P., Liu, J., Zhang, X.D., Zhang, Q., Hu, W.C., Qin, Y., Wang, K., 1612 Chen, L.Y., Shirley, N., Lin, Y.R., Liu, L.Y., Hernandez, A.G., Wright, C.L., 1613 Bulone, V., Tuskan, G.A., Heath, K., Zee, F., Moore, P.H., Sunkar, R., 1614 Leebens-Mack, J.H., Mockler, T., Bennetzen, J.L., Freeling, M., Sankoff, D., 1615 Paterson, A.H., Zhu, X.G., Yang, X.H., Smith, J.A.C., Cushman, J.C., Paull, 1616 R.E., and Yu, Q.Y. (2015). The pineapple genome and the evolution of CAM 1617 photosynthesis. Nat. Genet. 47: 1435-1442. 1618

Möllering, H. (1985). L-malate. Determination with malate dehydrogenase and 1619 aspartate aminotransferase. In Methods in Enzymatic Analysis, H.U. 1620 Bermeyer, J. Bermeyer, and M. Grasstl, eds (Weinheim: Verlag Chemie), pp. 1621 39 - 47. 1622

Monroe, J.D., and Storm, A.R. (2018). The Arabidopsis β-amylase (BAM) gene 1623 family: Diversity of form and function. Plant Sci. 276: 163-170. 1624

Moore, A., Zielinski, T., and Millar, A.J. (2014). Online Period Estimation and 1625 Determination of Rhythmicity in Circadian Data, Using the BioDare Data 1626 Infrastructure. In Plant Circadian Networks: Methods and Protocols, D. 1627 Staiger, ed (New York: Springer Science and Business Media), pp. 13-44. 1628

Moseley, R.C., Tuskan, G.A., and Yang, X. (2019). Comparative Genomics Analysis 1629 Provides New Insight Into Molecular Basis of Stomatal Movement in 1630 Kalanchoë fedtschenkoi. Front Plant Sci 10: Art. No. 292. 1631

Murashige, T., and Skoog, F. (1962). A revised medium for rapid growth and bio-1632 assays with tobacco tissue cultures. Physiol. Plant. 15: 473-497. 1633

Neuhaus, H.E., and Schulte, N. (1996). Starch degradation in chloroplasts isolated 1634 from C3 or CAM (crassulacean acid metabolism)-induced 1635 Mesembryanthemum crystallinum L. Biochem. J. 318 945-953. 1636

Nimmo, G.A., Nimmo, H.G., Fewson, C.A., and Wilkins, M.B. (1984). Diurnal 1637 Changes in the Properties of Phosphoenolpyruvate Carboxylase in 1638 Bryophyllum Leaves - a Possible Covalent Modification. FEBS Lett. 178: 199-1639 203. 1640

48

Nimmo, G.A., Nimmo, H.G., Hamilton, I.D., Fewson, C.A., and Wilkins, M.B. (1986). 1641 Purification of the Phosphorylated Night Form and Dephosphorylated Day 1642 Form of Phosphoenolpyruvate Carboxylase from Bryophyllum fedtschenkoi. 1643 Biochem. J. 239: 213-220. 1644

O’Leary, B., Park, J., and Plaxton, W.C. (2011). The remarkable diversity of plant 1645 PEPC (phosphoenolpyruvate carboxylase): recent insights into the 1646 physiological functions and post-translational controls of non-photosynthetic 1647 PEPCs. Biochem. J. 436: 15-34. 1648

Osmond, C.B. (1978). Crassulacean acid metabolism: a curiosity in context. Annu. 1649 Rev. Plant Physiol. Plant Mol. Biol. 29: 379-414. 1650

Park, S.Y., Fung, P., Nishimura, N., Jensen, D.R., Fujii, H., Zhao, Y., Lumba, S., 1651 Santiago, J., Rodrigues, A., Chow, T.F.F., Alfred, S.E., Bonetta, D., 1652 Finkelstein, R., Provart, N.J., Desveaux, D., Rodriguez, P.L., McCourt, P., 1653 Zhu, J.K., Schroeder, J.I., Volkman, B.F., and Cutler, S.R. (2009). Abscisic 1654 Acid Inhibits Type 2C Protein Phosphatases via the PYR/PYL Family of 1655 START Proteins. Science 324: 1068-1071. 1656

Prasch, C.M., Ott, K.V., Sonnewald, U., Bauer, H., Ache, P., and Hedrich, R. (2015). 1657 ß-amylase1 mutant Arabidopsis plants show improved drought tolerance due 1658 to reduced starch breakdown in guard cells. J. Exp. Bot. 66: 6059-6067. 1659

Rawat, R., Schwartz, J., Jones, M.A., Sairanen, I., Cheng, Y., Andersson, C.R., 1660 Zhao, Y., Ljung, K., and Harmer, S.L. (2009). REVEILLE1, a Myb-like 1661 transcription factor, integrates the circadian clock and auxin pathways. P Natl 1662 Acad Sci USA 106: 16883-16888. 1663

Ritte, G., Heydenreich, M., Mahlow, S., Haebel, S., Kötting, O., and Steup, M. 1664 (2006). Phosphorylation of C6- and C3-positions of glucosyl residues in starch 1665 is catalysed by distinct dikinases. FEBS Lett. 580: 4872–4876. 1666

Salahas, G., Manetas, Y., and Gavalas, N.A. (1990). Assaying for pyruvate, 1667 orthophosphate dikinase activity - necessary precautions with 1668 phosphoenolpyruvate carboxylase as coupling enzyme. Photosynthesis Res. 1669 24: 183-188. 1670

Santelia, D., and Lunn, J.E. (2017). Transitory Starch Metabolism in Guard Cells: 1671 Unique Features for a Unique Function. Plant Physiol. 174: 539-549. 1672

Santiago, J., Dupeux, F., Round, A., Antoni, R., Park, S.-Y., Jamin, M., Cutler, S.R., 1673 Rodriguez, P.L., and Márquez, J.A. (2009). The abscisic acid receptor PYR1 1674 in complex with abscisic acid. Nature 462: 665-668. 1675

Schluepmann, H., Pellny, T., van Dijken, A., Smeekens, S., and Paul, M. (2003). 1676 Trehalose 6-phosphate is indispensable for carbohydrate utilization and 1677 growth in Arabidopsis thaliana. P Natl Acad Sci USA 100: 6849-6854. 1678

Seo, P.J., Lee, S.B., Suh, M.C., Park, M.J., Go, Y.S., and Park, C.M. (2011). The 1679 MYB96 Transcription Factor Regulates Cuticular Wax Biosynthesis under 1680 Drought Conditions in Arabidopsis. Plant Cell 23: 1138-1152. 1681

Sharma, A., Wai, C.M., Ming, R., and Yu, Q. (2017). Diurnal Cycling Transcription 1682 Factors of Pineapple Revealed by Genome-Wide Annotation and Global 1683 Transcriptomic Analysis. Genome Biol Evol 9: 2170-2190. 1684

Shi, J., Yi, K., Liu, Y., Xie, L., Zhou, Z., Chen, Y., Hu, Z., Zheng, T., Liu, R., Chen, Y., 1685 and Chen, J. (2015). Phosphoenolpyruvate Carboxylase in Arabidopsis 1686 Leaves Plays a Crucial Role in Carbon and Nitrogen Metabolism. Plant 1687 Physiol. 167: 671-681. 1688

Smith, A.M., and Zeeman, S.C. (2006). Quantification of starch in plant tissues. Nat 1689 Protoc 1: 1342-1345. 1690

49

Smith, A.M., Zeeman, S.C., and Smith, S.M. (2005). Starch degradation. Annu. Rev. 1691 Plant Biol. 56: 73-98. 1692

Somers, D.E., Devlin, P.F., and Kay, S.A. (1998). Phytochromes and cryptochromes 1693 in the entrainment of the Arabidopsis circadian clock. Science 282: 1488-1694 1490. 1695

Taybi, T., Patil, S., Chollet, R., and Cushman, J.C. (2000). A minimal 1696 serine/threonine protein kinase circadianly regulates phosphoenolpyruvate 1697 carboxylase activity in crassulacean acid metabolism-induced leaves of the 1698 common ice plant. Plant Physiol. 123: 1471-1481. 1699

Valerio, C., Marri, L., Pupillo, P., Trost, P., Sparla, F., Costa, A., and Issakidis-1700 Bourguet, E. (2010). Thioredoxin-regulated β-amylase (BAM1) triggers diurnal 1701 starch degradation in guard cells, and in mesophyll cells under osmotic stress. 1702 J. Exp. Bot. 62: 545-555. 1703

von Caemmerer, S., and Furbank, R.T. (2003). The C4 pathway: an efficient CO2 1704 pump. Photosynthesis Res. 77: 191-207. 1705

