key: green = guanine yellow = cytosine blue = adenine ... · a black sugar 3 t black sugar 4 g...

Key: Green = Guanine Yellow = Cytosine Blue = Adenine Orange = Thymine

Duplication of any part of this document is permitted for classroom use only. This document, or any part, may not be reproduced or distributed for any other purpose without the written consent of the Discovering DNA Ltd. Copyright © 2013 Discovering DNA Ltd, all rights reserved.

Discovering DNA

Molymod® miniDNA®

Genetic Jigsawtm

Instructions and teachers guide

Cat no MDNA-JIG-372

We’d love to hear any feedback, comments or questions you have!

Please email Discovering DNA on:

Post: Discovering DNA Ltd, PO Box 280 Hertford, SG13 9DG

email: [email protected] tel: 01992 410 140 fax: 01992 410 106



Molymod® miniDNA® Genetic Jigsaw instructions

Contents:

Black sugar 41 Red sugar 41 White sugar 42 Phosphate (Purple) 124

Cytosine (Yellow) 21 Guanine (Green) 21 Adenine (Blue) 41 Thymine (Orange) 41

Introduction

Genetic Jigsaw is designed to show how plasmids are constructed, how restriction enzymes are used to add inserts during genetic engineering and how genes are controlled.

Plasmids occur naturally in bacteria as they use them to share genes that may give a selective advantage (such as toxin genes and antibiotic resistance genes). They are also powerful tools for molecular biology as we shall see.

Genetic engineering was invented in Hawaii! Bacterial transformation is the method for getting plasmids into bacteria. In nature, bacteria share plasmids by a process called conjugation (which is when bacteria form a tube and exchange plasmid DNA through it). The plasmids used in genetic engineering are designed so they cannot be conjugated for safety reasons, so other methods must be used.

Transformation of E. coli with a plasmid was first carried out successfully in 1972 by Stanley Cohen and Leslie Shiu in the USA. Cohen soon realized the potential of transforming bacteria with plasmids that had been genetically engineered. When Cohen was at a scientific conference in Hawaii, Herbert Boyer spoke about sticky ends in DNA created using the restriction enzyme Eco RI and Cohen saw the possibilities. By using restriction enzymes on plasmids they could insert any piece of DNA and make lots of copies of it. They later patented their technology and thus genetic engineering was born in Hawaii!

A moratorium A voluntary moratorium halted the use of the new recombinant gene technology in 1974. This happened as scientists and policy makers realized the power of the new technology of genetic engineering. In 1975 the Asilomar Conference in California resolved these questions and established basic safety rules for GM technology which still underpins genetic research today.

How is transformation carried out? Bacterial transformation is carried out by mixing E. coli with the plasmid and calcium chloride. A brief heat shock is given (e.g. 42°C for 50 seconds) that punches holes in the bacterial cell wall. The calcium ions from the calcium chloride coat the plasmid DNA to neutralize its’ negative charge so the plasmid enters the E. coli cell.

Selection markers Transformation succeeds only rarely, so selection genes have been developed to eliminate bacteria that haven’t taken up the plasmid leaving just those that have been transformed. Usually antibiotic selection genes are used so only bacteria with the plasmid can survive in the presence of an antibiotic such as ampicillin.

Bacteria as insulin factories E. coli grows fast so it is an ideal host for producing lots of protein. For example, when E. coli is transformed with a plasmid containing the human insulin gene, it produces insulin protein that can be purified and used as a medicine to treat diabetes. It is preferable to make protein medicines in bacteria rather than animals because of the risk of cross-species viruses.

Green Fluorescent Protein (GFP) GFP is naturally found in the jellyfish Aequorea victoria and gives them the property of bioluminensence. The GFP protein was first isolated in 1968 by Osamu Shimomura and the gene cloned and sequenced in 1992 by Douglas Prasher. Martin Chalfie then picked up studying GFP and his lab succeeded in expressing the gene in E. coli in 1994 by inserting the GFP gene into a plasmid and transforming E. coli. Amazingly the GFP protein caused bioluminescence in E. coli and they glowed bright green!



The power of GFP is that it is ideal as a “marker gene”. This means it can be expressed in living cells when fused to another protein, so you can use the GFP as a marker to localize where the other protein is being produced in a cell or tissue. It has been used in lots of different ways as a quick Google search for GFP images will reveal!

