killer vegetables, animal-human hybrids, other scary stuff. chapter 1: epistasis for beginners kevin...

14
killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

Upload: jeffry-walton

Post on 03-Jan-2016

215 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

killer vegetables, animal-human hybrids, other scary stuff.

Chapter 1: Epistasis for beginners

KEVIN HIOM

Galway 2010

Basic principles of DT40

Page 2: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

DT40: A genetically tractable eukaryotic cell line

DT40

• Genetically tractable• Good model for genome stability in mammals• Complementation by human genes• Good database

versus humans

Page 3: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

Genetically tractable DT40

All these require manipulation of the genome

Phenotypic analysis

Knocking out or mutating genes and looking at cellular function

Mapping genetic pathways

Combining mutations- epistasis

Structure/function analysis/ cell biology

Complementation, proteomics

Genetic regulation

Reporter assays

Page 4: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

Integrate DNA

Target DNA

Alter DNA

Remove DNA

*

*

Page 5: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

Random Integration- non homologous end joining

Targeted Integration- Homologous/Homeologous recombination

Site specific recombination

Genetic Recombination is our tool

Page 6: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

Non Homologous End Joining-Random integration

Advantages

SimpleRelatively high frequency

Potential uncharacterised genetic effectMultiple integrationShut down of expression

Disadvantages

Ku, DNA-PKcs, LigIV,

Page 7: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

Homologous recombination- site specific integration, gene disruption, mutation

DNA End ResectionMre11/RAD50/NBS1, CtIP, Exo1

Strand InvasionRAD51

ResolutionSlx1/4, GEN1

Branch MigrationRAD51BCDHolliday Junctions

Page 8: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

Homologous recombination

Page 9: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

Homologous Recombination

Advantages

Acurate/error free Introduction of multiple changes

Disdvantages

Easy to introduce errorsAberrant recombinationNeighbouring sequencesEpistasis difficult for HR genes

Page 10: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

Site specific recombination- cre/lox

ATAACTTCGTATAGCATACATTATACGAAGTTAT

LOXP

Page 11: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

Site specific recombination- re-using antibiotic resistance

Cre recombinase

drugr

synapsis

excision

Page 12: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

Site specific recombination

Courtesy of the National Library of Medicine (NLM)

Page 13: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

Understanding recombination is the key to manipulating the DT40 genome

Page 14: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40

3 copies of chromosome 2

Genomes are ‘plastic’- Don’t culture for too long

Words of warning