Von Caemmerer, S., and Griffiths, H. (2009). Stomatal responses to CO2 during a 1706 diel Crassulacean acid metabolism cycle in Kalanchoë daigremontiana and 1707 Kalanchoë pinnata. Plant, Cell Environ. 32: 567-576. 1708

Wai, C.M., and VanBuren, R. (2018). Circadian Regulation of Pineapple CAM 1709 Photosynthesis. In Genetics and Genomics of Pineapple, R. Ming, ed (Cham: 1710 Springer International Publishing), pp. 247-258. 1711

Wai, C.M., Weise, S.E., Ozersky, P., Mockler, T.C., Michael, T.P., and VanBuren, R. 1712 (2019). Time of day and network reprogramming during drought induced CAM 1713 photosynthesis in Sedum album. PLoS Genet. 15: e1008209. 1714

Wild, B., Wanek, W., Postl, W., and Richter, A. (2010). Contribution of carbon fixed 1715 by Rubisco and PEPC to phloem export in the Crassulacean acid metabolism 1716 plant Kalanchoë daigremontiana. J. Exp. Bot. 61: 1375-1383. 1717

Wilkins, M.B. (1959). An endogenous rhythm in the rate of carbon dioxide output of 1718 Bryophyllum. I. Some preliminary experiments. J. Exp. Bot. 10: 377-390. 1719

Wilkins, M.B. (1992). Circadian rhythms - their origin and control. New Phytol. 121: 1720 347-375. 1721

Winter, K. (2019). Ecophysiology of constitutive and facultative CAM photosynthesis. 1722 J. Exp. Bot. 10.1093/jxb/erz002. 1723

Winter, K., and Holtum, J.A. (2014). Facultative crassulacean acid metabolism 1724 (CAM) plants: powerful tools for unravelling the functional elements of CAM 1725 photosynthesis. J. Exp. Bot. 65: 3425-3441. 1726

Wyka, T.P., and Lüttge, U.E. (2003). Contribution of C3 carboxylation to the circadian 1727 rhythm of carbon dioxide uptake in a Crassulacean acid metabolism plant 1728 Kalanchoë daigremontiana. J. Exp. Bot. 54: 1471-1479. 1729

Yang, X., Hu, R., Yin, H., Jenkins, J., Shu, S., Tang, H., Liu, D., Weighill, D.A., Cheol 1730 Yim, W., Ha, J., Heyduk, K., Goodstein, D.M., Guo, H.B., Moseley, R.C., 1731 Fitzek, E., Jawdy, S., Zhang, Z., Xie, M., Hartwell, J., Grimwood, J., Abraham, 1732 P.E., Mewalal, R., Beltran, J.D., Boxall, S.F., Dever, L.V., Palla, K.J., Albion, 1733 R., Garcia, T., Mayer, J.A., Don Lim, S., Man Wai, C., Peluso, P., Van Buren, 1734 R., De Paoli, H.C., Borland, A.M., Guo, H., Chen, J.G., Muchero, W., Yin, Y., 1735 Jacobson, D.A., Tschaplinski, T.J., Hettich, R.L., Ming, R., Winter, K., 1736 Leebens-Mack, J.H., Smith, J.A.C., Cushman, J.C., Schmutz, J., and Tuskan, 1737 G.A. (2017). The Kalanchoë genome provides insights into convergent 1738 evolution and building blocks of crassulacean acid metabolism. Nature 1739 Communications 8: Art. No. 1899. 1740

50

Yin, H.F., Guo, H.B., Weston, D.J., Borland, A.M., Ranjan, P., Abraham, P.E., 1741 Jawdy, S.S., Wachira, J., Tuskan, G.A., Tschaplinski, T.J., Wullschleger, S.D., 1742 Guo, H., Hettich, R.L., Gross, S.M., Wang, Z., Visel, A., and Yang, X.H. 1743 (2018). Diel rewiring and positive selection of ancient plant proteins enabled 1744 evolution of CAM photosynthesis in Agave. BMC Genomics 19: Art. No. 588. 1745

Yoshida, T., dos Anjos, L., Medeiros, D.B., Araujo, W.L., Fernie, A.R., and Daloso, 1746 D.M. (2019). Insights into ABA-mediated regulation of guard cell primary1747 metabolism revealed by systems biology approaches. Prog. Biophys. Mol.1748 Biol. 146: 37-49.1749

Zhang, J.B., De-oliveira-Ceciliato, P., Takahashi, Y., Schulze, S., Dubeaux, G., 1750 Hauser, F., Azoulay-Shemer, T., Toldsepp, K., Kollist, H., Rappel, W.J., and 1751 Schroeder, J.I. (2018). Insights into the Molecular Mechanisms of CO2-1752 Mediated Regulation of Stomatal Movements. Curr. Biol. 28: R1356-R1363. 1753

Zhou, Y.P., Duan, J., Fujibe, T., Yamamoto, K.T., and Tian, C.E. (2012). AtIQM1, a 1754 novel calmodulin-binding protein, is involved in stomatal movement in 1755 Arabidopsis. Plant Mol. Biol. 79: 333-346. 1756

Zielinski, T., Moore, A.M., Troup, E., Halliday, K.J., and Millar, A.J. (2014). Strengths 1757 and Limitations of Period Estimation Methods for Circadian Data. Plos One 9: 1758 e96462. 1759

1760 1761

Figure 1

Figure 1. Confirmation of Target Gene Silencing in Transgenic K. laxiflora RNAi Lines rPPC1-A and rPPC1-B. Gene transcript abundance in leaf pair 6 (LP6) was measured using RT-qPCR for target genes: (A) PPC1; (B) PPC2; (C) PPC3; (D) PPC4; (E) PPCK1; (F) PPCK2; and (G) PPCK3. LP6 were sampled every 4 h across the 12-h-light/12-h-dark cycle. A THIOESTERASE/THIOL ESTER DEHYDRASE-ISOMERASE superfamily gene (TEDI) was amplified from the same cDNAs as a reference gene. Gene transcript abundance data represents the mean of 3 technical replicates for biological triplicates and were normalized to loading control gene (TEDI); error bars represent the standard error. In all cases, plants were entrained under 12-h-light/12-h-dark cycles for 7-days prior to sampling. Black data are for the wild type, blue data rPPC1-A, and red data rPPC1-B.

0.0

0.5

1.0

1.5

2.0PPC3C

0

1

2

3 PPCK1E

0

1

2

3

4

5 PPC2B

0.0

0.5

1.0

1.5PPC4D

0 4 8 12 16 20 240

2

4

6

Time (h)

PPCK2F

0 4 8 12 16 20 240

1

2

3

4

5

Time (h)

PPCK3G

0

20

40

60

80

100PPC1 A

Rela

tive

Tran

scrip

t Abu

ndan

ce

Figure 2

Figure 2. Loss of PPC1 Transcripts Leads to Loss of PPC Protein and Activity and Failure to Activate PPDK in the Light. Total leaf protein from leaf pair 6 (LP6) was isolated from leaves sampled at dawn and dusk plus every 4 h, starting at 2 h into the light period, across the 12-h-light/12-h-dark cycle, separated using SDS-PAGE and used for immunoblot analyses withantibodies raised to PPC (A), and phospho-PPC (B). (C) PPC activity was measuredin rapidly desalted extracts from LP6, ** = rPPC1-A p= 0.0054, *** = rPPC1-B,p=0.00016. (D) Anti-PPDK immunoblot. (E) Anti-phospho-PPDK immunoblot. (F)PPDK activity was measured in leaf extracts prepared from both dark leaves andilluminated leaves, ** = rPPC1-B, p=0.003. The activities of PPC, measured 6 h intothe light period, and PPDK, measured at both 6h into the dark, and 6h into the lightperiods, were the mean of 3 technical replicates of 3 biological replicates and theerror bars represent the standard error. The white bar below each panel representsthe 12-h-light period and the black bar below each panel represents the 12-h-darkperiod. Black data are for the wild type, blue data rPPC1-A, and red data rPPC1-B.Asterisks indicate significant difference from the wild type based on the students ttest:*. All Student‘s t-test parameters are presented in Supplemental Table 1 and 2.

