kdgrecc negatively regulates genes for pectinases, cellulase, … · hypersensitive reaction. we...

JOURNAL OF BACTERIOLOGY,0021-9193/99/$04.0010

Apr. 1999, p. 2411–2422 Vol. 181, No. 8

Copyright © 1999, American Society for Microbiology. All Rights Reserved.

kdgREcc Negatively Regulates Genes for Pectinases, Cellulase,Protease, HarpinEcc, and a Global RNA Regulator

in Erwinia carotovora subsp. carotovora†YANG LIU, GUOQIAO JIANG, YAYA CUI, ASITA MUKHERJEE, WEI LEI MA,

AND ARUN K. CHATTERJEE*

Plant Sciences Unit, University of Missouri, Columbia, Missouri 65211

Received 10 November 1998/Accepted 3 February 1999

Erwinia carotovora subsp. carotovora produces extracellular pectate lyase (Pel), polygalacturonase (Peh),cellulase (Cel), and protease (Prt). The concerted actions of these enzymes largely determine the virulence ofthis plant-pathogenic bacterium. E. carotovora subsp. carotovora also produces HarpinEcc, the elicitor of thehypersensitive reaction. We document here that KdgREcc (Kdg, 2-keto-3-deoxygluconate; KdgR, general re-pressor of genes involved in pectin and galacturonate catabolism), a homolog of the E. chrysanthemi repressor,KdgREch and the Escherichia coli repressor, KdgREco, negatively controls not only the pectinases, Pel and Peh,but also Cel, Prt, and HarpinEcc production in E. carotovora subsp. carotovora. The levels of pel-1, peh-1, celV,and hrpNEcc transcripts are markedly affected by KdgREcc. The KdgREcc

2 mutant is more virulent than theKdgREcc

1 parent. Thus, our data for the first time establish a global regulatory role for KdgREcc in E. caro-tovora subsp. carotovora. Another novel observation is the negative effect of KdgREcc on the transcription ofrsmB (previously aepH), which specifies an RNA regulator controlling exoenzyme and HarpinEcc production.The levels of rsmB RNA are higher in the KdgREcc

2 mutant than in the KdgREcc1 parent. Moreover, by DNase

I protection assays we determined that purified KdgREcc protected three 25-bp regions within the transcrip-tional unit of rsmB. Alignment of the protected sequences revealed the 21-mer consensus sequence of theKdgREcc-binding site as 5*-G/AA/TA/TGAAA[N6]TTTCAG/TG/TA-3*. Two such KdgREcc-binding sites occur inrsmB DNA in a close proximity to each other within nucleotides 179 and 1139 and the third KdgREcc-bindingsite within nucleotides 1207 and 1231. Analysis of lacZ transcriptional fusions shows that the KdgR-bindingsites negatively affect the expression of rsmB. KdgREcc also binds the operator DNAs of pel-1 and peh-1 genesand represses expression of a pel1-lacZ and a peh1-lacZ transcriptional fusions. We conclude that KdgREccaffects extracellular enzyme production by two ways: (i) directly, by inhibiting the transcription of exoenzymegenes; and (ii) indirectly, by preventing the production of a global RNA regulator. Our findings support theidea that KdgREcc affects transcription by promoter occlusion, i.e., preventing the initiation of transcription,and by a roadblock mechanism, i.e., by affecting the elongation of transcription.

Erwinia carotovora subsp. carotovora causes tissue-macerat-ing or soft-rotting disease in plants or plant organs (10, 42).The elicitation of this disease requires the production of ex-tracellular enzymes, especially pectinases such as pectate lyase(Pel), polygalacturonase (Peh), and pectin lyase (Pnl), whichare responsible for degrading plant cell wall components (2, 3).The genes for exoenzymes are subject to transcriptional as wellas posttranscriptional regulation (28, 56). A number of tran-scriptional factors, including, for example, AepA (36), HexA(17), HexY (50), Hor (54), RpoS (34), Rpf (16), ExpAB (14),and RdgAB (26, 29, 30), have been identified. Expression ofpel, peh, cel, and prt is also influenced by plant signals as well asthe cell density (quorum) sensing signal, N-(3-oxohexanoyl)-L-homoserine lactone (OHL) (5, 8, 24, 36, 44). How these tran-scriptional factors and signals interact to modulate the expres-sion of these exoenzyme genes has not yet been elucidated.

RsmA-rsmB constitutes a novel regulatory pair responsiblefor posttranscriptional regulation of exoenzyme genes (28).RsmA, an RNA-binding protein, promotes the decay of the

transcripts of many genes (5, 12). rsmB, formerly known asaepH (35), encodes a unique RNA regulator which is pre-sumed to affect the levels of RsmA, neutralize the RsmAaction, or both (28). This regulatory system controls manytraits, including the synthesis of OHL, extracellular enzymes,elicitors of the hypersensitive reaction, phytohormones, andextracellular polysaccharides, as well as other traits such aspathogenicity factors, bacterial motility, and various secondarymetabolites. The elegant and extensive work of Romeo andassociates in Escherichia coli have characterized a homologoussystem comprising CsrA and csrB (25, 48). This regulatory paircontrols glycogen accumulation, cell surface properties, andcell size in E. coli (25, 49).

The current model (28) postulates that RsmA and rsmB actin concert to modulate the expression of many genes, partic-ularly those that are expressed in a growth-phase-dependentmanner. Since rsmA specifies an RNA-binding protein whichpromotes message decay, it is reasonable to assume that RsmAlevels and RsmA activity are probably rigorously controlled bybacteria to prevent the extensive decay of transcripts of genesfor growth and housekeeping functions. In addition to rigorousregulation of rsmA expression (33, 34), the modulation of theRsmA effect is mainly accomplished by the production of rsmBRNA (28). It therefore follows that factors controlling theproduction of rsmB RNA could have a profound effect onexoenzyme and other metabolite production.

* Corresponding author. Mailing address: Plant Sciences Unit, Uni-versity of Missouri, 108 Waters Hall, Columbia, MO 65211. Phone:(573) 882-1892. Fax: (573) 882-0588. E-mail: [email protected].

† Journal series 12,848 of the Missouri Agricultural ExperimentStation.

2411

on April 19, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Extensive studies in E. chrysanthemi (3, 21) have establishedthat KdgR negatively regulates the genes involved in pectindegradation (Kdg, 2-keto-3-deoxygluconate; KdgR, general re-pressor of genes involved in pectin and galacturonate catabo-lism). In fact, KdgREch has been found to affect the expressionof at least 13 operons of E. chrysanthemi involved in pectincatabolism and enzyme export via the type II secretion path-way (21). Through systematic analysis of the KdgREch bindingto operators, Nasser and associates have elucidated the con-sensus KdgREch binding site (KDGR box) for the E. chrysan-themi genes (38). Although putative KdgR-binding sequenceshave been detected within several E. carotovora subsp. caroto-vora pectinase genes (6, 20, 27), as well as in rsmB (28, 35), toour knowledge there has been no report documenting theregulatory effects of KdgREcc. In this work we (i) show thatkdgREcc has high homology with the corresponding genes ofE. chrysanthemi and E. coli; (ii) document overproductionand purification of KdgREcc from E. coli; (iii) establish thatKdgREcc is a DNA binding protein; (iv) localize the KdgR-binding sites; and (v) show that the production of exoenzymes,HarpinEcc, and rsmB transcripts is derepressed in a KdgREcc

2

mutant constructed by marker exchange and that kdgREcc1

DNA exerts a negative trans-dominant effect. The findingsreported here for the first time demonstrate that KdgR affectsthe levels of Cel, Prt, and HarpinEcc, in addition to the pecti-nases, and that in E. carotovora subsp. carotovora KdgR regu-lates the structural genes for some of the exoenzymes directly,as well as indirectly by controlling the expression of a globalregulator. Furthermore, we present data that support the hy-pothesis that KdgREcc affects gene expression in E. carotovorasubsp. carotovora by interfering with the initiation of transcrip-tion as well as by preventing the elongation of transcription bya roadblock mechanism.

MATERIALS AND METHODS

Bacterial strains and media. The bacterial strains used here are listed in Table1. Recipes of Luria-Bertani (LB) medium and minimal salts medium have beendescribed (5, 9). When required, antibiotics were supplemented as follows (mg/ml): ampicillin (Ap), 100; kanamycin (Km), 50; spectinomycin (Sp), 50; andtetracycline (Tc), 10. Media were solidified by the addition of 1.5% (wt/vol) agar.