Chalfie was awarded a share of the Nobel prize in 2008 for his work which he shared with Shimomura and Roger Y. Tsien. Tsien developed the potential of GFP by creating lots of different colours by a PCR based technique called site directed mutagenesis.

Bacterial transformation with GFP is now also widely used in educational kits.

Learning outcomes

This set provides enough materials to carry out the lesson with 6 groups of students or with a whole class. This hands-on activity will help you remember many key points about genetic engineering and bacterial transformation.

By the end of the session, your students will have learnt:

• Importance of complementary base pairing

• Importance of 5’ and 3’ ends of DNA

• How restriction enzymes produce sticky ends

• How gene expression is controlled by promoters

• Antibiotic selection genes • Directional cloning • GFP as a marker gene • The role of the origin of replication • Lac operon and ara operon • Bacterial transformation • Start codon

Time requirements

Preparation - The first time will take about 20 minutes but after this preparation is no more than 5 minutes as you can keep the components assembled in the storage box for future use.

Lesson - 20 minutes is sufficient to carry out the activity with more time to explain the stages and analyse the outcomes as required. Preparation

1 Assemble template bases

You only need to do this once as the bases can be kept for future lessons!

The bases comprise of a sugar (red, black or white), a phosphate (purple) and a base (yellow, green, blue or orange). Please note the different sugar colours are included to make it easier to see the probe and sense and antisense strands of the template they do not represent different chemicals.

Use black sugars for the sense strand and red sugars for the antisense strand of the template.

Attach the purple phosphate to the black or red sugar by pushing the bent knob from the sugar into the hole in the purple phosphate. Make sure you add the sugar to the 5’ prime end as shown so the knob still sticks out of the purple phosphate not out of the sugar.

Push the coloured base (green, orange, blue or yellow) onto the straight knob on the sugar. Assemble these bases with black sugars: Cytosine (Yellow) 4 Guanine (Green) 8 Adenine (Blue) 17 Thymine (Orange) 12

Assemble these bases with red sugars: Cytosine (Yellow) 8 Guanine (Green) 4 Adenine (Blue) 12 Thymine (Orange) 17

Helpfully, C, G, A, and T are embossed on the edge of the base.



2 Assemble insert bases

Use white sugars for the insert bases. Assemble the following bases:

Cytosine (Yellow) 9 Guanine (Green) 9

Adenine (Blue) 12 Thymine (Orange) 12

3 Give out bases as follows to each of the following 6 groups:

Group 1 - Origin of replication A black sugar 5 T red sugar 5

Group 2 - Repressor gene A black sugar 3 T black sugar 2 C black sugar 1 G black sugar 3 A red sugar 2 T red sugar 3 G red sugar 1 C red sugar 3 Group 3 - Promoter A black sugar 3 T black sugar 3 A red sugar 3 T red sugar 3

Group 4 - Multiple cloning site A black sugar 3 T black sugar 3 C black sugar 3 G black sugar 3 A red sugar 3 T red sugar 3 G red sugar 3 C red sugar 3 Group 5 - antibiotic selection gene A black sugar 3 T black sugar 4 G black sugar 2 A red sugar 4 T red sugar 3 C red sugar 2 Group 6 - Insert A white sugar 12 T white sugar 12 C white sugar 9 G white sugar 9

After completion of the lesson

Separate bases (black, red and white sugars) and keep in the storage boxes for use next time.

Preparation for subsequent uses (about 5 minutes)

Sort out the bases (with black and red sugars) by colour (yellow, green, blue or orange)

Then you are ready to go!

5’ prime

5’ prime 3’ prime

3’ prime sugar

sugar

base

base

phosphate

phosphate



Plasmid class activity – teacher’s notes

Lesson tips

Important - ensure students have bases correctly orientated so 5’ and 3’ are opposite each other when bases are paired (shown on page 2) & don’t let your students take the bases apart!

Remember in base pairing the following match:

T pairs with A (orange with blue) C pairs with G (yellow with green)

Lesson plan

• Each group of students constructs one part of the plasmid – ori, repressor, promoter, multiple cloning site, antibiotic resistance gene and insert.

• They bring their parts to front of class and put them together to make the entire plasmid in the correct orientation and order. The insert is not yet added.