PPDK

c

12 14 18 22 0 2 6 10

E F

PPC A

12 14 18 22 0 2 6 10

WT

rPPC1-A

rPPC1-B c

c B

12 14 18 22 0 2 6 10

D

WT

rPPC1-B

rPPC1-A c

12 14 18 22 0 2 6 10

Phospho-PPDK E

C

Phospho-PPC

Dark Light0.00

0.01

0.02

0.03

0.04

0.05

Rat

e (µ

mol

/min

/mg

prot

ein)

PPDK Activity

**

WT rPPC1-A rPPC1-B0.00

0.05

0.10

0.15

0.20

PPC

act

ivity

/µg

prot

ein PPC Activity

***

**

c

WT rPPC1-A rPPC1-B

G

0 4 8 12 16 20 240

50

100

150

Time (h)

Mal

ate

(µm

ol g

FW-1

)

MalateA

0 4 8 12 16 20 240.0

0.2

0.4

0.6

0.8

Time (h)

Sucr

ose

(mg

g FW

-1)

SucroseC

0 4 8 12 16 20 240.0

0.2

0.4

0.6

Time (h)

Fruc

tose

(mg

gFW

-1)

FructoseE

0 4 8 12 16 20 240

5

10

15

Time (h)

Star

ch (m

g gF

W-1

)

StarchB

0 4 8 12 16 20 240.0

0.1

0.2

0.3

0.4

Time (h)

Glu

cose

(mg

gFW

-1)

GlucoseD

Figure 3

0

5

10

15

20

25

Dry

Wei

ght (

g)

Shoot DW

WT rPPC1-A rPPC1-Bw wwd d d

*

*

F

Figure 3. Impact of silencing PPC1 on malate, starch, soluble sugars and growth.(A) The contents of malate, (B) starch, (C) sucrose, (D) glucose and (E) fructose were determined from leaf pair 6 (LP6) samples collected every 4 h using plants entrained under 12-h-light/12-h-dark cycles. Methanol extracts were prepared from the leaves from wild type, rPPC1-A and rPPC1-B and used for malate and soluble sugar determination, whereas starch was measured in the insoluble pellet. (F) Dry weight of 148-day-old greenhouse-grown plants, either well-watered (w) or drought-stressed for the last 28-days (d). * denotes significant difference between wild type and rPPC1-B based on the Student’s t-test. Well-watered, rPPC1-B * p = 0.017; drought-stressed rPPC1-B * p = 0.011, n = 6 to 9, developmentally synchronised, clonal plants per line. (G), 4-month-old plants raised in a greenhouse under 16-h-light/ 8-h-dark. In all graphs, black data are for the wild type, blue data rPPC1-A, and red data rPPC1-B. Error bars represent the standard error. Asterisks indicate significant difference from the wild type:*. See Supplemental Data Set 1 for full parameters from the Student’s t-test results for the relative growth data.

Figure 4. Impact of silencing PPC1 on 24 h light/ dark gas exchange profiles under well-watered and drought-stressed conditions, and on chlorophyll content. (A), CO2 uptake profile showing the 4 phases of CAM, (B), stomatal conductance (gs) profile and (C), the calculated internal partial pressure of CO2 inside the leaf (Ci) profile for CAM leaves (leaf pair 6; LP6) using plants pre-entrained for 7-days under 12-h-light/ 12-h-dark cycles. (D), Impact of drought on K. laxiflora wild type and transgenic lines with reduced PPC1. Gas exchange profile for shoots of whole young plants (9-leaf-pair stage) measured throughout 27-days. The plants were watered to full capacity on day 0 and allowed to progress into drought until day 23 when they were re-watered to full capacity (black arrow). The means for each of the four gas exchange traces for each line are shown, with error bars showing the standard error of the mean (SEM) in the paler-coloured extensions that extend above and below each of the data points. (E)and (F) Impact of silencing PPC1 on chlorophyll a (E) and chlorophyll b (F) content in leaf pairs 2 through 7. In (E) and (F) the error bars represent the standard error of the mean calculated for the three biologicalreplicates, which were individual clones of each line. Asterisks indicate significant difference from the wildtype based on the Student’s t-test: * (E), Chlorophyll a in rPPC1-A: LP2, p = 0.000160; rPPC1-B: LP2, p =0.043676; LP3, p = 0.000003; LP4, p = 0.000001; LP5, p = 0.000094; LP6, p = 0.000012; LP7, p = 0.010883.* (F), Chlorophyll b in rPPC1-A: LP2, p = 0.000304; rPPC1-B: LP3, p = 0.000019; LP4, p = 0.000016; LP5 p =0.000653; LP6, p=0.000951. All Student‘s t-test parameters are presented in Supplemental Table 3. Blackdata are for the wild type, blue data rPPC1-A, and red data rPPC1-B.

Figure 4

0

10C

O2 u

ptak

e (µ

mol

m-2

s-1

)

Photosynthesis

Time (h)0 12 246 18

III III IV

A

0.0

0.1

g s (m

ol m

-2 s

-1) Conductance

Time (h)0 12 246 18

III III IV

B

-2000

0

2000

Ci (µm

ol m

ol-1

) Ci

Time (h)0 12 246 18

C

-2

0

2

4

Time (d)

CO

2 upt

ake

(µm

ol m

-2 s

-1)

10 16 2242 14 262080 12 24186

D

LP2 LP3 LP4 LP5 LP6 LP70.00

0.02

0.04

0.06

0.08

0.10

Chl

a (m

g cm

-2) Chlorophyll a

* * * *

E

** *

LP2 LP3 LP4 LP5 LP6 LP70.000

0.002

0.004

0.006

Chl

b (m

g cm

-2) Chlorophyll b

* * * *

F

*

Figure 5. Impact of the Loss of PPC1 Transcripts on the Light/ Dark Regulation of the Transcript Abundance of CAM- and Central Circadian Clock-Associated Genes in RNAi Lines rPPC1-A and rPPC1-B. Gene transcript abundance was measured using RT-qPCR for target genes: (A), PPDK; (B), PPDK-RP; (C), b-NAD-ME; (D), GWD; (E), AMY3a; (F), AMY3b; (G), BAM1; (H), BAM3; (I), BAM9; (J), PHS1; (K), GPT2; (L), MEX1; (M), pGlcT; (N), CAB; (O), TPS7; (P), CCA1-1; (Q), CCA1-2; (R), TOC1-1; (S), TOC1-2; (T), PRR7; (U), PRR3/7; (V), PRR9; (W), JMJ30/ JMJD5; (X), ELF3; (Y), CDF2; (Z), RVE1-like; (AA), EPR1; (BB), LNK3; (CC), FKF1 and (DD), GI. Mature leaves (leaf pair 6; LP6) were sampled every 4 h across the 12-h-light/12-h-dark cycle. A thioesterase/thiol ester dehydrase-isomerase superfamily gene (TEDI) was amplified from the same cDNAs as a reference gene. Gene transcript abundance data represents the mean of 3 technical replicates for biological triplicates and were normalized to loading control gene (TEDI); error bars represent the standard error. In all cases, plants were entrained under 12-h-light/12-h-dark cycles for 7-days prior to sampling. Black data are for the wild type, blue data rPPC1-A, and red data rPPC1-B.

Figure 5

20

24

28 PPDKA

0

10

20 GPT2K

0

40

80 GWDD

0

4

8 BAM9I

0

2

4 CCA1-2Q

0

2

4

6 PRR7T0

2

4TPS7O

0

1

2

3 CDF2Y

0 4 8 12 16 20 240

5

10

15 LNK3BB

0

5

10

15 PPDK-RPB

0

10

20AMY3bF

0

5

10

15 BAM1G

0

20

40 CABN

0

5

10 TOC1-1R

0

4

8 PRR37U

0

40

JMJD5W

0

5

10

15 RVE1-like Z

0 4 8 12 16 20 240

4

8FKFCC

0

5

10 NAD ME BC

0

40

80AMY3aE

0

20

40 BAM3H

0

2

4CCA1-1P

0

2

4

6 TOC1-2S

0

2

4 PRR9V

0

5

10

15 ELF3X

0 4 8 12 16 20 240

2

4 EPR1AA

0 4 8 12 16 20 240

2

4

6 GIDD

0

1

PHS1J

0

20

40 MEX1L

0

1

2

3 pGlcTM

Rel

ativ

e Tr

ansc

ript A

bund

ance

Time (h)

Time (h)

Time (h)

Time (h)

-1

0

1

2

3

Time (d)

CO

2 up

take

(µm

ol m

-2 s

-1)

1 2 3 40 5

A

-1

0

1

2

3

Time (d)