Extracellular enzyme assays. The compositions of agarose media for semi-quantitative plate assay for extracellular cellulase (Cel), Pel, Peh, and protease (Prt)

TABLE 1. Bacterial strains and plasmids

Strain or plasmid Relevant characteristics Source or reference

StrainE. carotovora subsp.

carotovoraEcc71 Wild type 57AC5073 KdgREcc

2 mutant of Ecc71, Spr This workE. chrysanthemi EC16 Wild type 7E. coli

DH5a f80lacZDM15 D(lacZYA-argF) U169 hsdR17 recA1 endA1 thi-1 Gibco-BRLJM109(DE3) endA1 recA1 gyrA96 hsdR17 supE44 relA1 thi D(lac-pro) F9 (traD36 proAB1 lacIq lacZDM15)

lcI857 ind1 Sam7 lacU5-T7 gene 1Promega Biotec

PlasmidpBluescript SK(1) Apr StratagenepCRII Apr InvitrogenpDK6 Kmr 23pET-28b(1) Kmr NovagenpGEM-T Easy Apr Promega BiotecpHP45V Source of Spr omega fragment 45pLARF5 Tcr 22pMP220 Tcr 52pRK415 Tcr 22pRK2013 Mob1 Tra1 Kmr 15pT7-7 Apr 53pAKC781 Apr, peh-11 27pAKC783 Apr, pel-11 27pAKC923 Apr, hrpNEcc

1 DNA in pBluescript SK(1) 13pAKC924 Apr, hrpNEcc DNA in pBluescript SK(1) 13pAKC1002 Tcr, rsmB-lacZ fusion 28pAKC1014 Apr, rsmB DNA in pBluescript SK(1) 28pAKC1018 Tcr, rsmB-lacZ fusion 28pAKC1020 Tcr, rsmB-lacZ fusion 28pAKC1021 Tcr, rsmB DNA 28pAKC1023 Apr, PCR product of EC16 kdgREch in pCRII This workpAKC1024 Tcr, strain Ecc71 kdgREcc

1 DNA in pLARF5 This workpAKC1025 Tcr, kdgREcc

1, 7.35-kb ClaI fragment from pAKC1024 in pRK415 This workpAKC1026 Tcr, 1.2-kb EcoRI DNA containing part of kdgREcc from pAKC1025 cloned in pRK415 This workpAKC1027 Spr Tcr, V-Sp insertion in the BstEII site of pAKC1026 This workpAKC1028 Apr, pT7-kdgREcc in pT7-7 This workpAKC1029 Kmr, pT7-kdgREcc-6His in pET-28b(1) This workpAKC1030 Apr, 188-bp pel-1 DNA fragment in pBluescript SK(1) This workpAKC1031 Tcr, 188-bp pel-1 DNA fragment from pAKC1030 in pMP220 This workpAKC1032 Apr, 383-bp peh-1 DNA in pBluescript SK(1) This workpAKC1033 Tcr, 383-bp peh-1 DNA fragment from pAKC1032 in pMP220 This workpAKC1034 Apr, 200-bp DNA fragment of celV from strain Ecc71 in pGEM-T Easy This workpAKC1035 Kmr, ptac-kdgREcc in pDK6 This work

2412 LIU ET AL. J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

were previously described (5). The preparation of enzyme samples and quantitativePel assays were carried out according to the method of Murata et al. (36).

PCR techniques. The EasyStart kit (MßP, San Diego, Calif.) was used accord-ing to the manufacturer’s specifications for all PCR amplifications, which wereperformed on a OmniGene thermal cycler (Midwest Scientific, St. Louis, Mo.).The primer sequences are given in Table 2. All PCR products were electropho-resed through low-melting-point SeaPlaque agarose gel (Midwest Scientific).The appropriate bands were excised and purified by using the QIAquick gelextraction kit (Qiagen, Inc., Chatsworth, Calif.) prior to restriction endonucleasetreatment and cloning.

Cloning and nucleotide sequence analysis of kdgREcc. The 135-bp kdgREchprobe was amplified by PCR with primers KDGRP1 and KDGRM1 (Table 2)from chromosomal DNA of E. chrysanthemi EC16. The primers were designedbased on the published sequence of the E. chrysanthemi kdgREch gene (46). PCRproduct was cloned into pCRII vector to produce pAKC1023, and the nucleotidesequence was confirmed by sequencing analysis. We subsequently used thekdgREch DNA to screen a genomic library of E. carotovora subsp. carotovoraEcc71. Southern hybridizations showed that the kdgREch DNA hybridized with a331-bp SalI fragment of pAKC1024 (Fig. 1A), a pLARF5 derivative carryingEcc71 kdgREcc

1 DNA (Table 1). The 331-bp SalI fragment was cloned intopBluescript SK(1), and nucleotide sequence (Fig. 1B) was determined by usingthe universal T3 and T7 primers (Stratagene, La Jolla, Calif.). Starting with thissequence, successive primers (Table 2) were synthesized to sequence the kdgREccgene in pAKC1025. The GenBank accession number for kdgREcc is AF103871.

Plasmids. To construct ptac-kdgREcc, the coding region of kdgREcc was ampli-fied by PCR from pAKC1025 with primers KDGRS7 and KDGRS8 (Table 2).PCR products were digested with NdeI and HindIII and cloned into pT7-7 toyield pAKC1028. The XbaI-HindIII fragment of pAKC1028 was subcloned intopDK6 to produce pAKC1035. For the KdgREcc-6His overexpressing plasmid, thecoding region of kdgREcc was amplified by PCR with primers KDGRP2 andKDGRP3 (Table 2). PCR products were digested with NcoI and XhoI and clonedinto the vector pET-28b(1) to yield pAKC1029. In pAKC1029, additional eightamino acid residues (Leu-Glu-6His) have been added to the C-terminal region ofthe 263 amino acid residues of KdgREcc.

The 188-bp pel-1 DNA from 269 to 1119 (6) was amplified by PCR withprimers PEL1P1 and PEL1P2 (Table 2) and cloned into the EcoRV site ofpBluescript SK(1) to produce plasmid pAKC1030. The BamHI-XbaI fragmentof pAKC1030 was inserted into the BglII-XbaI sites of pMP220 to yieldpAKC1031. To construct peh1-lacZ fusion, the 383-bp peh-1 DNA from 297 to1286 (27) was amplified by PCR with primers PEH1P1 and PEH1P2 (Table 2)and cloned into the HindIII and BamHI sites of pBluescript SK(1) to produceplasmid pAKC1032. The KpnI-XbaI fragment of pAKC1032 was inserted intothe KpnI-XbaI sites of pMP220 to yield pAKC1033. The celV DNA was amplifiedfrom strain Ecc71 chromosomal DNA by PCR with primers CELVP1 andCELVP2 (Table 2) based on nucleotide sequence of celV of E. carotovoraSCRI193 (11) and cloned into pGEM-T Easy.

Construction of KdgREcc2 strains by marker exchange. The 1.2-kb EcoRI

fragment from pAKC1025 was subcloned into pRK415 to produce plasmid

pAKC1026. The Omega-Sp cassette from pHP45V was inserted at the BstEII siteof kdgREcc DNA fragment (Fig. 1A) in pAKC1026 to produce pAKC1027.pAKC1027 was transferred into Ecc71 by using the helper plasmid, pRK2013.Transconjugants were selected on minimal salts agar containing sucrose (0.2%[wt/vol]) and supplemented with Sp. Isolates that were Spr and Tcs were selectedfor further studies. The marker exchange was confirmed by Southern blot hy-bridization as well as by Northern blot analysis.

b-Galactosidase assay. The b-galactosidase assays were carried out accordingto the method of Miller (31).

Purification of KdgREcc-6His recombinant protein. E. coli JM109(DE3) car-rying pAKC1029 was grown at 37°C in LB medium containing Km. When theculture reached an A600 value of 0.7, IPTG (isopropyl-b-D-thiogalactopyrano-side) was added to yield a final concentration of 0.5 mM. After an additional 3-hincubation, cells were collected by centrifugation and frozen at 280°C. KdgREcc-6His was purified from sonicated cell extracts by using Ni-nitriloacetic acid(NTA) resin essentially according to the protocol provided by Qiagen, Inc.Fractions collected from the Ni-NTA affinity column were analyzed by sodiumdodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and those con-taining KdgREcc protein were pooled. The purified KdgREcc protein was storedat 220°C in 50% glycerol. The protein concentration was determined by thebicinchononic acid (Pierce Corp., Rockford, Ill.) method, with bovine serum al-bumin (BSA) as a standard.