• Use restriction enzymes to add the insert into the plasmid in the correct orientation. • Students learn how the inserted gene is switched on

The plasmid map below shows the different elements of the plasmid and how they go together:

A real plasmid is 3000 – 5000 base pairs in length so we have scaled it down for this activity. Lesson part one – assemble the plasmid components

1 Origin of replication

The origin of replication (ori) is the place where the plasmid DNA replication starts. As plasmids are self-replicating molecules, they borrow many of the proteins needed for replication from their bacterial host in a semi-parasitic way. However, as many plasmids offer a selective advantage to their host (eg antibiotic resistance genes) they are not usually considered parasites.

The ori also determines how many plasmid copies there are in each bacterial cell. Low copy number plasmids have 25 – 50 copies per cell whereas high copy number plasmids have 500 or more copies per cell!

The ori varies in size depending on what genes and protein binding regions are present. A typical ori is 589 base pairs in length. A common feature is an A-T rich region where the strands are first separated for DNA replication to begin. As A-T have only two hydrogen bonds less energy is required to separate them than G-C which have three bonds. We will model an A-T rich region of the ori in our Genetic Jigsaw.

Put the bases in the following sequence:

5’- AAAAA – 3’ sense strand black sugars 3’ – TTTTT – 5’ antisense strand red sugars



2 Repressor gene (araC/lacI)

This gene has a built in promoter that constitutively (constantly) produces its protein AraC in the arabinose operon or LacI in the lactose operon. The protein binds to the promoter and stops expression until the “food” lactose or arabinose is present.

When the arabinose or lactose is present, it binds to the repressor protein and causes the protein to change shape (conformation), this clears the way for RNA polymerase to bind to the promoter and switch on the genes that encode enzymes that digest the food. See below in the promoter section for more details on this.

We use the sequence of the araC gene that is 879 base pairs long so we represent this with a region from the start of gene, including the ATG start codon.

Put the following sequence together:

5’ - ATGGCTGAA - 3’ sense strand black sugars 3’ - TACCGACTT - 5’ antisense strand red sugars

When we add this sequence to the plasmid we will put it in with the red strand at the top as it is expressed in the opposite direction to the rest of the plasmid.

3 Promoter

The promoter is the genetic switch that turns on (or expresses) the genes upstream from it. Many promoters have been characterized but the first to be understood was the lac operon promoter.

An operon is a group of bacterial genes that are switched in together by the same promoter. The lac operon is found in E. coli and controls the expression of genes that break down the disaccharide lactose. An intricate method of control has evolved whereby the food source acts as the switch to turn on the digestive enzymes. In this way, E. coli only produces digestive enzymes when the food source is present.

In the lac operon, a repressor protein LacI is continually produced by the gene lacI. LacI protein binds to the lac promoter (at a region called the lac operator) and stops it from being switched on by RNA polymerase. If lactose is present, it binds to LacI causing a conformation change that allows RNA polymerase to bind to the promoter and turn on the operon. A Nobel Prize was awarded in 1965 to Jacques Monod, Francis Jacob and Andre Lwoff who worked it out.

A similar promoter has been found for arabinose operon (with a few differences) with a repressor protein called AraC. AraC protein binds the arabinose promoter (which is called pBAD) and stops expression of the arabinose operon. A conformation change also occurs to the AraC protein when bound to arabinose so these operons are controlled in a similar way. In our plasmid, we use a consensus sequence that is similar to the sequence found in many bacterial promoters where RNA Polymerase binds.



The pBAD promoter is 166 base pairs long so we have represented this with the following sequence that should be made:

5’-TATAAT-3’ sense strand black sugars 3’-ATATTA-5’ antisense strand red sugars

4 Multiple cloning site (MCS)

The multiple cloning site (MCS, also called a polylinker) is a region in the plasmid where there are a series of unique restriction enzyme recognition sites. These are included so you can easily cut and add a DNA insert. By combining different enzymes, you can add an insert to the plasmid in a particular orientation relative to the promoter so the gene is expressed correctly.

Our MCS has two enzymes, EcoRI and NheI which both have 6 base pair palindromic sites that leave sticky ends. A typical MCS would be 60 or more base pairs with 5 to 10 enzyme sites.