CO

2 up

take

(µm

ol m

-2 s

-1)

1 2 3 40 5

B

Figure 6

Figure 6. Effects of silencing PPC1 on CAM CO2 exchange rhythms measured under constant light and temperature (LL) conditions. (A), Gas exchange profile for detached CAM leaves (leaf pair 6; LP6) was measured using leaves entrained under a 12-h-light/12-h-dark cycle followed by release into LL constant conditions (100 µmol m-2 s-1 at 15 ˚C). (B), Gas exchange profile for well-watered whole young plants (9-leaf-pairs stage) using plants entrained under 12-h-light/12-h-dark cycles followed by release into constant LL conditions (100 µmol m-2 s-1 at 15 ˚C). The data represents the mean CO2 uptake of 3 individual plants. (C), Delayed Fluorescence (DF) circadian rhythms became more robust in lines rPPC1-A and rPPC1-B. Plants were entrained under 12-h-light/12-h-dark cycles before being transferred to constant red/blue light (35 µmol m2s-1) under the CCD imaging camera system. DF was assayed with a 1-h time resolution for 120 h. The plots represent normalized averages for DF measured for 21 leaf discs sampled from 3 biological replicates of LP6 from each line. Error bars indicate SE of the mean calculated from three biological replicates. (D), Relative Amplitude Error (RAE) plot for the DF rhythms. (E), Mean period length plot, and (F), Mean RAE plot; the plotted values were calculated using the Biodare package for circadian rhythm analysis. FFT = fast Fourier transform-nonlinear least squares analysis, or SR = spectral resampling analysis. Black data are for the wild type, blue data rPPC1-A, and red data rPPC1-B. LL begins at 0h in Figures 6A-C.

0 24 48 72 96 120880

900

920

940

Time (h)

Fluo

resc

ence

C

SR FFT0

5

10

15

20

25

Perio

d (h

)

E

15 20 25 30 350.0

0.6

1.2

Period (h)

RAE

D

SR FFT0.0

0.2

0.4

0.6

0.8

1.0

RAE

F

c

Figure 7

0

5

10

15 PPC1A

0

1

2

3

4 PPCK2D

0

5

10

15

20 GPT2F

0

2

4

6 TOC1-1J

0

2

4

6 PRR37M

0 12 24 36 48 60 720

1

2

3

4

5 GIV

0

5

10

15

20 ELF3Q

0 12 24 36 48 60 720

1

EPR1T

0

1

2 PPC2B

0

2

4

6 PPCK3E

0

1

2

3

4 CCA1-1H

0

2

4

6

8 TOC1-2K

0

2

4

6

8

10 PRR9N

0 12 24 36 48 60 720

2

4

6

8 FKFU0

5×10-2

1×10-1

2×10-1 CDF2R

0

1

2 PPCK1C

0

2

4

6

8 CCA1-2I

0

1

2

3

4 PRR7L

0

2

4

6

8 LNK3O

0

2

4

6

8 JMJDP

0

2

4

6 RVE1-like S

0

10

20

30

40 CAB G

Time (h)

Time (h) Time (h)

Rel

ativ

e Tr

ansc

ript A

bund

ance

Figure 7. Impact of the Loss of PPC1 Transcripts on Circadian Clock Controlled GeneTranscript Abundance during Constant Light and Temperature (LL) Free Running Conditions. Mature leaves (leaf pair 6), which performed CAM in the wild type, were sampled every 4 h under constant conditions (100 µmol m-2 s-1 at 15 ˚C) for wild type and rPPC1-B. RNA was isolated and used for real-time RT-qPCR. A thioesterase/thiol ester dehydrase-isomerase superfamily gene (TEDI) was amplified as a reference gene from the same cDNAs. Gene transcript abundance data represents the mean of 3 technical replicates for biological triplicates and were normalized to loading control gene (TEDI); error bars represent the standard error. In all cases, plants were entrained under 12-h-light/12-h-dark cycles prior to release into LL free-running conditions at 0h. Black data are for the wild type and red data rPPC1-B. The grey bars behind the data represent the subjective dark period, the time when it would have been dark under the previous entrainment conditions. Likewise, the white regions represent the subjective light period.(A), Circadian rhythm of PPC1 transcript abundance under constant LL conditions (100 µmol m-2

s-1 at 15 ˚C) for wild type and rPPC1-B. (B), PPC2; (C), PPCK1; (D), PPCK2; (E), PPCK3; (F),GPT2; (G), CAB; (H), CCA1-1 ; (I), CCA1-2; (J), TOC1-1; (K), TOC1-2; (L), PRR7; (M), PRR37;(N), PRR9; (O), LNK3-like; (P), JMJ30/JMJD5; (Q), ELF3; (R), CDF2; (S), RVE1-like; (T), EPR1;(U), FKF1 and (V), GI.

Figure 8. Impact of the Loss of PPC Activity on the Light/ Dark Regulation of the Transcript Abundance of Stomatal Control Genes in the Epidermis. Plants were entrained under 12-h-light/12-h-dark for 7 days prior to sampling. Epidermal peel samples were separated from leaf pairs 6, 7 and 8, with samples collected every 4h starting at 02:00, 2 h into the 12-h-light period. Each biological sample represents a pool of epidermal peels taken from 6 leaf pair 6, 7 and 8 leaves from 3 clonal stems of each line. Each peel was frozen in liquid nitrogen immediately after it was taken and pooled later. RNA was isolated and used in RT-qPCR. A thioesterase/thiol ester dehydrase-isomerase superfamily gene (TEDI) was amplified as a reference gene from the same cDNAs. Gene transcript abundance data represent the mean of 3 technical replicates for biological triplicates, and were normalized to the reference gene (TEDI); error bars represent the standard error. In all cases, plants were entrained under 12-h-light/12-h-dark cycles for 7 days prior to sampling. Black data are for the wild type and red data rPPC1-B. (A), PHOT1; (B), CRY2; (C), bCA5; (D), PATROL1; (E), CBC1/2 ; (F), HT1; (G), OST1; (H), SLAC1; (I),PP2C; (J), RCAR3; (K), GORK; (L), SKOR; (M), ALMT12 ; (N), RMA1; (O), EDA39; (P), SOS2; (Q), ACA2;(R), ECA4; (S), MYB60 and (T), MYB61.

Figure 8

0

1 PHOT1A

0

1

2CBC1/2E

0

1

2PP2CI

0

1

2ALMT12M

0 4 8 12 16 20 240

2

4

6

Time (h)

ACA2Q

0

4

8CRY2B

0

2

4

6

8 RCAR3J

0

2

4

6

8 RMA1N

0 4 8 12 16 20 240

1

2

3

4

5

Time (h)

ECA4R

0

1

2

3

4 ßCA5C

0

1

2GORKK

0

1

2

3

4

5 EDA39O

0 4 8 12 16 20 240

50

100

150

Time (h)

MYB60S

0

1 PATROL1D

0

1

2 SLAC1H

0

1

2 SKORL

0.0

0.4

SOS2P

0 4 8 12 16 20 240

2

4

6

8

Time (h)