Gel mobility shift assay. The DNA fragments were prepared as follows: the188-bp pel-1 DNA was prepared from pAKC1030 (Table 1), the 383-bp peh-1DNA was prepared from pAKC1032 (Table 1), and the 284-bp rsmB was pre-pared from pAKC1021 (28). The plasmid DNAs were digested with the appro-priate endonucleases, and the desired fragments were purified from low-melting-point SeaPlaque agarose gel. The DNA fragments were end labeled with [a-32P]dATP and Klenow fragment and then purified by the Sephadex G-50 spin-column chromatography.

Protein-DNA interaction was assayed in 20 ml of binding buffer (12 mMHEPES-NaOH, pH 7.9; 4 mM Tris-HCl, pH 7.9; 75 mM KCl; 10 mM MgCl2; 5mM CaCl2; 1.0 mM dithiothreitol) containing 1 mg of salmon sperm DNA, 2 mgof BSA, and purified KdgREcc-6His protein. After incubation for 20 min at roomtemperature, the reaction mixtures were subjected to PAGE in a 5% (wt/vol)polyacrylamide gel. The gel was dried and exposed to X-ray film.

DNase I protection analysis. PCR labeling of DNA probes, chemical sequenceanalysis, and DNase I protection assays were carried out according to the meth-od of Liu et al. (29, 30), except that the DNA binding buffer described abovewas used. The rsmB primers, P13 and P16, and purified SacI fragment frompAKC1020 (28) were used to produce the probe by PCR.

RNA assays. Total RNA was obtained from E. carotovora subsp. carotovorastrains. Bacteria were grown at 28°C in minimal salts medium plus sucrose (0.5%[wt/vol]) or in this medium supplemented with Tc. Total RNA was extracted bythe method of Aiba et al. (1).

Primer extension assay was performed according to the manufacturer’s in-structions (Promega Biotec, Madison, Wis.) with primer KDGRS6 (Table 2) and10 mg of RNA.

Northern blot hybridization experiments were performed by following theprocedure of Liu et al. (28). The 517-bp BstEII-EcoRI kdgREcc DNA fragmentfrom pAKC1025 (Table 1) was used as a DNA probe. The other DNA probesused in this work were the 314-bp EcoRV-KpnI DNA fragment of pel-1 frompAKC783 (27), the 743-bp HindIII fragment of peh-1 from pAKC781 (27), the308-bp BamHI-HindIII DNA fragment of rsmB from pAKC1014 (28), the 200-bpEcoRI fragment of celV from pAKC1034 (Table 1), and the 779-bp EcoRV-SmaIDNA fragment of hrpNEcc from pAKC924 (13). DNA probes were labelled with[a-32P]dATP by random priming according to the manufacturer’s instructions(Promega Biotec). Prehybridization (4 h at 65°C) and hybridization (18 h at65°C) were performed in prehybridization buffer (63 SSC [13 SSC is 0.15 MNaCl plus 0.015 M sodium citrate], 23 Denhardt’s solution, 0.1% (wt/vol) SDS,and 100 mg of denatured salmon sperm DNA per ml). After hybridization,membranes were washed twice for 30 min at 65°C in 23 SSC–0.5% (wt/vol) SDSand then for 30 min at 65°C in 0.13 SSC–0.5% (wt/vol) SDS and finally wereexamined by autoradiography with X-ray film (Kodak, Rochester, N.Y.). Thedensities of the hybridization bands were quantified by using the QS30 opticallyenhanced densitometry system (Fisher Scientific, Pittsburgh, Pa.).

Western blot analysis. Bacterial strains were grown at 28°C in minimal saltsmedium containing sucrose to an A600 of 2.0. Western blot analysis of cellextracts was carried out according to the method of Mukherjee et al. (32). Theantibodies raised against HarpinEch (4) were used as the probe.

RESULTS

Cloning and nucleotide sequence of kdgREcc of strain Ecc71.To identify the kdgREcc gene, we amplified a 135-bp segment ofthe kdgR DNA from E. chrysanthemi EC16 by PCR with thedegenerate primers KDGRP1 and KDGRM1 (Table 2). Thenucleotide sequence of the PCR product was 88.1% identicalto the corresponding sequences of kdgREch of strain 3937 (47).The plasmid pAKC1024 (Table 1), obtained by colony hybrid-

TABLE 2. Synthetic oligonucleotide primers

Primer Sequencea (59 to 39) Positionb

KDGRP1 TCAGCTKGAYCTGGTGCGYCAGCAG 1684 to 1708KDGRM1 GTCGGGAARGAGATRCTCAGRCCDG 1818 to 1794KDGRS1 TCAGCAGAACACAGCGTGTGCG 1596 to 1575KDGRS2 TCTGATATTCCCTATCAATGCCTG 1842 to 1865KDGRS3 ACGCAGGTTATACATCGAGTC 1447 to 1427KDGRS4 TCATCGGCTGCAAGAAGCG 1220 to 1202KDGRS5 ACGGACGACACGGAATCG 151 to 131KDGRS6 ACGGACGACACGGAATCG 1101 to 184KDGRS7 GACATATGGCTAGTGCAGATTTAGA 155 to 174KDGRS8 AGAAGCTTGATAGGGAATATCAGAAAG 1859 to 1839KDGRS10 ATGTTGCGCAGGAAGGTG 1233 to 1250KDGRS11 AGAGGTTCTGTCGACTGTCG 1537 to 1553KDGRS12 ACACGAATATGTGGCTATG 1768 to 1786KDGRS13 ATTGTTTCCCGCGTTAGTGCAG 1377 to 1357KDGRP2 ATACCATGGCTAGTGCAGATTTAGATA 155 to 176KDGRP3 ATACTCGAGGAAAGGATAATCGTGGTAACCCA1843 to 1821PEL1P1 ATGTTTCATCCGCAATACATTTAAC 269 to 245PEL1P2 TATTTCATTATCACTGTCTCCTTG 1119 to 196PEH1P1 AGAAAAGCTTACCACCCGCTG 2101 to 281PEH1P2 AAAGGATCCGTTCGGGAATCAGATGCAAATGC1287 to 1263CELVP1 CAGCATTATCCGCCACGCCAGTA 183 to 1105CELVP2 CATGGCGACGCGGAATACGTTA 1282 to 1261

a D 5 A or T or G; K 5 G or T; R 5 A or G; Y 5 C or T.b Corresponding to base positions relative to the transcriptional start site,

except for primers KDGRP1, KDGRM1, CELVP1, and CELVP2. The basepositions of these four primers are given relative to the translational start site.

VOL. 181, 1999 KdgR OF E. CAROTOVORA 2413


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ization with the 135-bp PCR product of kdgREch as the probe,repressed Cel, Pel, Peh, and Prt production in strain Ecc71 asindicated by agarose plate assays (data not shown; also seebelow). The restriction map of the 7.35-kb ClaI DNA fragmentcontaining kdgREcc is shown in Fig. 1A.

The deduced amino acid sequence of kdgREcc (Fig. 1B)shows that the coding region of kdgREcc could specify a poly-peptide of 263 amino acid residues with a molecular mass of29,676 Da. An ogl gene is located upstream of kdgREcc (Fig.1B), as previously reported in E. chrysanthemi (47). A palin-

dromic structure, consisting of a GC-rich stem-loop and anAT-rich tail (Fig. 1B), is localized between ogl and kdgREcc.Since this stem loop is 11 bp downstream of the stop codon ofogl, it is likely that the palindrome functions as a rho-indepen-dent terminator of ogl transcription.