NheI recognition site

5’ - G CTAGC - 3’ 3’ - CGATC G - 5’

EcoRI recognition site

5’ - G AATTC - 3' 3’ - CTTAA G - 5'

Sticky ends are useful for rejoining fragments of DNA as they have an overhang that will connect with another fragment of DNA with the same overhang. Put the following sequence together to make the MCS:

5’ - GCTAGCGAATTC - 3’ sense strand black sugars 3’ - CGATCGCTTAAG - 5’ antisense strand red sugars

5 Antibiotic selection gene

When carrying out genetic engineering it is important to be able to identify which bacteria have the plasmid in them. For this purpose an antibiotic selection gene is used. When present the beta-lactamase gene enables E. coli to survive in the presence of the antibiotic ampicillin. If no plasmid is present, the bacteria cannot survive so only the transformed bacteria grow.



The beta-lactamase gene is 861 base pairs long and is preceded by a promoter that is 92 base pairs long. We represent this with a region from the start of gene, including the ATG start codon. Assemble the following sequence for beta-lactamase:

5’ – ATGAGTATT - 3’ sense strand black sugars 3’ – TACTCATAA – 5’ antisense strand red sugars

6 Green fluorescent protein/insulin insert

The insert is the piece of DNA you wish to include in the plasmid. In our example it can either be the gene for human insulin or the green fluorescent protein (GFP) gene.

GFP insert - GFP is used a marker gene as it glows bright green even when in living cells! The GFP gene is 720 base pairs long so we have chosen to represent it with the sequence for the 9 base pair chromophore region of the protein – the part that causes the glow.

Insulin insert – If human insulin gene is in the plasmid and expressed in bacteria, the cells becomes factories producing insulin protein for treating diabetes. The complete human insulin gene is 2764 base pairs long so we have a smaller representation of this.

Using bases with white sugars for both strands, assemble the insert in 3 parts as follows:

NheI site GFP chromophore EcoRi site

5’ - GCTAGC - 3’ TCTTATGGT GAATTC sense strand white sugars 3’ - CGATCG - 5’ AGAATACCA CTTAAG antisense strand white sugars

When you join the parts together it will look like this:

Lesson part two – make the plasmid (minus the insert)

1 Take all the assembled parts (ori, repressor, promoter, multiple cloning site and antibiotic resistance gene) and line up in the correct order and orientation.

ori repressor promoter MCS AmpR



2 Put the parts together in the correct orientation (5’ to 3’ direction) and order.

3 Next join the whole plasmid into a circular plasmid…

Lesson part three - Let’s genetically engineer our plasmid!

1 Split the circular plasmid at the ori and lie it flat on a table as shown:

2 Identify the MCS by looking for EcoRI & NehI sites (see MCS section above for photo):

NheI restriction site 5’ - G CTAGC - 3’ 3’ - CGATC G - 5’

EcoRI restriction site 5’ - G AATTC - 3' 3’ - CTTAA G - 5'

3 Align the insert with the plasmid at the MCS.

4 Digest insert and plasmid with EcoRI:



5 Next digest insert and plasmid with NheI:

6 Line them up where the sticky ends match and place the insert in the plasmid:

Note it can only go in one way round – directional insertion – because two different restriction enzymes were used to cut the insert and the MCS and they produce different sticky ends.

7 Join the insert and plasmid together. DNA ligase does this in the lab.

This puts the insert in the plasmid in the correct 5’ – 3’ orientation. Thus, the GFP or insulin gene would be correctly switched on by the promoter when ara or lac is present. Well done!

8 Rejoin the plasmid into a loop and the plasmid is ready to be transformed!

Lesson part four - How is the inserted gene switched on?

1 Note the position of the promoter relative to the insert. It is “upstream” of the insert so the insert is under the control of the promoter.

2 The promoter turns on the gene when the food source is present because it is blocked by the repressor protein when food is absent. Thus, the default state is off.

The repressor gene makes the repressor protein. As it is produced at a low level all the time so it is orientated the other way to the MCS so it does not turn on any inserted gene all of the time.

3 If a student places a hand over the promoter region this shows how the repressor protein binds to block RNA polymerase binding at the promoter.

4 When food is present, it binds to the repressor protein and causes it to change shape, so it can’t bind to the promoter so it is turned on. Rather like a hand being over a light switch.

5 Another student cups their hand over the first students hand and then pulls them off the promoter. This is what happens then the food binds to the repressor protein.

This then allows RNA polymerase to bind to the promoter and switch on the gene producing mRNA.



Genetic jigsaw class activity – student’s notes

Important - ensure you have bases correctly orientated so 5’ and 3’ are opposite each other when bases are paired & don’t take the bases apart!