MYB61T

0.00

0.04

0.08OST1G

0.0

0.1

0.2

0.3 HT1F

Rel

ativ

e Tr

ansc

ript A

bund

ance

Parsed Citations

Abraham, P.E., Yin, H., Borland, A.M., Weighill, D., Lim, S.D., De Paoli, H.C., Engle, N., Jones, P.C., Agh, R., Weston, D.J., Wullschleger,S.D., Tschaplinski, T., Jacobson, D., Cushman, J.C., Hettich, R.L., Tuskan, G.A., and Yang, X. (2016). Transcript, protein and metabolitetemporal dynamics in the CAM plant Agave. Nat Plants 2: Art. No. 16178.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ache, P., Becker, D., Ivashikina, N., Dietrich, P., Roelfsema, M.R.G., and Hedrich, R. (2000). GORK, a delayed outward rectifierexpressed in guard cells of Arabidopsis thaliana, is a K+-selective, K+-sensing ion channel. FEBS Lett. 486: 93-98.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Alonso-Cantabrana, H., Cousins, A.B., Danila, F.R., Ryan, T., Sharwood, R.E., von Caemmerer, S., and Furbank, R.T. (2018). Diffusion ofCO2 across the mesophyll-bundle sheath cell interface in a C4 plant with genetically reduced PEP carboxylase activity. Plant Physiol.178: 72 - 81.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Anderson, C.M., and Wilkins, M.B. (1989). Period and Phase Control by Temperature in the Circadian Rhythm of Carbon DioxideFixation in Illuminated Leaves of Bryophyllum fedtschenkoi. Planta 177: 456-469.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Arnon, D.I. (1949). Copper enzymes in isolated chloroplasts. Polyphenol oxidase in Beta vulgaris. Plant Physiol. 24: 1-15.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Blatt, M.R. (2016). Plant Physiology: Redefining the Enigma of Metabolism in Stomatal Movement. Curr. Biol. 26: R107-R109.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Boccalandro, H.E., Giordano, C.V., Ploschuk, E.L., Piccoli, P.N., Bottini, R., and Casal, J.J. (2012). Phototropins But Not CryptochromesMediate the Blue Light-Specific Promotion of Stomatal Conductance, While Both Enhance Photosynthesis and Transpiration underFull Sunlight. Plant Physiol. 158: 1475-1484.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Borland, A.M., Griffiths, H., Hartwell, J., and Smith, J.A.C. (2009). Exploiting the potential of plants with crassulacean acid metabolismfor bioenergy production on marginal lands. J. Exp. Bot. 60: 2879-2896.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Borland, A.M., Guo, H.B., Yang, X., and Cushman, J.C. (2016). Orchestration of carbohydrate processing for crassulacean acidmetabolism. Curr. Opin. Plant Biol. 31: 118-124.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Borland, A.M., Wullschleger, S.D., Weston, D.J., Hartwell, J., Tuskan, G.A., Yang, X., and Cushman, J.C. (2015). Climate-resilientagroforestry: physiological responses to climate change and engineering of crassulacean acid metabolism (CAM) as a mitigationstrategy. Plant, Cell Environ. 38: 1833-1849.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Borland, A.M., Hartwell, J., Weston, D.J., Schlauch, K.A., Tschaplinski, T.J., Tuskan, G.A., Yang, X., and Cushman, J.C. (2014).Engineering crassulacean acid metabolism to improve water-use efficiency. Trends Plant Sci. 19: 327-338.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Boxall, S.F., Dever, L.V., Knerova, J., Gould, P.D., and Hartwell, J. (2017). Phosphorylation of Phosphoenolpyruvate Carboxylase IsEssential for Maximal and Sustained Dark CO2 Fixation and Core Circadian Clock Operation in the Obligate Crassulacean AcidMetabolism Species Kalanchoë fedtschenkoi. Plant Cell 29: 2519-2536.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Boxall, S.F., Foster, J.M., Bohnert, H.J., Cushman, J.C., Nimmo, H.G., and Hartwell, J. (2005). Conservation and divergence of circadianclock operation in a stress-inducible Crassulacean acid metabolism species reveals clock compensation against stress. Plant Physiol.137: 969-982.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Brilhaus, D., Brautigam, A., Mettler-Altmann, T., Winter, K., and Weber, A.P.M. (2016). Reversible Burst of Transcriptional Changesduring Induction of Crassulacean Acid Metabolism in Talinum triangulare. Plant Physiol. 170: 102-122.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Burnell, J.N., and Hatch, M.D. (1986). Activation and inactivation of an enzyme catalyzed by a single, bifunctional protein - a newexample and why. Arch Biochem Biophys 245: 297-304.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Cai, J., Liu, X., Vanneste, K., Proost, S., Tsai, W.C., Liu, K.W., Chen, L.J., He, Y., Xu, Q., Bian, C., Zheng, Z.J., Sun, F.M., Liu, W.Q., Hsiao,Y.Y., Pan, Z.J., Hsu, C.C., Yang, Y.P., Hsu, Y.C., Chuang, Y.C., Dievart, A., Dufayard, J.F., Xu, X., Wang, J.Y., Wang, J., Xiao, X.J., Zhao,X.M., Du, R., Zhang, G.Q., Wang, M.N., Su, Y.Y., Xie, G.C., Liu, G.H., Li, L.Q., Huang, L.Q., Luo, Y.B., Chen, H.H., de Peer, Y.V., and Liu,Z.J. (2015). The genome sequence of the orchid Phalaenopsis equestris. Nat. Genet. 47: 65-72.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Carter, P.J., Nimmo, H.G., Fewson, C.A., and Wilkins, M.B. (1990). Bryophyllum fedtschenkoi protein phosphatase type 2A candephosphorylate phosphoenolpyruvate carboxylase. FEBS Lett. 263: 233-236.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Carter, P.J., Nimmo, H.G., Fewson, C.A., and Wilkins, M.B. (1991). Circadian Rhythms in the Activity of a Plant Protein Kinase. EMBO J.10: 2063-2068.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Chastain, C.J., Botschner, M., Harrington, G.E., Thompson, B.J., Mills, S.E., Sarath, G., and Chollet, R. (2000). Further analysis of maizeC4 pyruvate,orthophosphate dikinase phosphorylation by its bifunctional regulatory protein using selective substitutions of theregulatory Thr-456 and catalytic His-458 residues. Arch Biochem Biophys 375: 165-170.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Chastain, C.J., Fries, J.P., Vogel, J.A., Randklev, C.L., Vossen, A.P., Dittmer, S.K., Watkins, E.E., Fiedler, L.J., Wacker, S.A., Meinhover,K.C., Sarath, G., and Chollet, R. (2002). Pyruvate,orthophosphate dikinase in leaves and chloroplasts of C3 plants undergoes light-/dark-induced reversible phosphorylation. Plant Physiol. 128: 1368-1378.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Chater, C., Peng, K., Movahedi, M., Dunn, J.A., Walker, H.J., Liang, Y.K., McLachlan, D.H., Casson, S., Isner, J.C., Wilson, I., Neill, S.J.,Hedrich, R., Gray, J.E., and Hetherington, A.M. (2015). Elevated CO2-Induced Responses in Stomata Require ABA and ABA Signaling.Curr. Biol. 25: 2709-2716.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Cheng, N.-H., Pittman, J.K., Zhu, J.-K., and Hirschi, K.D. (2004). The Protein Kinase SOS2 Activates the Arabidopsis H+/Ca2+ AntiporterCAX1 to Integrate Calcium Transport and Salt Tolerance. J. Biol. Chem. 279: 2922-2926.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Chollet, R., Vidal, J., and O'Leary, M.H. (1996). Phosphoenolpyruvate carboxylase: A ubiquitous, highly regulated enzyme in plants.Annu. Rev. Plant Physiol. Plant Mol. Biol. 47: 273-298.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Cominelli, E., Galbiati, M., Vavasseur, A., Conti, L., Sala, T., Vuylsteke, M., Leonhardt, N., Dellaporta, S.L., and Tonelli, C. (2005). Aguard-cell-specific MYB transcription factor regulates stomatal movements and plant drought tolerance. Curr. Biol. 15: 1196-1200.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Cushman, J.C., Davis, S.C., Yang, X., and Borland, A.M. (2015). Development and use of bioenergy feedstocks for semi-arid and aridlands. J. Exp. Bot. 66: 4177 - 4193.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Cushman, J.C., Agarie, S., Albion, R.L., Elliot, S.M., Taybi, T., and Borland, A.M. (2008). Isolation and characterization of mutants ofcommon ice plant deficient in Crassulacean acid metabolism. Plant Physiol. 147: 228-238.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Daloso, D.M., Williams, T.C.R., Antunes, W.C., Pinheiro, D.P., Muller, C., Loureiro, M.E., and Fernie, A.R. (2016). Guard cell-specificupregulation of sucrose synthase 3 reveals that the role of sucrose in stomatal function is primarily energetic. New Phytol. 209: 1470-1483.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Daszkowska-Golec, A., and Szarejko, I. (2013). Open or close the gate - stomata action under the control of phytohormones in drought

Daszkowska-Golec, A., and Szarejko, I. (2013). Open or close the gate - stomata action under the control of phytohormones in droughtstress conditions. Front Plant Sci 4: 138-138.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Davies, B.N., and Griffiths, H. (2012). Competing carboxylases: circadian and metabolic regulation of Rubisco in C3 and CAMMesembryanthemum crystallinum L. Plant, Cell Environ. 35: 1211-1220.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