The transcriptional start site of kdgREcc was localized byprimer extension analysis to the adenine residue 54 nucleotidesupstream of the putative start codon (Fig. 1B). The sequencesof the putative 235 box (TTGCCA) and the 210 box (TATACT) of kdgREcc are very similar to those of the E. coli sigma-70

FIG. 1. (A) Physical map of the 7.35 kb of ClaI DNA segment of strain Ecc71 containing the kdgREcc gene. The location and direction of the gene are indicatedby an arrow. The ogl gene is located upstream of kdgREcc, as indicated by the broken arrow. The omega (V) fragment (Sp resistance cassette) was introduced at theBstEII site. B, BstEII; Bg, BglII; C, ClaI; E, EcoRI; P, PstI; S, SalI; V, EcoRV. (B) Nucleotide sequence of kdgREcc and the 39-terminal region of the ogl gene of strainEcc71. The deduced amino acid sequence of KdgREcc is also given. Palindromic sequences in between the ogl and kdgREcc genes are indicated by inverted arrows.Sequences similar to the 210 and 235 consensus sequences are double underlined, and the transcriptional start site is indicated by “11”. Transcriptional terminationsequences represented by an inverted repeat beyond the 39 end of kdgREcc are indicated by double-lined inverted arrows. Several restriction endonuclease sites are alsoshown. Numbers on the right refer to the positions of the nucleotides.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

promoter (Fig. 1B). However, we have not found anyother regulatory element in the vicinity of the kdgREcc pro-moter region, such as the consensus sequences for the bindingof KdgREch (aaTg/aAAAc/tNNt/cg/aTTTc/tA [38]), CRP (TGTGAnnnnnnTCACA [37]), or IclR (TGGAAATna/gTTTCCa/g [41]).

Analysis of the 39 sequence of kdgREcc revealed a palin-dromic structure 19 bp downstream of the kdgREcc codingregion, which is connected to 11 T residues, giving rise to apoly(T) structure (Fig. 1B). If this structure functions as thetranscriptional terminator of kdgREcc, as would be expected,the kdgREcc mRNA would comprise a 900-base transcriptionalunit. Indeed, the results of the Northern blotting assay con-firmed this prediction (data not shown).

The deduced amino acid sequence of KdgREcc has the high-est similarities to KdgREch of E. chrysanthemi (47) and KdgREcoof E. coli (GenBank accession number D90826). An alignmentof these sequences is presented in Fig. 2. KdgREcc is 90 and88% similar to KdgREch and KdgREco, respectively. WhileKdgREcc and KdgREco each consist of 263 amino acid residues,KdgREch has 43 additional amino acid residues at the N-ter-minal end. KdgREcc is 57% similar to the IclR repressor ofE. coli (40), as well as to the GylR repressor of Streptomycescoelicolor (51), which is a member of the IclR family. Sequencecomparisons between these bacterial transcriptional regulatorsand KdgREcc revealed two regions of high similarity. Near theNH2 terminus of the KdgREcc protein, the 34-ITELSQRVMMSKSTVYRFIQ-53 stretch of residues match the helix-turn-helix (HTH) structural motif in GylR, IclR, and KdgREch tran-scriptional regulators. Near the COOH terminus of the KdgREccprotein, residues 194-GYGEDNEEQEEGLRCIAVPVFD-215 match the PROSITE pattern (PS01051, “IclR family sig-

nature”) found in members of the IclR family of regulators,such as IclR and GylR. These observations strongly suggestthat KdgREcc is a member of the IclR transcriptional regulatorfamily.

Effects of KdgREcc on extracellular enzyme and HarpinEccproduction and pathogenicity. To determine the effects ofKdgREcc on exoenzyme production, the KdgREcc

2 mutant,strain AC5073, and its parent strain, Ecc71, were grown inminimal salts medium plus sucrose, and culture supernatantswere assayed to determine their enzymatic activities. The cellsfrom these cultures were used for the isolation of total RNAfor transcript assays. The levels of Pel, Peh, Cel, and Prt werehigher in AC5073 than in Ecc71 (Fig. 3A; Table 3). Similarly,the levels of transcripts in AC5073 were higher than in strainEcc71 (Fig. 3C): the pel-1 transcript was fivefold higher; thepeh-1 transcript was twofold higher; and the celV transcript wasthreefold higher.

As a further proof for the negative regulation of exoenzymesby KdgR, AC5073 carrying the KdgREcc

1 plasmid, pAKC1024,or the cloning vector was grown in minimal salts medium plussucrose and Tc, and culture supernatants and cells were col-lected for assays of enzymatic activities and transcripts, respec-tively. While the KdgREcc

2 mutant carrying the cloning vectorproduced substantial levels of Pel, Peh, Cel, and Prt, theseactivities were undetectable or barely detectable in the mutantcarrying multiple copies of KdgREcc

1 DNA (Fig. 3B and Table3). The levels of pel-1, peh-1, and celV transcripts also wereconsiderably lower in the mutant carrying the KdgR1 plasmidthan in the mutant carrying the vector (Fig. 3D).

To obtain additional evidence that KdgREcc inhibits tran-scription of pel-1 and peh-1, we examined the expression ofpel1-lacZ and peh1-lacZ transcriptional fusions in the E. coli

FIG. 2. Alignment of the deduced amino acid sequence of KdgREcc of strain Ecc71 with those of E. chrysanthemi EC3937 (KdgREch) and E. coli (KdgREco). TheHTH motif is shown. Identical amino acids are not identified. Dots indicate conserved substitutions.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

kdgREcc-overexpressing strain, DH5a (pAKC1035). The datain Table 4 show that the levels of b-galactosidase produced bythe E. coli kdgREcc-overexpressing strain carrying the pel1-lacZand peh1-lacZ fusions were considerably lower than the levelsproduced by DH5a carrying the pDK6 vector and the samelacZ constructs. We attribute this repression of transcription tobinding of KdgREcc to the KdgREcc-binding sites localized inthe 59 regions of pel-1 and peh-1 transcription units (see be-low).

Previous studies have established a positive correlation be-tween the levels of exoenzymes and the virulence of E. caro-tovora subsp. carotovora (3, 5, 12, 13, 19, 34, 43). As exoenzymeproduction was derepressed in the KdgREcc

2 mutant, it wasdeemed of interest to compare the degree of virulence of theKdgREcc

2 and the KdgREcc1 strains. The data presented in

Fig. 3E demonstrate that AC5073 caused more extensive mac-eration of celery petioles than strain Ecc71.

We have shown that hrpNEcc expression and HarpinEcc lev-els in strain Ecc71 are coregulated, along with exoenzymes,OHL, RsmA, and rsmB RNA (28, 32). Thus, in light of theeffects of KdgREcc on pectinases, as well as on Cel and Prt, itwas of interest to examine the influence of KdgR on hrpNEccexpression. The results of Western and Northern analyses (Fig.3C and F) show that HarpinEcc and hrpNEcc mRNA levels werehigher in the KdgREcc

2 mutant than in the KdgREcc1 parent,

Ecc71. In addition, multiple copies of KdgREcc1 DNA severely

FIG. 3. Effects of KdgREcc on the production of exoenzymes and HarpinEcc, on the transcription of exoenzyme genes and hrpNEcc, and on pathogenicity. (A andB) Agarose plate assays for Peh, Prt, and Cel activities of E. carotovora subsp. carotovora strains. Strains Ecc71 (KdgREcc

1, column A1) and AC5073 (KdgREcc2, column

A2) were grown at 28°C in minimal salts medium plus sucrose to an A600 of 2.3, and the culture supernatants (20 ml) were used for the assays of enzymatic activities.AC5073 carrying pLAFR5 (cloning vector, column B1) or pAK1024 (KdgREcc

1, column B2) was grown in minimal salts medium plus sucrose and Tc to an A600 of 2.3,and the culture supernatants (20 ml) were used for the assays of enzymatic activities. The plates were scored for activities after incubation for 24 h at 28°C. Halos aroundthe wells are due to enzymatic activities. (C and D) Levels of transcripts of pel-1, peh-1, hrpNEcc, and celV. Bacteria were grown at 28°C in minimal salts medium plussucrose or in this medium supplemented with Tc to an A600 of 1.0 for RNA extraction. Total RNAs from strains Ecc71 (column C1), AC5073 (column C2), AC5073carrying pLAFR5 (column D1), and AC5073 carrying pAKC1024 (column D2) were used for Northern blot analysis. Lanes 1 and 2 in parts C and D contained 10 and20 mg of total RNA, respectively. (E) Plant tissue maceration induced by strain Ecc71 (site 2) and its KdgREcc

2 mutant, strain AC5073 (site 1). Each inoculation siteof this celery petiole was injected with 2 3 108 cells. Water was used as a control (site 3). The inoculated petiole was incubated in a moist chamber at 25°C for 24 h.(F) Western blot analysis of HarpinEcc produced by strain Ecc71 (lane 1) and its KdgREcc

2 derivative, strain AC5073 (lane 2). Each lane contained 20 mg of totalbacterial protein.