Remember in base pairing the following match:

T pairs with A (orange with blue) C pairs with G (yellow with green)

The plasmid map below shows the parts of the plasmid and how they go together:

Plasmids are 3000 – 5000 base pairs in length so we have scaled it down. Each student group makes one part of the plasmid.

Lesson part one – make the plasmid components

1 Assemble the origin of replication

Origin of replication (ori) is the place where plasmid DNA replication starts. Ori also determines how many plasmid copies there are in each cell. Put the bases in the following sequence:

5’- AAAAA - 3’ sense strand black sugars 3’ - TTTTT - 5’ antisense strand red sugars

2 Assemble the repressor gene (araC/lacI)

The repressor protein binds to the promoter and stops expression until the “food” lactose or arabinose is present Put the following sequence together:

5’ - ATGGCTGAA - 3’ sense strand black sugars 3’ - TACCGACTT - 5’ antisense strand red sugars

3 Assemble the promoter region

The promoter is the genetic switch that turns on (or expresses) the genes upstream from it. Put the following sequence together:

5’- TATAAT - 3’ sense strand black sugars 3’- ATATTA - 5’ antisense strand red sugars

4 Assemble the multiple cloning site (MCS)

Multiple cloning site (MCS) is a region in the plasmid where there are a series of unique restriction enzyme recognition sites. We have two enzymes in our MCS, EcoRI and NheI.

NheI recognition site is a 6 base pair palindromic site that leaves sticky ends:

5’ - G CTAGC - 3’ 3’ - CGATC G - 5’

EcoRI recognition site is a 6 base pair palindromic site that leaves sticky ends:



5’ - G AATTC - 3' 3’ - CTTAA G - 5'

Put the following sequence together to make the MCS:

5’ - GCTAGCGAATTC - 3’ sense strand black sugars 3’ - CGATCGCTTAAG - 5’ antisense strand red sugars

5 Assemble the antibiotic selection marker gene

When carrying out genetic engineering it is important to be able to identify which bacteria have the plasmid in them. For this purpose an antibiotic selection gene is used. Assemble the following sequence for the ampicillin resistance gene (beta-lactamase):

5’ - ATGAGTATT - 3’ sense strand black sugars 3’ - TACTCATAA - 5’ antisense strand red sugars

6 Assemble green fluorescent protein/insulin insert

The insert is the piece of DNA you wish to include in the plasmid. Using bases with white sugars for both strands, assemble the insert as follows:

5’ - GCTAGCTCTTATGGTGAATTC - 3’ sense strand white sugars 3’ - CGATCGAGAATACCACTTAAG - 5’ antisense strand white sugars

Lesson part two – make the plasmid (minus the insert)

1 Take all the assembled parts and line up in the correct order and orientation. 2 Join the parts together making sure of the correct 5’ – 3’ orientation. 3 Next join the whole plasmid into a circular plasmid.

Lesson part three - Let’s genetically engineer our plasmid!

1 Split the circular plasmid at the ori and lie it on flat a table. 2 Identify the MCS is in the plasmid by looking for the EcoRI and NehI recognition sites:

NheI restriction site 5’ - G CTAGC - 3’ 3’ - CGATC G - 5’

EcoRI restriction site 5’ - G AATTC - 3' 3’ - CTTAA G - 5'

3 Align the insert with the plasmid at the MCS. 4 Digest insert and plasmid with EcoRI. 5 Next digest insert and plasmid with NheI. 6 Line them up where the sticky ends match and place the insert in the plasmid. 7 Join the insert and plasmid together. 8 Rejoin the plasmid into a loop.

Lesson part four - How is the inserted gene switched on?

1 Note the position of the promoter relative to the insert. It is “upstream” of the insert so the insert is under the control of the promoter.

2 The promoter only turns on the gene when the food source is present, as it is blocked by the repressor protein when food is absent. Thus, the default state is off.

3 A student places a hand over the promoter region this shows how the repressor protein stops RNA polymerase binding at the promoter.

4 A second student cups their hand over the first student’s hand and pulls it off the promoter. This is what happens then the food binds to the repressor protein.

Observation questions

1 Why do bacteria have plasmids naturally? 2 What does each part of the plasmid do? 3 Why are some parts of the plasmid switched on all of the time and others not? 4 Why is it important to be able to include the insert in a particular 5’ – 3’ orientation? 5 What is the purpose of using two different restriction enzymes?

key: green = guanine yellow = cytosine blue = adenine ... · a black sugar 3 t black sugar 4 g...

Documents