DePaoli, H.C., Borland, A.M., Tuskan, G.A., Cushman, J.C., and Yang, X. (2014). Synthetic biology as it relates to CAM photosynthesis:challenges and opportunities. J. Exp. Bot. 65: 3381-3393.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Dever, L.V., Boxall, S.F., Knerova, J., and Hartwell, J. (2015). Transgenic Perturbation of the Decarboxylation Phase of CrassulaceanAcid Metabolism Alters Physiology and Metabolism But Has Only a Small Effect on Growth. Plant Physiol. 167: 44-59.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Dever, L.V., Blackwell, R.D., Fullwood, N.J., Lacuesta, M., Leegood, R.C., Onek, L.A., Pearson, M., and Lea, P.J. (1995). The Isolationand Characterization of Mutants of the C4 Photosynthetic Pathway. J. Exp. Bot. 46: 1363-1376.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Feria, A.B., Alvarez, R., Cochereau, L., Vidal, J., García-Mauriño, S., and Echevarría, C. (2008). Regulation of phosphoenolpyruvatecarboxylase phosphorylation by metabolites and abscisic acid during the development and germination of barley seeds. PlantPhysiology 148: 761-774.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Fulton, D.C., Stettler, M., Mettler, T., Vaughan, C.K., Li, J., Francisco, P., Gil, D., Reinhold, H., Eicke, S., Messerli, G., Dorken, G.,Halliday, K., Smith, A.M., Smith, S.M., and Zeeman, S.C. (2008). ß-AMYLASE4, a noncatalytic protein required for starch breakdown, actsupstream of three active ß-amylases in Arabidopsis chloroplasts. Plant Cell 20: 1040-1058.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Gamborg, O.L., Miller, R.A., and Ojima, K. (1968). Nutrient requirements of suspension cultures of soybean root cells. Exp. Cell Res. 50:151-158.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Gaymard, F., Pilot, G., Lacombe, B., Bouchez, D., Bruneau, D., Boucherez, J., Michaux-Ferriere, N., Thibaud, J.B., and Sentenac, H.(1998). Identification and disruption of a plant shaker-like outward channel involved in K+ release into the xylem sap. Cell 94: 647-655.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

González, M.-C., Echevarria, C., Vidal, J., and Cejudo, F.J. (2002). Isolation and characterisation of a wheat phosphoenolpyruvatecarboxylase gene. Modelling of the encoded protein. Plant Science 162: 233-238.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Gould, P.D., Diaz, P., Hogben, C., Kusakina, J., Salem, R., Hartwell, J., and Hall, A. (2009). Delayed fluorescence as a universal tool forthe measurement of circadian rhythms in higher plants. Plant J. 58: 893-901.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Grondin, A., Rodrigues, O., Verdoucq, L., Merlot, S., Leonhardt, N., and Maurel, C. (2015). Aquaporins Contribute to ABA-TriggeredStomatal Closure through OST1-Mediated Phosphorylation. Plant Cell 27: 1945-1954.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Gross, S.M., Martin, J.A., Simpson, J., Abraham-Juarez, M.J., Wang, Z., and Visel, A. (2013). De novo transcriptome assembly of droughttolerant CAM plants, Agave deserti and Agave tequilana

. BMC Genomics 14: Art. No. 563.