TABLE 3. Levels of Pel produced by E. carotovorasubsp. carotovora

Straina Relevant phenotype Pel sp actb

Ecc71 KdgREcc1 0.05

AC5073 KdgREcc2 0.43

AC5073(pLARF5) KdgREcc2(KdgREcc

2) 0.34AC5073(pAKC1024) KdgREcc

2(KdgREcc1) 0.02

a E. carotovora subsp. carotovora strains Ecc71 and AC5073 were grown at28°C in minimal salts medium plus sucrose (0.5% [wt/vol]), and strains AC5073(pLARF5) and AC5073(pAKC1024) were grown in minimal salts medium plussucrose (0.5% [wt/vol]) and Tc to an A600 of 2.3. Pel activity was assayed as de-scribed by Murata et al. (36).

b Expressed as units per milliliter per A600 unit.

TABLE 4. Levels of b-galactosidase activity of transcriptionalpel1-lacZ, peh1-lacZ, and rsmB-lacZ fusions in

the kdgREcc-overexpressing E. coli strainDH5a(pAKC1035, ptac-kdgREcc)

Plasmidsb-Galactosidase

activity(Miller units)

pAKC1031(pel1-lacZ) 1 pDK6a............................................... 326pAKC1031(pel1-lacZ) 1 pAKC1035a ...................................... 65pAKC1033(peh1-lacZ) 1 pDK6a.............................................. 969pAKC1033(peh1-lacZ) 1 pAKC1035a ..................................... 303pAKC1002(rsmB-lacZ) 1 pAKC1035b .................................... 612pAKC1018(rsmB-lacZ) 1 pAKC1035b .................................... 279

a E. coli constructs were grown at 28°C in LB plus Km plus Tc plus 10 mMIPTG, and cells for b-galactosidase assay were collected at the A600 value of 2.0.

b E. coli constructs were grown at 28°C in LB plus Km plus Tc plus 50 mMIPTG, and cells for b-galactosidase assay were collected at the A600 value of 1.0.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

repressed the production of hrpNEcc mRNA (Fig. 3D). To ourknowledge, this is the first report of a negative effect of KdgRon the expression of a hrp gene.

kdgREcc reduces the levels of rsmB RNA. As stated above,rsmB RNA was recently shown to activate extracellular enzymeand HarpinEcc production in Ecc71. rsmB contains three po-tential KdgR-binding sites within the 59 transcribed region (28,35), suggesting that KdgR may bind rsmB DNA and interruptelongation of rsmB transcription. The following lines of evi-dence support this hypothesis. (i) The amount of rsmB RNA isabout twofold higher in the KdgREcc

2 mutant than in theEcc71 wild-type strain carrying a chromosomal copy of kdgREcc(Fig. 4A). (ii) The results (Fig. 4B) also reveal a .75% reduc-tion in the level of rsmB RNA in strain Ecc71 carryingpAKC1024 compared to the level in strain Ecc71 carrying thecloning vector. Thus, multiple copies of kdgREcc in strain Ecc71reduce the level of rsmB RNA.

To rigorously establish the role of KdgR-binding sites onrsmB transcription, we examined the expression of lacZ oper-on fusions. Two such fusions were used: pAKC1018 contains488 bp of rsmB DNA and includes all three KdgR-bindingsites (see below), as well as the promoter-regulator region;pAKC1002, on the other hand, contains 221 bp of rsmBDNA, which includes the promoter-regulator region but notthe KdgR-binding sites. These plasmids were transferred intoE. coli DH5a carrying pAKC1035, wherein kdgREcc expressionis controlled by the tac promoter (see Table 1). Bacteria weregrown in LB containing Km, Tc, and IPTG (50 mM), and cul-ture samples were assayed for b-galactosidase activity. Thedata in Table 4 show that b-galactosidase levels were abouttwofold higher with the rsmB-lacZ construct lacking the KdgR-binding sites than with the construct containing the three KdgR-binding sites.

Purification of the KdgREcc-6His recombinant protein. Tocharacterize KdgREcc, we purified KdgREcc-6His recombinantprotein overproduced in E. coli. For this, we amplified thecoding region of kdgREcc by PCR and cloned it into the T7promoter expression vector, pET-28b(1), to produce plasmidpAKC1029. After IPTG induction, a protein of approximately29 kDa was overproduced by JM109(DE3) carrying pAKC1029(Fig. 5, lane 2), but not by JM109(DE3) carrying pET-28b(1)(Fig. 5, lane 1). The apparent molecular mass of 29 kDamatches well with the mass of 29,676 Da of the polypeptidededuced from the kdgREcc sequence, further indicating thatthis overproduced protein is encoded by kdgREcc. The one-steppurification protocol produced recombinant KdgREcc-6Hisprotein of about 95% purity, as judged by the SDS-PAGEanalysis (Fig. 5, lane 3).

Identification of KdgREcc-binding site. Gel mobility shiftassays were carried out to determine interaction of purifiedKdgREcc-6His protein with several DNA segments that containpotential KdgR-binding sites. Purified KdgREcc-6His proteinand labeled rsmB, peh-1, and pel-1 fragments were incubated inthe binding buffer and electrophoresed in 5% (wt/vol) poly-acrylamide gels. Figure 6 shows that the KdgREcc-6His proteinbinds DNA segments of rsmB, peh-1, and pel-1, in each caseproducing a single retarded band. The extent of band shift wasproportional to the concentration of KdgREcc (Fig. 6C), indi-cating that KdgREcc binding was specific. This was also sup-ported by the competition experiment, wherein the excess ofcold rsmB DNA abolished the retarded band (Fig. 6C).

DNase I protection experiments were performed to pre-cisely localize the binding sites of KdgREcc on the rsmB DNA.The upper strand and the lower strand of the rsmB fragment

FIG. 4. Effect of kdgREcc on the transcription of rsmB in E. carotovora subsp.carotovora. Bacteria were grown in minimal salts medium plus sucrose or in thismedium supplemented with Tc at 28°C to an A600 of 1.0. Total RNAs wereisolated and used for Northern blot analysis. Lanes: A1, Ecc71 (KdgREcc

1); A2,AC5073 (KdgREcc

2); B1, AC5073 carrying pLAFR5 (cloning vector); B2,AC5073 carrying pAKC1024 (KdgREcc

1). Each lane contained 5 mg of totalRNA.

FIG. 5. Overexpression and purification of KdgREcc-6His. Crude extractsand fractionated KdgREcc-6His were analyzed by SDS-PAGE in a 12% (wt/vol)polyacrylamide gel. Lanes: 1, lysate of JM109(DE3) carrying the cloningvector, pET28b(1); 2, lysate of JM109(DE3) carrying pAKC1029; and 3, pu-rified KdgREcc-6His protein. Lanes 1 and 2 contained 10 mg of protein, whereaslane 3 contained 2 mg of protein.

FIG. 6. Gel mobility shift assays for binding of KdgREcc-6His to the pel-1(A), peh-1 (B), and rsmB (C) DNAs. 32P-labeled rsmB (1 ng), pel-1 (2 ng), orpeh-1 (2 ng) DNA was used. Lanes A1, B1, and C1, no protein was added; lanesA2 and B2, reaction mixtures contained 300 ng of KdgREcc-6His; lanes C2, C3,C4, and C5, reactions were carried out with 300, 400, 500, or 600 ng of purifiedKdgREcc-6His protein, respectively; lane C6, reaction was performed with 300 ngof KdgREcc-6His in the presence of 200 ng of excess of cold rsmB DNA.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

were specifically labeled with [g-32P]ATP and then incubatedin the presence of increasing amounts of purified KdgREcc-6His. These DNA-protein complexes were subjected to partialDNase I digestion, and the resulting products were separatedon 8% (wt/vol) polyacrylamide sequencing gels and visualizedby autoradiography. Three 25-bp protected regions were de-tected within the nucleotides 179 and 1103, 1115 and 1139,and 1207 and 1231 (Fig. 7A), relative to the rsmB transcrip-tional start site (28).

The nucleotide sequence alignment of the three protectedregions of rsmB revealed the binding sequence of 59-GGAAGAAA[N6]TTTCAGGAA/TG/AA-39 (Fig. 7B). This sequenceis highly similar to the known consensus sequence of KdgREch-binding site (Fig. 7B). The putative KdgREcc-binding sites are

also present within the 59 regions of pel-1 and peh-1 transcrip-tion units (Fig. 7B), and this observation explains our findingsthat KdgREcc binds pel-1 and peh-1 DNA fragments in vitro(Fig. 6A and B) and represses transcriptional fusions in vivo(Table 4).

DISCUSSION

In this report we have established that KdgREcc functions asa global regulator in that it controls not only pectinases such asPel and Peh, but also Cel, Prt, and HarpinEcc production. Ourfindings suggest that this is brought about by affecting theexpression of at least some of the structural genes as well asrsmB, an RNA regulator that in turn controls exoenzymes andHarpinEcc. To our knowledge, these data provide the firstexperimental evidence for this dual role of KdgREcc (depictedin Fig. 8). Whether this also is true for the other KdgR species,such as those from E. chrysanthemi and E. coli, remains to bedetermined, although it is reasonable to predict, based upongenetic homology, that they have similar functions as well.That KdgREcc is a repressor is clearly demonstrated by thederepressed phenotypes of the KdgREcc

2 mutant and the neg-ative trans-dominant effect of multiple copies of the kdgREcc

1

DNA. The effects on transcripts (Fig. 3C and D), when con-sidered along with the binding of purified KdgREcc to theputative operator DNAs within the 59 regions of pel-1 andpeh-1 transcription units, indicate that KdgREcc interferes withthe initiation of transcription, as previously reported for someof the E. chrysanthemi pel and pectate catabolic genes (37, 39).

KdgREcc binds to three KDGR boxes located within thetranscriptional unit of rsmB, 79 bases downstream of the tran-scriptional initiation site. In fact, KdgREcc binding sequencesare not present within the promoter region of rsmB. While thedetails of rsmB transcription are not yet known, it would ap-pear, based upon the characteristics of the promoter DNA andthe expression of rsmB-lacZ fusions, that sigma-70 RNA poly-merase holoenzyme can by itself activate the rsmB promoter(28). Thus, KdgREcc binding to rsmB DNA, starting at sites 79bases downstream of the promoter, may not interfere with theinitiation of transcription but instead may affect the elongationof transcription. Precedence exists for this sort of regulation inboth eukaryotic and prokaryotic systems (55), wherein DNAbinding proteins exert their effects by binding the DNA tem-plates. For example, the purine repressor, PurR, was shown toregulate the transcription elongation of the E. coli purB operonby a roadblock mechanism (18). The binding of PurR to thepurB operator, 242 bp downstream of the transcriptional startsite, blocked the polymerase during elongation. The effect onelongation was independent of the purB promoter and also didnot require cotranslation (18). Since rsmB encodes a RNAregulator and not a protein product (28), cotranslation iscertainly not required in the regulation of transcription byKdgREcc. Therefore, it is possible that in rsmB the KdgREccbinds the three operators downstream of transcription startsite and halts the movement of RNA polymerase by a road-block mechanism similar to that in E. coli. Our observationsalso raise the possibility that conformational change of rsmBtemplate DNA is triggered by KdgREcc binding and that thisalteration is responsible for the inhibition of transcriptionelongation. Although rsmB DNA contains three KdgREcc-binding sites, in gel shift assays only one retarded band ap-peared in a concentration-dependent manner (Fig. 6C). Sinceno intermediate complexes were detected in these assays, weassume that a highly ordered and cooperative binding occursbetween KdgREcc protein and rsmB DNA. It is conceivablethat after three KdgREcc dimers bind rsmB double-stranded

FIG. 7. (A) DNase I protection analysis of the rsmB DNA fragment byKdgREcc. 59 and 39 refer to the 32P-end-labeled portion of rsmB DNA. In the 50ml of binding reaction mixture, an 11.7 nM concentration of the sense strandprobe (59) or a 5.0 nM concentration of the antisense strand probe (39) wasincubated with 0 (lane 1) or with 0.16, 0.32, 0.64, 0.96, and 1.28 mM purifiedKdgREcc-6His protein (lanes 2 to 6, respectively). The G1A chemical sequenceof the same labeled DNA fragments is shown in the leftmost lanes. Bracketsindicate nucleotide positions relative to the transcriptional start site, which wereprotected from DNase I digestion by KdgREcc-6His. (B) Nucleotide sequencealignment of the protected regions of rsmB and putative KdgREcc-binding sitesof pel-1 and peh-1.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

DNA, polymerization of KdgREcc proteins could produce alooped or bent conformation of the rsmB DNA, giving rise toa template nonpermissive for transcription elongation. Addi-tional detailed analysis of interactions between KdgREcc andvariously modified rsmB DNA should clarify the physical andbiological consequences of the occurrence of multiple bindingsites within the transcriptional unit.

The rationale for regulating gene expression by interferingwith elongation of transcription but not of initiation, if thatindeed is the case, is hard to appreciate unless we consider thepossibility that this allows the bacterium to very rapidly adjustthe levels of rsmB RNA upon the relief of repression. Accord-ing to this hypothesis, once the level of active KdgREcc drops,transcripts already initiated will immediately elongate, allow-ing rapid production of rsmB RNA. Such a rapid responsewould certainly be an advantage, even a requirement, if rsmBwere to perform a vital function. Indeed, several lines of indi-rect evidence point to such a role of rsmB. For example, rsmBRNA neutralizes the negative effects of the RNA-binding pro-tein RsmA, which promotes message decay (28). In the ab-sence of rsmB RNA, RsmA may induce a nonspecific decay oftranscripts which could have an extremely detrimental effect oncell physiology and cell viability. Our inability to obtain stablersmB null mutants (33) also points to an important role of thisRNA.

The negative regulation of Cel, Prt, and HarpinEcc by KdgRhas not been reported previously and merits comment. We donot yet know if there are binding sites for KdgREcc within thepromoter region of the structural gene for Prt. We are, how-ever, certain that KdgREcc binding sites are not present within475 bp upstream of the translational start site of hrpNEcc (32);this DNA region includes a 75-bp untranslated sequence and a

400-bp sequence upstream of the transcriptional start site.Thus, it is highly unlikely that the KdgREcc effect on hrpNEcctranscripts (Fig. 3D) is due to the binding of KdgREcc to op-erator DNA, thereby preventing promoter activation by RNApolymerase holoenzyme. Not eliminated is the rare possibil-ity that KdgREcc binds hrpNEcc DNA far upstream of the tran-scriptional start site, binding that may somehow negativelyinterfere with promoter activation and initiation of transcrip-tion. A more plausible hypothesis is that the KdgREcc effect onhrpNEcc expression is directed via its effect on expression ofrsmB or another regulator of hrpNEcc. We have shown herethat the KdgREcc

2 mutant produces higher levels of rsmB andhrpNEcc transcripts compared to the KdgREcc

1 parent (Fig. 3Cand Fig. 4A). Previous studies (28) have established that over-expression of rsmB is invariably accompanied by overexpres-sion of hrpNEcc, as well as the genes for several exoenzymes. Itis therefore likely that in the absence of KdgREcc a higher levelof rsmB expression results in the activation of hrpNEcc tran-scription (Fig. 8). Since KdgREcc binding sites are not foundwithin the 490-bp sequence upstream of the translational startsite of celV, we suggest that at least part of the KdgREcc effecton Cel is due to the regulation of rsmB by KdgREcc. Productionof Prt may also be similarly affected by KdgREcc. In light of theglobal regulatory role of OHL in E. carotovora subsp. caroto-vora (5, 24, 44), we tested the possibility that KdgREcc re-presses OHL production and that this, in turn, affects exoen-zyme and HarpinEcc levels. However, our comparative studieswith KdgREcc

1 and KdgREcc2 strains did not support this

hypothesis. Studies have been initiated to identify anotherglobal regulator that is affected by KdgREcc and to determinewhether this presumed KdgREcc-mediated repression, in con-junction with the negative effect on rsmB transcription, actu-

FIG. 8. A speculative model depicting the regulatory effects of KdgREcc on the production of exoenzymes and HarpinEcc. The proposed scheme postulates KdgREccto function via two different pathways: by directly repressing the transcription of the exoenzyme genes, i.e., pel and peh, and by affecting the transcription of rsmB, aglobal RNA regulator, which controls pel, peh, cel, prt, and hrpNEcc expression (28). While we have documented the inhibition of pel and peh transcription by kdgREcc,we do not have similar evidence for a direct effect of kdgREcc on the transcription of hrpNEcc, cel, or prt genes. However, the data presented here show that rsmBtranscription is affected by a roadblock mechanism. We propose that as the level of active KdgREcc drops, rsmB transcription is stimulated, producing RNA which bindsRsmA. Since RsmA promotes transcript decay, the decrease in the free RsmA pool could contribute to mRNA stability. The formation of RsmA-rsmB RNA complexalso facilitates rsmB RNA processing. The processed rsmB RNA (rsmB9) then activates Pel, Peh, Cel, Prt, and HarpinEcc production, although the mechanism by whichthis is brought about is not yet fully understood.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ally accounts for the inhibition of hrpNEcc, cel, and prt expres-sion.