Hartwell, J. (2005). The co-ordination of central plant metabolism by the circadian clock. Biochem. Soc. Trans. 33: 945-948.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hartwell, J. (2006). The circadian clock in CAM plants. In Endogenous Plant Rhythms, A.J.W. Hall and H.G. McWatters, eds (Oxford, UK:Blackwell Publishing Ltd), pp. 211 - 236.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hartwell, J., Dever, L.V., and Boxall, S.F. (2016). Emerging model systems for functional genomics analysis of Crassulacean acidmetabolism. Curr. Opin. Plant Biol. 31: 100-108.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hartwell, J., Smith, L., Wilkins, M., Jenkins, G., and Nimmo, H. (1996). Higher plant phosphoenolpyruvate carboxylase kinase isregulated at the level of translatable mRNA in response to light or a circadian rhythm. Plant J. 10: 1071-1078.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hartwell, J., Gill, A., Nimmo, G.A., Wilkins, M.B., Jenkins, G.L., and Nimmo, H.G. (1999). Phosphoenolpyruvate carboxylase kinase is anovel protein kinase regulated at the level of expression. Plant J. 20: 333-342.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hashimoto, M., Negi, J., Young, J., Israelsson, M., Schroeder, J.I., and Iba, K. (2006). Arabidopsis HT1 kinase controls stomatalmovements in response to CO2. Nat. Cell Biol. 8: 391-397.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hashimoto-Sugimoto, M., Higaki, T., Yaeno, T., Nagami, A., Irie, M., Fujimi, M., Miyamoto, M., Akita, K., Negi, J., Shirasu, K., Hasezawa,S., and Iba, K. (2013). A Munc13-like protein in Arabidopsis mediates H+-ATPase translocation that is essential for stomatal responses.Nature Communications 4: Art. No. 2215.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Haydon, M.J., Mielczarek, O., Robertson, F.C., Hubbard, K.E., and Webb, A.A.R. (2013). Photosynthetic entrainment of the Arabidopsisthaliana circadian clock. Nature 502: 689-692.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hedrich, R., and Geiger, D. (2017). Biology of SLAC1-type anion channels - from nutrient uptake to stomatal closure. New Phytol. 216:46-61.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Helfer, A., Nusinow, D.A., Chow, B.Y., Gehrke, A.R., Bulyk, M.L., and Kay, S.A. (2011). LUX ARRHYTHMO encodes a nighttime repressorof circadian gene expression in the Arabidopsis core clock. Curr. Biol. 21: 126-133.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Heyduk, K., Ray, J.N., Ayyampalayam, S., and Leebens-Mack, J. (2018). Shifts in gene expression profiles are associated with weak andstrong Crassulacean acid metabolism. Am. J. Bot. 105: 587-601.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Heyduk, K., Hwang, M., Albert, V., Silvera, K., Lan, T.Y., Farr, K., Chang, T.H., Chan, M.T., Winter, K., and Leebens-Mack, J. (2019).Altered Gene Regulatory Networks Are Associated With the Transition From C3 to Crassulacean Acid Metabolism in Erycina(Oncidiinae: Orchidaceae). Front Plant Sci 9: Art. No. 2000.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hiyama, A., Takemiya, A., Munemasa, S., Okuma, E., Sugiyama, N., Tada, Y., Murata, Y., and Shimazaki, K. (2017). Blue light and CO2signals converge to regulate light-induced stomatal opening. Nature Communications 8: Art. No. 1284.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Holtum, J.A.M., Hancock, L.P., Edwards, E.J., and Winter, K. (2017). Facultative CAM photosynthesis (crassulacean acid metabolism) infour species of Calandrinia, ephemeral succulents of arid Australia. Photosynthesis Res. 134: 17-25.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Horrer, D., Fluetsch, S., Pazmino, D., Matthews, J.S.A., Thalmann, M., Nigro, A., Leonhardt, N., Lawson, T., and Santelia, D. (2016). BlueLight Induces a Distinct Starch Degradation Pathway in Guard Cells for Stomatal Opening. Curr. Biol. 26: 362-370.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hu, H.H., Boisson-Dernier, A., Israelsson-Nordstrom, M., Bohmer, M., Xue, S.W., Ries, A., Godoski, J., Kuhn, J.M., and Schroeder, J.I.(2010). Carbonic anhydrases are upstream regulators of CO2-controlled stomatal movements in guard cells. Nat. Cell Biol. 12: 87-93.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Imes, D., Mumm, P., Bohm, J., Al-Rasheid, K.A., Marten, I., Geiger, D., and Hedrich, R. (2013). Open stomata 1 (OST1) kinase controls R-type anion channel QUAC1 in Arabidopsis guard cells. Plant J. 74: 372-382.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Jezek, M., and Blatt, M.R. (2017). The Membrane Transport System of the Guard Cell and Its Integration for Stomatal Dynamics. PlantPhysiol. 174: 487-519.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Karimi, M., Inze, D., and Depicker, A. (2002). GATEWAYTM vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci.7: 193-195.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kim, T.-H., Böhmer, M., Hu, H., Nishimura, N., and Schroeder, J.I. (2010). Guard Cell Signal Transduction Network: Advances inUnderstanding Abscisic Acid, CO2, and Ca2+ Signaling. Annu. Rev. Plant Biol. 61: 561-591.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kinoshita, T., Doi, M., Suetsugu, N., Kagawa, T., Wada, M., and Shimazaki, K. (2001). phot1 and phot2 mediate blue light regulation ofstomatal opening. Nature 414: 656-660.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kluge, M., and Fischer, K. (1967). Relations between CO2-Exchange and Transpiration in Bryophyllum daigremontianum Berg. Planta77: 212-223.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kondo, A., Nose, A., Yuasa, H., and Ueno, O. (2000). Species variation in the intracellular localization of pyruvate, Pi dikinase in leavesof crassulacean-acid-metabolism plants: an immunogold electron-microscope study. Planta 210: 611-621.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kore-eda, S., Noake, C., Ohishi, M., Ohnishi, J., and Cushman, J.C. (2005). Transcriptional profiles of organellar metabolite transportersduring induction of crassulacean acid metabolism in Mesembryanthemum crystallinum. Funct. Plant Biol. 32: 451-466.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kore-eda, S., Nozawa, A., Okada, Y., Takashi, K., Azad, M.A., Ohnishi, J., Nishiyama, Y., and Tozawa, Y. (2013). Characterization of theplastidic phosphate translocators in the inducible crassulacean acid metabolism plant Mesembryanthemum crystallinum. BiosciBiotech Bioch 77: 1511-1516.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lee, S.B., Kim, H.U., and Suh, M.C. (2016). MYB94 and MYB96 Additively Activate Cuticular Wax Biosynthesis in Arabidopsis. Plant CellPhysiol 57: 2300-2311.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Liang, Y.K., Dubos, C., Dodd, I.C., Holroyd, G.H., Hetherington, A.M., and Campbell, M.M. (2005). AtMYB61, an R2R3-MYB transcriptionfactor controlling stomatal aperture in Arabidopsis thaliana. Curr. Biol. 15: 1201-1206.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lim, S.D., Lee, S., Choi, W.-G., Yim, W.C., and Cushman, J.C. (2019). Laying the Foundation for Crassulacean Acid Metabolism (CAM)Biodesign: Expression of the C4 Metabolism Cycle Genes of CAM in Arabidopsis. Front Plant Sci 10: Art. No 101.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Liu, J., Ishitani, M., Halfter, U., Kim, C.S., and Zhu, J.K. (2000). The Arabidopsis thaliana SOS2 gene encodes a protein kinase that isrequired for salt tolerance. P Natl Acad Sci USA 97: 3730-3734.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lüttge, U., and Ball, E. (1978). Free Running Oscillations of Transpiration and CO2 Exchange in CAM Plants without a ConcomitantRhythm of Malate Levels. Z Pflanzenphysiol 90: 69-77.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ma, Y., Szostkiewicz, I., Korte, A., Moes, D., Yang, Y., Christmann, A., and Grill, E. (2009). Regulators of PP2C Phosphatase ActivityFunction as Abscisic Acid Sensors. Science 324: 1064-1068.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Males, J., and Griffiths, H. (2017). Stomatal Biology of CAM Plants. Plant Physiol. 174: 550-560.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ming, R., VanBuren, R., Wai, C.M., Tang, H.B., Schatz, M.C., Bowers, J.E., Lyons, E., Wang, M.L., Chen, J., Biggers, E., Zhang, J.S.,Huang, L.X., Zhang, L.M., Miao, W.J., Zhang, J., Ye, Z.Y., Miao, C.Y., Lin, Z.C., Wang, H., Zhou, H.Y., Yim, W.C., Priest, H.D., Zheng, C.F.,Woodhouse, M., Edger, P.P., Guyot, R., Guo, H.B., Guo, H., Zheng, G.Y., Singh, R., Sharma, A., Min, X.J., Zheng, Y., Lee, H., Gurtowski,J., Sedlazeck, F.J., Harkess, A., McKain, M.R., Liao, Z.Y., Fang, J.P., Liu, J., Zhang, X.D., Zhang, Q., Hu, W.C., Qin, Y., Wang, K., Chen,L.Y., Shirley, N., Lin, Y.R., Liu, L.Y., Hernandez, A.G., Wright, C.L., Bulone, V., Tuskan, G.A., Heath, K., Zee, F., Moore, P.H., Sunkar, R.,Leebens-Mack, J.H., Mockler, T., Bennetzen, J.L., Freeling, M., Sankoff, D., Paterson, A.H., Zhu, X.G., Yang, X.H., Smith, J.A.C.,Cushman, J.C., Paull, R.E., and Yu, Q.Y. (2015). The pineapple genome and the evolution of CAM photosynthesis. Nat. Genet. 47: 1435-1442.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Möllering, H. (1985). L-malate. Determination with malate dehydrogenase and aspartate aminotransferase. In Methods in EnzymaticAnalysis, H.U. Bermeyer, J. Bermeyer, and M. Grasstl, eds (Weinheim: Verlag Chemie), pp. 39 - 47.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Monroe, J.D., and Storm, A.R. (2018). The Arabidopsis β-amylase (BAM) gene family: Diversity of form and function. Plant Sci. 276: 163-170.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Moore, A., Zielinski, T., and Millar, A.J. (2014). Online Period Estimation and Determination of Rhythmicity in Circadian Data, Using theBioDare Data Infrastructure. In Plant Circadian Networks: Methods and Protocols, D. Staiger, ed (New York: Springer Science andBusiness Media), pp. 13-44.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Moseley, R.C., Tuskan, G.A., and Yang, X. (2019). Comparative Genomics Analysis Provides New Insight Into Molecular Basis ofStomatal Movement in Kalanchoë fedtschenkoi. Front Plant Sci 10: Art. No. 292.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Murashige, T., and Skoog, F. (1962). A revised medium for rapid growth and bio-assays with tobacco tissue cultures. Physiol. Plant. 15:473-497.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Neuhaus, H.E., and Schulte, N. (1996). Starch degradation in chloroplasts isolated from C3 or CAM (crassulacean acid metabolism)-induced Mesembryanthemum crystallinum L. Biochem. J. 318 945-953.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nimmo, G.A., Nimmo, H.G., Fewson, C.A., and Wilkins, M.B. (1984). Diurnal Changes in the Properties of PhosphoenolpyruvateCarboxylase in Bryophyllum Leaves - a Possible Covalent Modification. FEBS Lett. 178: 199-203.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nimmo, G.A., Nimmo, H.G., Hamilton, I.D., Fewson, C.A., and Wilkins, M.B. (1986). Purification of the Phosphorylated Night Form andDephosphorylated Day Form of Phosphoenolpyruvate Carboxylase from Bryophyllum fedtschenkoi. Biochem. J. 239: 213-220.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

O'Leary, B., Park, J., and Plaxton, W.C. (2011). The remarkable diversity of plant PEPC (phosphoenolpyruvate carboxylase): recentinsights into the physiological functions and post-translational controls of non-photosynthetic PEPCs. Biochem. J. 436: 15-34.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Osmond, C.B. (1978). Crassulacean acid metabolism: a curiosity in context. Annu. Rev. Plant Physiol. Plant Mol. Biol. 29: 379-414.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Park, S.Y., Fung, P., Nishimura, N., Jensen, D.R., Fujii, H., Zhao, Y., Lumba, S., Santiago, J., Rodrigues, A., Chow, T.F.F., Alfred, S.E.,Bonetta, D., Finkelstein, R., Provart, N.J., Desveaux, D., Rodriguez, P.L., McCourt, P., Zhu, J.K., Schroeder, J.I., Volkman, B.F., andCutler, S.R. (2009). Abscisic Acid Inhibits Type 2C Protein Phosphatases via the PYR/PYL Family of START Proteins. Science 324: 1068-1071.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Prasch, C.M., Ott, K.V., Sonnewald, U., Bauer, H., Ache, P., and Hedrich, R. (2015). ß-amylase1 mutant Arabidopsis plants showimproved drought tolerance due to reduced starch breakdown in guard cells. J. Exp. Bot. 66: 6059-6067.