ACKNOWLEDGMENTS

Our work was supported by the National Science Foundation (grantMCB-9728505) and the Food for the 21st Century program of theUniversity of Missouri.

We thank Alan Collmer for the anti-HarpinEch antibodies and J. D.Wall for reviewing the manuscript.

REFERENCES

1. Aiba, H., S. Adhya, and B. de Crombrugghe. 1981. Evidence for two func-tional gal promoters in intact Escherichia coli cells. J. Biol. Chem. 256:11905–11910.

2. Alfano, J. R., and A. Collmer. 1996. Bacterial pathogens in plants: life upagainst the wall. Plant Cell 8:1683–1698.

3. Barras, F., F. van Gijsegem, and A. K. Chatterjee. 1994. Extracellular en-zymes and pathogenesis of soft-rot Erwinia. Annu. Rev. Phytopathol. 32:201–234.

4. Bauer, D. W., Z.-M. Wei, S. V. Beer, and A. Collmer. 1995. Erwinia chrysan-themi harpinEch: an elicitor of the hypersensitive response that contributes tosoft-rot pathogenesis. Mol. Plant-Microbe Interact. 8:484–491.

5. Chatterjee, A., Y. Cui, Y. Liu, C. K. Dumenyo, and A. K. Chatterjee. 1995.Inactivation of rsmA leads to overproduction of extracellular pectinases,cellulases, and proteases in Erwinia carotovora subsp. carotovora in the ab-sence of the starvation/cell density sensing signal, N-(3-oxohexanoyl)-L-ho-moserine lactone. Appl. Environ. Microbiol. 61:1959–1967.

6. Chatterjee, A., Y. Liu, and Arun K. Chatterjee. 1995. Nucleotide sequence ofa pectate lyase structural gene, pel1 of Erwinia carotovora subsp. carotovorastrain 71 and structural relationship of pel1 with other pel genes of Erwiniaspecies. Mol. Plant-Microbe Interact. 8:92–95.

7. Chatterjee, A. K., G. E. Buchanan, M. K. Behrens, and M. P. Starr. 1979.Synthesis and excretion of polygalacturonic acid trans-eliminase in Erwinia,Yersinia, and Klebsiella species. Can. J. Microbiol. 25:94–102.

8. Chatterjee, A. K., J. L. McEvoy, H. Murata, and A. Collmer. 1991. Regula-tion of the production of pectinases and other extracellular enzymes in thesoft-rotting Erwinia spp., p. 45–58. In S. S. Patil, S. Ouchi, D. Mills, and C.Vance (ed.), Molecular strategies of pathogens and host plants. Springer-Verlag, New York, N.Y.

9. Chatterjee, A. K., L. M. Ross, J. L. McEvoy, and K. K. Thurn. 1985.pULB113, an RP4::mini-Mu plasmid, mediates chromosomal mobilizationand R-prime formation in Erwinia amylovora, Erwinia chrysanthemi, andsubspecies of Erwinia carotovora. Appl. Environ. Microbiol. 50:1–9.

10. Collmer, A., and N. T. Keen. 1986. The role of pectic enzymes in plantpathogenesis. Annu. Rev. Phytopathol. 24:383–409.

11. Cooper, C. J. C., and G. P. C. Salmond. 1993. Molecular analysis of themajor cellulase (CelV) of Erwinia carotovora: evidence for an evolutionary“mix-and-match” of enzyme domains. Mol. Gen. Genet. 241:341–350.

12. Cui, Y., A. Chatterjee, Y. Liu, C. K. Dumenyo, and A. K. Chatterjee. 1995.Identification of a global repressor gene, rsmA, of Erwinia carotovora subsp.carotovora that controls extracellular enzymes, N-(3-oxohexanoyl)-L-homo-serine lactone, and pathogenicity in soft-rotting Erwinia spp. J. Bacteriol.177:5108–5115.

13. Cui, Y., L. Madi, A. Mukherjee, C. K. Dumenyo, and A. K. Chatterjee. 1996.The RsmA2 mutants of Erwinia carotovora subsp. carotovora strain Ecc71overexpress hrpNEcc and elicit a hypersensitive reaction-like response intobacco leaves. Mol. Plant-Microbe Interact. 9:565–573.

14. Eriksson, R. B., A. R. Andersson, M. Pirhonen, and E. T. Palva. 1998.Two-component regulators involved in the global control of virulence inErwinia carotovora subsp. carotovora. Mol. Plant-Microbe Interact. 11:743–752.

15. Figurski, D. H., and D. R. Helinski. 1979. Replication of an origin-containingderivative of a plasmid RK2 depend on a plasmid function provided in trans.Proc. Natl. Acad. Sci. USA 76:1648–1652.

16. Frederick, R. D., J. Chiu, J. L. Bennetzen, and A. K. Handa. 1997. Identi-fication of a pathogenicity locus, rpfA, in Erwinia carotovora subsp. caroto-vora that encodes a two-component sensor-regulator protein. Mol. Plant-Microbe Interact. 10:407–415.

17. Harris, S. J., Y.-L. Shih, S. D. Bentley, and G. P. C. Salmond. 1998. The hexAgene of Erwinia carotovora encodes a LysR homologue and regulates motilityand the expression of multiple virulence determinants. Mol. Microbiol. 28:705–717.

18. He, B., and H. Zalkin. 1992. Repression of Escherichia coli purB is by atranscriptional roadblock mechanism. J. Bacteriol. 174:7121–7127.

19. Hinton, J. C. D., and G. P. C. Salmond. 1987. Use of TnphoA to enrich forextracellular enzyme mutants of Erwinia carotovora subsp. carotovora. Mol.Microbiol. 1:381–386.

20. Hinton, J. C. D., J. M. Sidebotham, D. R. Gill, and G. P. C. Salmond. 1989.Extracellular and periplasmic isoenzymes of pectate lyase from Erwinia ca-

rotovora subspecies carotovora belong to different gene families. Mol. Mi-crobiol. 3:1785–1795.

21. Hugouvieux-Cotte-Pattat, N., G. Condemine, W. Nasser, and S. Reverchon.1996. Regulation of pectinolysis in Erwinia chrysanthemi. Annu. Rev. Micro-biol. 50:213–257.

22. Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improvedbroad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene70:191–197.

23. Kleiner, D., W. Paul, and M. J. Merrick. 1988. Construction of multicopyexpression vectors for regulated overproduction of proteins in Klebsiellapneumoniae and other enteric bacteria. J. Gen. Microbiol. 134:1779–1784.

24. Jones, S., B. Yu, N. J. Bainton, M. Birdsall, B. W. Bycroft, S. R. Chhabra,A. J. R. Cox, P. Golby, P. J. Reeves, S. Stephens, M. K. Winson, G. P. C.Salmond, G. S. A. B. Stewart, and P. Williams. 1993. The lux autoinducerregulates the production of exoenzyme virulence determinants in Erwiniacarotovora and Pseudomonas aeruginosa. EMBO J. 12:2477–2482.

25. Liu, M. Y., G. Gui, B. Wei, J. F. Preston III, L. Oakford, U. Yuksel, D. P.Giedroc, and T. Romeo. 1997. The RNA molecule CsrB binds to the globalregulatory protein CsrA and antagonizes its activity in Escherichia coli.J. Biol. Chem. 272:17502–17510.

26. Liu, Y., A. Chatterjee, and A. K. Chatterjee. 1994. Nucleotide sequence,organization and expression of rdgA and rdgB genes that regulate pectin lyaseproduction in the plant pathogenic bacterium Erwinia carotovora subsp.carotovora in response to DNA damaging agents. Mol. Microbiol. 14:999–1010.

27. Liu, Y., A. Chatterjee, and A. K. Chatterjee. 1994. Nucleotide sequence andexpression of a novel pectate lyase gene (pel-3) and a closely linked endopo-lygalacturonase gene (peh-1) of Erwinia carotovora subsp. carotovora 71.Appl. Environ. Microbiol. 60:2545–2552.

28. Liu, Y., Y. Cui, A. Mukherjee, and A. K. Chatterjee. 1998. Characterizationof a novel RNA regulator of Erwinia carotovora subsp. carotovora that con-trols production of extracellular enzymes and secondary metabolites. Mol.Microbiol. 29:219–234.

29. Liu, Y., Y. Cui, A. Mukherjee, and A. K. Chatterjee. 1997. Activation of theErwinia carotovora subsp. carotovora pectin lyase structural gene pnlA: a rolefor RdgB. Microbiology 143:705–712.

30. Liu, Y., X. Wang, A. Mukherjee, and A. K. Chatterjee. 1996. RecA relievesnegative autoregulation of rdgA, which specifies a component of the RecA-Rdg regulatory circuit controlling pectin lyase production in Erwinia caroto-vora subsp. carotovora. Mol. Microbiol. 22:909–918.

31. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

32. Mukherjee, A., Y. Cui, Y. Liu, and A. K. Chatterjee. 1997. Molecular char-acterization and expression of the Erwinia carotovora hrpNEcc gene, whichencodes an elicitor of the hypersensitive reaction. Mol. Plant-Microbe In-teract. 10:462–471.

33. Mukherjee, A., Y. Cui, Y. Liu, and A. K. Chatterjee. Unpublished data.34. Mukherjee, A., Y. Cui, W. Ma, Y. Liu, A. Ishihama, A. Eisenstark, and A. K.

Chatterjee. 1998. RpoS (sigma-S) controls the expression of rsmA, a globalregulator of secondary metabolites, Hairpin, and extracellular proteins inErwinia carotovora. J. Bacteriol. 180:3629–3634.

35. Murata, H., A. Chatterjee, Y. Liu, and A. K. Chatterjee. 1994. Regulation ofthe production of extracellular pectinase, cellulase, and protease in the softrot bacterium Erwinia carotovora subsp. carotovora: evidence that aepH ofErwinia carotovora subsp. carotovora 71 activates gene expression in Erwiniacarotovora subsp. carotovora, E. carotovora subsp. atroseptica, and Escherichiacoli. Appl. Environ. Microbiol. 60:3150–3159.

36. Murata, H., J. L. McEvoy, A. Chatterjee, A. Collmer, and A. K. Chatterjee.1991. Molecular cloning of an aepA gene that activates production of extra-cellular pectolytic, cellulolytic, and proteolytic enzymes in Erwinia carotovorasubsp. carotovora. Mol. Plant-Microbe Interact. 4:239–246.

37. Nasser, W., J. Robert-Baudouy, and S. Reverchon. 1997. Antagonistic effectof CRP and KdgR in the transcription control of the Erwinia chrysanthemipectinolysis genes. Mol. Microbiol. 26:1071–1082.

38. Nasser, W., S. Reverchon, G. Condemine, and J. Robert-Baudouy. 1994.Specific interactions of Erwinia chrysanthemi KdgR repressor with differentoperators of genes involved in pectinolysis. J. Mol. Biol. 236:427–440.

39. Nasser, W., S. Reverchon, and J. Robert-Baudouy. 1992. Purification andfunctional characterization of the KdgR protein, a major repressor of pecti-nolysis genes of Erwinia chrysanthemi. Mol. Microbiol. 6:257–265.

40. Negre, D., J. C. Cortay, I. A. Old, A. Galinier, C. Richaud, I. Saint-Girons,and A. J. Cozzone. 1991. Overproduction and characterization of the iclRgene product of Escherichia coli K12 and comparison with that of Salmonellatyphimurium LT2. Gene 97:29–37.

41. Pan, B., I. Unnikrishnan, and D. C. Laporte. 1996. The binding site of theIclR repressor protein overlaps the promoter of aceBAK. J. Bacteriol. 178:3982–3984.

42. Perombelon, M. C. M., and A. Kelman. 1980. Ecology of the soft rot Erwin-ias. Annu. Rev. Phytopathol. 18:361–387.

43. Pirhonen, M., H. Saarilahti, M.-B. Karlsson, and E. T. Palva. 1991. Identi-fication of pathogenicity determinants of Erwinia carotovora subsp. caroto-vora by transposon mutagenesis. Mol. Plant-Microbe Interact. 4:276–283.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

44. Pirhonen, M., D. Flego, R. Heikinheimo, and E. T. Palva. 1993. A smalldiffusible signal molecule is responsible for the global control of virulenceand exoenzyme production in the plant pathogen Erwinia carotovora. EMBOJ. 12:2467–2476.

45. Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with aselectable DNA fragment. Gene 29:303–313.

46. Reverchon, S., Y. Huang, C. Bourson, and J. Robert-Baudouy. 1989. Nucle-otide sequences of the Erwinia chrysanthemi ogl and pelE genes, negativelyregulated by the kdgR gene product. Gene 85:125–134.

47. Reverchon, S., W. Nasser, and J. Robert-Baudouy. 1991. Characterization ofkdgR, a gene of Erwinia chrysanthemi that regulates pectin degradation. Mol.Microbiol. 5:2203–2216.

48. Romeo, T. M. 1998. Global regulation by a small RNA-binding protein CsrAand the noncoding RNA molecule CsrB. Mol. Microbiol. 29:1321–1330.

49. Romeo, T., M. Gong, M. Y. Liu, and A. M. Brun-Zinkernagel. 1993. Identi-fication and molecular characterization of csrA, a pleiotropic gene fromEscherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size,and surface properties. J. Bacteriol. 175:4744–4755.

50. Shih, Y. L., S. Harris, S. Bentley, and G. P. C. Salmond. 1998. Coordinateregulation of exoenzymes and motility in Erwinia carotovora, abstr. 1.8.52. In7th International Congress of Plant Pathology, Edinburgh, Scotland.

51. Smith, C. P., and K. F. Chater. 1988. Structure and regulation of controlling

sequences for the Streptomyces coelicolor glycerol operon. J. Mol. Biol. 204:569–580.

52. Spaink, H. P., R. J. H. Okker, C. A. Wijffelman, E. Pees, and B. J. J.Lugtenberg. 1987. Promoters in the nodulation region of the Rhizobiumleguminosarum Sym plasmid pRL1JI. Plant Mol. Biol. 9:27–39.

53. Tabor, S., and C. C. Richardson. 1985. A bacteriophage T7 RNA polymer-ase/promoter system for controlled exclusive expression of specific genes.Proc. Natl. Acad. Sci. USA 82:1074–1078.

54. Thomson, N. R., A. Cox, B. W. Bycroft, G. S. A. B. Stewart, P. Williams, andG. P. C. Salmond. 1997. The Rap and Hor proteins of Erwinia, Serratia andYersinia: a novel subgroup in a growing superfamily of proteins regulatingdiverse physiological processes in bacterial pathogens. Mol. Microbiol. 26:531–544.

55. Uptain, S. M., C. M. Kane, and M. J. Chamberlin. 1997. Basic mechanismsof transcript elongation and its regulation. Annu. Rev. Biochem. 66:117–172.

56. Wharam, S. D., V. Mulholland, and G. P. C. Salmond. 1995. Conservedvirulence factor regulation and secretion systems in bacterial pathogens ofplants and animals. Eur. J. Plant Pathol. 101:1–13.

57. Zink, R. T., R. J. Kemble, and A. K. Chatterjee. 1984. Transposon Tn5mutagenesis in Erwinia carotovora subsp. carotovora and E. carotovora subsp.atroseptica. J. Bacteriol. 157:809–814.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

kdgrecc negatively regulates genes for pectinases, cellulase, … · hypersensitive reaction. we...

Documents