Pubmed: Author and Title

Google Scholar: Author Only Title Only Author and Title

Rawat, R., Schwartz, J., Jones, M.A., Sairanen, I., Cheng, Y., Andersson, C.R., Zhao, Y., Ljung, K., and Harmer, S.L. (2009). REVEILLE1, aMyb-like transcription factor, integrates the circadian clock and auxin pathways. P Natl Acad Sci USA 106: 16883-16888.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ritte, G., Heydenreich, M., Mahlow, S., Haebel, S., Kötting, O., and Steup, M. (2006). Phosphorylation of C6- and C3-positions ofglucosyl residues in starch is catalysed by distinct dikinases. FEBS Lett. 580: 4872–4876.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Salahas, G., Manetas, Y., and Gavalas, N.A. (1990). Assaying for pyruvate, orthophosphate dikinase activity - necessary precautionswith phosphoenolpyruvate carboxylase as coupling enzyme. Photosynthesis Res. 24: 183-188.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Santelia, D., and Lunn, J.E. (2017). Transitory Starch Metabolism in Guard Cells: Unique Features for a Unique Function. Plant Physiol.174: 539-549.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Santiago, J., Dupeux, F., Round, A., Antoni, R., Park, S.-Y., Jamin, M., Cutler, S.R., Rodriguez, P.L., and Márquez, J.A. (2009). Theabscisic acid receptor PYR1 in complex with abscisic acid. Nature 462: 665-668.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Schluepmann, H., Pellny, T., van Dijken, A., Smeekens, S., and Paul, M. (2003). Trehalose 6-phosphate is indispensable forcarbohydrate utilization and growth in Arabidopsis thaliana. P Natl Acad Sci USA 100: 6849-6854.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Seo, P.J., Lee, S.B., Suh, M.C., Park, M.J., Go, Y.S., and Park, C.M. (2011). The MYB96 Transcription Factor Regulates Cuticular WaxBiosynthesis under Drought Conditions in Arabidopsis. Plant Cell 23: 1138-1152.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Sharma, A., Wai, C.M., Ming, R., and Yu, Q. (2017). Diurnal Cycling Transcription Factors of Pineapple Revealed by Genome-WideAnnotation and Global Transcriptomic Analysis. Genome Biol Evol 9: 2170-2190.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Shi, J., Yi, K., Liu, Y., Xie, L., Zhou, Z., Chen, Y., Hu, Z., Zheng, T., Liu, R., Chen, Y., and Chen, J. (2015). PhosphoenolpyruvateCarboxylase in Arabidopsis Leaves Plays a Crucial Role in Carbon and Nitrogen Metabolism. Plant Physiol. 167: 671-681.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Smith, A.M., and Zeeman, S.C. (2006). Quantification of starch in plant tissues. Nat Protoc 1: 1342-1345.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Smith, A.M., Zeeman, S.C., and Smith, S.M. (2005). Starch degradation. Annu. Rev. Plant Biol. 56: 73-98.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Somers, D.E., Devlin, P.F., and Kay, S.A. (1998). Phytochromes and cryptochromes in the entrainment of the Arabidopsis circadianclock. Science 282: 1488-1490.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Taybi, T., Patil, S., Chollet, R., and Cushman, J.C. (2000). A minimal serine/threonine protein kinase circadianly regulatesphosphoenolpyruvate carboxylase activity in crassulacean acid metabolism-induced leaves of the common ice plant. Plant Physiol. 123:1471-1481.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Valerio, C., Marri, L., Pupillo, P., Trost, P., Sparla, F., Costa, A., and Issakidis-Bourguet, E. (2010). Thioredoxin-regulated β-amylase(BAM1) triggers diurnal starch degradation in guard cells, and in mesophyll cells under osmotic stress. J. Exp. Bot. 62: 545-555.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

von Caemmerer, S., and Furbank, R.T. (2003). The C4 pathway: an efficient CO2 pump. Photosynthesis Res. 77: 191-207.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Von Caemmerer, S., and Griffiths, H. (2009). Stomatal responses to CO2 during a diel Crassulacean acid metabolism cycle in Kalanchoëdaigremontiana and Kalanchoë pinnata. Plant, Cell Environ. 32: 567-576.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wai, C.M., and VanBuren, R. (2018). Circadian Regulation of Pineapple CAM Photosynthesis. In Genetics and Genomics of Pineapple,R. Ming, ed (Cham: Springer International Publishing), pp. 247-258.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wai, C.M., Weise, S.E., Ozersky, P., Mockler, T.C., Michael, T.P., and VanBuren, R. (2019). Time of day and network reprogrammingduring drought induced CAM photosynthesis in Sedum album. PLoS Genet. 15: e1008209.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wild, B., Wanek, W., Postl, W., and Richter, A. (2010). Contribution of carbon fixed by Rubisco and PEPC to phloem export in theCrassulacean acid metabolism plant Kalanchoë daigremontiana. J. Exp. Bot. 61: 1375-1383.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wilkins, M.B. (1959). An endogenous rhythm in the rate of carbon dioxide output of Bryophyllum. I. Some preliminary experiments. J.Exp. Bot. 10: 377-390.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wilkins, M.B. (1992). Circadian rhythms - their origin and control. New Phytol. 121: 347-375.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Winter, K. (2019). Ecophysiology of constitutive and facultative CAM photosynthesis. J. Exp. Bot. 10.1093/jxb/erz002.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Winter, K., and Holtum, J.A. (2014). Facultative crassulacean acid metabolism (CAM) plants: powerful tools for unravelling the functionalelements of CAM photosynthesis. J. Exp. Bot. 65: 3425-3441.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wyka, T.P., and Lüttge, U.E. (2003). Contribution of C3 carboxylation to the circadian rhythm of carbon dioxide uptake in a Crassulaceanacid metabolism plant Kalanchoë daigremontiana. J. Exp. Bot. 54: 1471-1479.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Yang, X., Hu, R., Yin, H., Jenkins, J., Shu, S., Tang, H., Liu, D., Weighill, D.A., Cheol Yim, W., Ha, J., Heyduk, K., Goodstein, D.M., Guo,H.B., Moseley, R.C., Fitzek, E., Jawdy, S., Zhang, Z., Xie, M., Hartwell, J., Grimwood, J., Abraham, P.E., Mewalal, R., Beltran, J.D., Boxall,S.F., Dever, L.V., Palla, K.J., Albion, R., Garcia, T., Mayer, J.A., Don Lim, S., Man Wai, C., Peluso, P., Van Buren, R., De Paoli, H.C.,Borland, A.M., Guo, H., Chen, J.G., Muchero, W., Yin, Y., Jacobson, D.A., Tschaplinski, T.J., Hettich, R.L., Ming, R., Winter, K., Leebens-Mack, J.H., Smith, J.A.C., Cushman, J.C., Schmutz, J., and Tuskan, G.A. (2017). The Kalanchoë genome provides insights intoconvergent evolution and building blocks of crassulacean acid metabolism. Nature Communications 8: Art. No. 1899.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Yin, H.F., Guo, H.B., Weston, D.J., Borland, A.M., Ranjan, P., Abraham, P.E., Jawdy, S.S., Wachira, J., Tuskan, G.A., Tschaplinski, T.J.,Wullschleger, S.D., Guo, H., Hettich, R.L., Gross, S.M., Wang, Z., Visel, A., and Yang, X.H. (2018). Diel rewiring and positive selection ofancient plant proteins enabled evolution of CAM photosynthesis in Agave. BMC Genomics 19: Art. No. 588.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Yoshida, T., dos Anjos, L., Medeiros, D.B., Araujo, W.L., Fernie, A.R., and Daloso, D.M. (2019). Insights into ABA-mediated regulation ofguard cell primary metabolism revealed by systems biology approaches. Prog. Biophys. Mol. Biol. 146: 37-49.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Zhang, J.B., De-oliveira-Ceciliato, P., Takahashi, Y., Schulze, S., Dubeaux, G., Hauser, F., Azoulay-Shemer, T., Toldsepp, K., Kollist, H.,Rappel, W.J., and Schroeder, J.I. (2018). Insights into the Molecular Mechanisms of CO2-Mediated Regulation of Stomatal Movements.Curr. Biol. 28: R1356-R1363.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Zhou, Y.P., Duan, J., Fujibe, T., Yamamoto, K.T., and Tian, C.E. (2012). AtIQM1, a novel calmodulin-binding protein, is involved instomatal movement in Arabidopsis. Plant Mol. Biol. 79: 333-346.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Zielinski, T., Moore, A.M., Troup, E., Halliday, K.J., and Millar, A.J. (2014). Strengths and Limitations of Period Estimation Methods forCircadian Data. Plos One 9: e96462.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

DOI 10.1105/tpc.19.00481; originally published online February 12, 2020;Plant Cell

HartwellSusanna F Boxall, Nirja Kadu, Louisa V Dever, Jana Knerova, Jade L. Waller, Peter D Gould and James

Circadian Clock and Guard Cell Signaling GenesKalanchoë PPC1 is Essential for Crassulacean Acid Metabolism and the Regulation of Core

 This information is current as of September 17, 2020

 

Supplemental Data /content/suppl/2020/02/17/tpc.19.00481.DC2.html /content/suppl/2020/02/12/tpc.19.00481.DC1.html

Permissions https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X

eTOCs http://www.plantcell.org/cgi/alerts/ctmain

Sign up for eTOCs at:

CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain

Sign up for CiteTrack Alerts at:

Subscription Information http://www.aspb.org/publications/subscriptions.cfm

is available at:Plant Physiology and The Plant CellSubscription Information for

ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists