Copyright � 2009 by the Genetics Society of AmericaDOI: 10.1534/genetics.109.104364

KlAft, the Kluyveromyces lactis Ortholog of Aft1 and Aft2, MediatesActivation of Iron-Responsive Transcription Through the

PuCACCC Aft-Type Sequence

Natalia Conde e Silva,* Isabelle R. Goncxalves,†,‡ Marc Lemaire,§,**,††,‡‡ Emmanuel Lesuisse,*Jean Michel Camadro* and Pierre Louis Blaiseau*,§§,1

*Ingenierie des Proteines et Controle Metabolique, Unite Mixte de Recherche 7592, Institut Jacques Monod, Centre National de la RechercheScientifique, Universite Paris Diderot, F-75205 Paris Cedex 13, France, †Universite Pierre et Marie Curie (UPMC Universite) Paris 06,

Atelier de Bioinformatique, F-75005 Paris Cedex 05, France, ‡Genetique et Evolution, Unite Mixte de Recherche 7138 Systematique,Adaptation, Evolution, Centre National de la Recherche Scientifique-UPMC Universite Paris 06-Museum National d’Histoire

Naturelle–Institut de Recherche pour le Developpement, F-75005 Paris Cedex 05, France, §Genetique Moleculaire desLevures, Unite Mixte de Recherche 5240 Microbiologie, Adaptation et Pathogenie, Universite de Lyon, F-69003 Lyon, France,**Universite Lyon 1, F-69003 Lyon, France, ††Centre National de la Recherche Scientifique, F-69622 Villeurbanne, France,

‡‡Institut National des Sciences Appliquees de Lyon, F-69621 Villeurbanne, France and §§UPMC Universite Paris 06,Unite de Formation et de Recherche 927 Sciences De la Vie, F-75005 Paris Cedex 05, France

Manuscript received April 24, 2009Accepted for publication June 22, 2009

ABSTRACT

Iron homeostasis in fungi is regulated at the transcriptional level by two different mechanisms. It ismediated by a conserved GATA-type repressor in most fungi except in the yeast Saccharomyces cerevisiae,where it is controlled by the transcription activators Aft1 and Aft2. These activators are encoded by theparalogous genes AFT1 and AFT2, which result from the whole-genome duplication. Here, we exploreregulation of iron homeostasis in the yeast Kluyveromyces lactis that diverged from S. cerevisiae before thisevent. We identify an ortholog of AFT1/AFT2, designated KlAFT, whose deletion leads to the inability togrow under iron limitation. We show with quantitative real-time PCR analysis that KlAft activates thetranscription of all homologs of the Aft1-target genes involved in the iron transport at the cell surfacein response to iron limitation. However, homologs of Aft2-specific target genes encoding intracellulariron transporters are regulated neither by KlAft nor by iron. Both bioinformatic and DNA bindingand transcription analyses demonstrate that KlAft activates iron-responsive gene expression throughthe PuCACCC Aft-type sequence. Thus, K. lactis is the first documented species with a positive iron-transcriptional control mediated by only one copy of the Aft-type regulator. This indicates that thisfunction was acquired before the whole-genome duplication and was then diversified into two regulatorsin S. cerevisiae.

IRON is an essential nutrient. However, despite itsabundance in the earth’s crust, iron assimilation

poses two significant challenges for most organisms.First, the bioavailability of iron is extremely low in aerobicenvironments because it is mostly present as highlyinsoluble ferric hydroxides. Second, iron accumulationmay be cytotoxic (Halliwell and Gutteridge 1984).Therefore, organisms have developed tightly regulatedsystems for the acquisition and utilization of iron(Hentze etal. 2004). In fungi, two oppositemodes of iron-dependent regulation of transcription have been de-scribed. The first is mediated by a Zn-finger GATA-typefactor that functions by repressing the transcription ofgenes involved in iron assimilation under iron-replete

conditions (Voisard et al. 1993). This negative regula-tory mechanism of iron homeostasis is conserved in mostfungi (Haas et al. 2008). The second iron-regulatorypathway has been characterized only in the yeastSaccharomyces cerevisiae. It ismediatedby twotranscriptionfactors, Aft1 and Aft2, which activate gene expressionunder iron limitation (Yamaguchi-Iwai et al. 1995;Blaiseau et al. 2001; Rutherford et al. 2001).

Aft1 and Aft2 are encoded by the AFT1/AFT2 para-logous genes, which arose from a single ancestralgene after the whole-genome duplication (WGD) event(Wolfe and Shields 1997; Kellis et al. 2004). Aft1 andAft2 have overlapping but not redundant functions(Blaiseau et al. 2001; Rutherford et al. 2001, 2003;Courel et al. 2005). Strains with single deletions foreither AFT1 or AFT2 exhibit clear phenotypic differ-ences: the aft2D strain displays no mutant phenotypewhereas the aft1D strain grows poorly in low-ironconditions. However, consistent with the functionalsimilarity of Aft1 and Aft2, the double aft1Daft2D

Supporting information is available online at http://www.genetics.org/cgi/content/full/genetics.109.104364/DC1.

1Corresponding author: Ingenierie des Proteines et Controle Metabo-lique, UMR 7592, Institut Jacques Monod, CNRS, Universite ParisDiderot, 15 rue Helene Brion, 75205 Paris Cedex 13, France.E-mail: blaiseau.pierre-louis@ijm.univ-paris-diderot.fr

Genetics 183: 93–106 (September 2009)

mutant is more sensitive to iron deprivation than asingle aft1D mutant (Blaiseau et al. 2001; Rutherford

et al. 2001). Aft1 activates the transcription of all thegenes involved in iron acquisition at the cell surface.These include genes that are involved in both the re-ductive and the siderophore-mediated high-affinityiron transport systems, such as FET3, FTR1, ATX1,CCC2, and FRE1-2 and ARN1-4, FIT1-3, and FRE3,respectively (Philpott and Protchenko 2008). Inaddition to genes involved in iron uptake, Aft1 activatesthe transcription of genes involved in metabolic adap-tation to conditions of low iron. Such genes includeCTH1 and CTH2, which encode conserved mRNA-binding protein involved in the post-transcriptionalcontrol of iron homeostasis (Shakoury-Elizeh et al.2004; Puig et al. 2005, 2008), and HMX1, which encodesa yeast heme oxygenase (Protchenko and Philpott

2003; Shakoury-Elizeh et al. 2004). Aft2 controls thetranscription of some of the Aft1 target genes (e.g., FTR1,CTH1, and CTH2) (Courel et al. 2005; Puig et al. 2005,2008) but it also activates the transcription of genes thatare not Aft1 target genes, including SMF3 and MRS4,involved in vacuolar and mitochondrial iron transport,respectively (Rutherford et al. 2003; Courel et al.2005). Promoter sequence examination and in vivo DNAbinding analyses showed that Aft1 and Aft2 recognizesimilar, but distinct, DNA sequences: TGCACCC andPuCACCC, respectively (Courel et al. 2005). Thesevarious observations suggest that Aft1 and Aft2 havebecome specialized during evolution.

S. cerevisiae serves as a paradigm for iron transport andregulation in hemiascomycete yeasts (Kosman 2003).However, the mechanisms underlying the regulation ofthe high-affinity iron uptake systems appear to bestrikingly different between S. cerevisiae and other hemi-ascomycete species such as the human yeast pathogenCandida albicans or the methylotrophic yeast Pichiapastoris. The iron-responsive regulator characterizedin these other yeasts is the GATA-type transcriptionrepressor conserved in most fungi (Lan et al. 2004;Miele et al. 2007). To elucidate the mechanisms reg-ulating iron homeostasis in hemiascomycetes, we in-vestigated iron regulation in Kluyveromyces lactis. K. lactisis Crabtree-negative and displays a respiratory lifestyle,which is more typical of eukaryotic organisms than theS. cerevisiae fermentative lifestyle (Merico et al. 2007). K.lactis is phylogenetically close to S. cerevisiae but a majordifference between K. lactis and S. cerevisiae is that theformer diverged before the WGD and the latter di-verged after this event (Fitzpatrick et al. 2006).Consequently, K. lactis exhibits much less overall generedundancy, facilitating genetic studies of metabolicand regulatory pathways and allowing a better under-standing of their evolution. In this study, we identify theKlAFT gene as the K. lactis ortholog of AFT1/AFT2. Acombination of bioinformatics and experimental anal-yses allowed us to demonstrate that KlAft regulates iron-

regulated genes through an Aft-type DNA-bindingsequence. This indicates that the Aft iron-regulatoryfunction was acquired before the WGD. Moreover, con-sistent with specialization of Aft1 and Aft2 after the WGD,we show that KlAft regulates the homologs of Aft1-targetgenes but not those of genes regulated only by Aft2.

MATERIALS AND METHODS

K. lactis and S. cerevisiae strains: The K. lactis strains used inthis study were PM6-7A (MATa uraA1-1 adeT-600), MW270-7B(MATa uraA1-1 leu2 metA1-1), MLK53 (MATa uraA1-1 adeT-600KlaftTKanMX4), and MLK131 (MATa uraA1-1 adeT-600 lac4TURA3). The MLK53 KlaftD mutant was constructed by one-step gene deletion, integrating kanMX4 at the KlAFT locusin PM6-7A, as described in Wach (1996). The primers usedfor the KlaftDTkanMX4 cassette were P59 KlAFT 59-GATTATTCTCGCTCTCTGTA-39, P59L KlAFT 59-GGGATCCGTCGACCTGCAGCGTACGCATTCAGAAAATAGACAAAATCTC-39, P39L KlAFT 59-AAACGAGCTCGAATTCATCGATGATATGAGATTTTAGCAGTGGAAAAAAGTCT-39, and P39 KlAFT59-CAAAGTCATTCCCGTTCTGT-39. Kanamycin-resistantclones were selected on YPD plates containing 200 mg/ml ofG418. Among 52 G418R transformants, only one (MLK43)displayed a typical aftD mutant phenotype, a growth deficiencyon YPD plates supplemented with 200 mM bathophenantho-line disulfonic acid (BPS). PCR and meiotic analyses con-firmed that the KlAFT gene was disrupted by kanMX4 inMLK43 and that the aftD phenotype was genetically linked toG418 resistance. The MLK131 lac4D mutant was constructed asdescribed in Neil et al. (2007). The S. cerevisiae strains used inthis study were BY4742 (MATa; his3D1; leu2D0; lys2D0;ura3D0), Y14438 (MATa; his3D1; leu2D0; lys2D0; ura3D0;aft1TkanMX4), and SCMC01 (MATa; his3D1; leu2D0; lys2D0;ura3D0; aft1TkanMX4; aft2TkanMX4).

Plasmids construction: Genomic DNA from K. lactis strainMW270-7B was used as a template for PCR to amplify a 4400-bpfragment containing KlAFT with both upstream and down-stream sequences. Genomic DNA from S. cerevisiae strainBY4742 was used as a template for PCR to amplify 3757- and2860-bp fragments containing AFT1 and AFT2 with bothupstream and downstream sequences, respectively. The KlAFT,AFT1, and AFT2 PCR products were first inserted into thevector pCR-2.1-TOPO (Invitrogen, Carlsbad, CA) and thentransferred into the low-copy-number K. lactis vector pCXJ18(Chen 1996), yielding the pCXJ18-KlAFT, pCXJ18-AFT1, andpCXJ18-AFT2 plasmids. The PCR products were also ligatedinto the S. cerevisiae/K. lactis shuttle vector pCXJ22 (Chen

1996), yielding the pCXJ22-KlAFT, pCXJ22-AFT1, and pCXJ22-AFT2 plasmids. The plasmid pCXJ22-KlAFT-13Myc carrying13 tandem copies of the c-myc-encoded Myc epitope at thevery carboxy terminus of the KlAft protein was constructedby in vivo recombination in S. cerevisiae. The Myc epitopetag for KlAFT was amplified from the template pFA6a-13Myc-HIS3MX6 as described previously (Longtine et al.1998). The primers used were 59-CCACAAATGCTTTGGGATGAACCTCACGGCTTTTTTCAACGGATCCCCGGGTTAATTAA-39and 59-GTGTTGTACTAAATGAAAGACTTTTTTCCACTGCTAAAATCGAATTCGAGCTCGTTTAAAC-39. The KLAFT-13Myc PCR product was transformed into a SCMC01 aft1Daft2Dmutant containing pCXJ22-KlAFT. The plasmids contained inHis1 transformants were rescued in Escherichia coli for molec-ular analysis. The plasmid pXW3, a K. lactis URA3 multicopyvector carrying the promoterless lacZ operon (Chen et al. 1992),was used to construct a transcriptional KLLA0E14652g-lacZfusion. The 590-bp fragment of KLLA0E14652g (from �585

94 N. Conde e Silva et al.

to 15 with respect to the start codon) was amplified by PCR andinserted between the BamHI and HindIII sites of pXW3, yieldingpKLLA0E14652g-WT-lacZ. The primers used were 59-CTCAAGCTTGCTTGAATCCTAGTTCATC-39 and 59-TCGAAGCTTTCCATTGATTAATGTTCTAGATCG-39. pKLLA0E14652g-WT-lacZwas used as a PCR template for the QuikChange mutagenesiskit (Stratagene, La Jolla, CA) according to the manufacturer’sinstructions. The primers used were 59-GTTTAAAGTGGGAAGTCTTGATCTGGGAAGTTTTTATCCGTTGTC-39 and itscomplement for M1 substitutions, 59-GAAATCGTCATTTCACAGGGAACTATTTTGCTTTTTTTCTAGTAG-39 and its com-plement for M3 substitutions, and 59-GGAAGATTGGAAAAAAAAAATGACACCCAAGAAATATTTGGTTAC-39 and its com-plement for M4 substitutions. Nucleotides that deviate from theKLLA0E14652g sequence are underlined. All PCR-generatedsequences were confirmed by DNA sequencing. All yeast trans-formations were performed by the lithium acetate method.

Media, growth conditions, and plate assays: Rich YPDmedium contained 1% yeast extract, 2% peptone, and 2%glucose. Minimal YNB medium contained 0.67% yeast nitro-gen base (Difco, Detroit), 0.5% ammonium sulfate, 2%glucose, and the required amino acids and bases. Iron- andcopper-limiting yeast nitrogen base medium (Bio101 minusiron and copper) contained 0.17% yeast nitrogen base withoutiron and copper (Bio101 no. 4027-122), 0.5% ammoniumsulfate, 2% glucose, and the required amino acids and bases.For RNA isolation, the wild-type and KlaftD mutant cells werepregrown at 30� in Bio101 minus iron and copper supple-mented with 1 mm ferric ammonium sulfate. For comparisonof KlAFT and KlaftD, the wild-type and KlaftD mutant cultureswere then grown in Bio101 minus iron and copper. Forcomparison of KlAFT with and without Fe, the wild-typecultures were then grown in Bio101 minus iron and copperwith (1Fe) or without (�Fe) 100 mm ferric ammonium sulfate.All the cultures were grown exponentially to an OD600¼ 1 andtotal RNA was then extracted. For b-galactosidase assays,cultures were grown in Bio101 minus iron and copper with(1Fe) or without (�Fe) 100 mm ferric ammonium sulfate. Forplate assays, cells were pregrown on YPD medium supple-mented with 100 mm ferric ammonium sulfate. Cells weresuspended in water at 2 3 106 cells/ml, plated in serial 10-folddilutions onto YPD agar plates with or without 200 mm BPS,and incubated at 30� for 3–4 days prior to imaging.

RNA isolation and quantitative real-time PCR analysis: Foranalyses of mRNA abundance, total RNA was extracted by thehot phenol method and reverse transcribed using AMVReverse Transcriptase (Roche Applied Science) followingthe manufacturer’s instructions. The amounts of resultingcDNA were evaluated by quantitative real-time PCR with theMx3000P system (Stratagene, La Jolla, CA) and normalized tothe K. lactis KLLA0D05357g gene, a putative ortholog of the S.cerevisiae ACT1 gene. Values reported represent the average oftwo independent experiments, each performed in duplicate.Standard deviations were ,10%. Primers for quantitative real-time PCR (see supporting information, Table S1) weredesigned with the Primer3 program.

b-Galactosidase assay: b-Galactosidase was assayed usingo-nitrophenyl-d-galactopyranoside as described previously(Guarente 1983).

Electrophoretic mobility shift assays: The cell extracts wereprepared as described previously (Kuras et al. 1996) with thefollowing modifications. Strains were grown at 30� in 250 ml ofminimal YNB medium supplemented to meet the auxotrophicrequirements, until the optical density at 600 nm was �1.5.The following procedures were performed at 4� with ice-coldbuffer. Cells were harvested by centrifugation, and the cellpellet was washed with 15 ml of extraction buffer (100 mm Tris,pH 87.5, 1 mm EDTA, 10 mm MgCl2, 10% glycerol, 10 mm

b-mercaptoethanol, and 1 mm PMSF). After centrifugation,the cell pellet was resuspended in 1 ml of extraction buffer andthe cells were disrupted in a ‘‘One Shot’’ Cell Disrupter(Constant Systems LDT, Daventry, UK) at a pressure of 2 kbar.The resulting lysate was cleared by a first centrifugation for30 min at 12,000 3 g and a second for 20 min at 13,000 3 g.Aliquots were stored at �80�. For the mobility shift assays, thebinding reaction mixtures (20 ml) contained 25 mm HEPES,pH 7.6, 60 mm KCI, 7.5% glycerol, 0.1 mm EDTA, 1 mm

dithiothreitol, 5 mm MgCl2. Totals of 20–40 mg of cell extractand 0.5–0.75 mg of poly(dIdC)2 were used. DNA probes wereprepared by PCR amplification. For KLLA0E14652g, theprimers 59-TTCATCATCTAGTAGTGAAG-39 and 59-CTTGCATTAAGATCTAACC-39 were used to produce a DNA fragmentcontaining the �530 ACACCC sequence and the primers 59-AAAGGGCCTTTCGTG-39 and 59-ACTTTAAACTTAATAGTAACC-39 to produce a DNA fragment containing the �288ACACCC sequence. For KLLA0E26400g, the primers 59-AAAGGGCCTTTCGTG-39 and 59-ACTTTAAACTTAATAGTAACC-39were used to produce a fragment containing the�571 ACACCCsequence. Probes were P-end labeled with [g-32P]dATP. Approx-imately 10,000 cpm of probe (1.7 ng) was used in each bind-ing mixture. Samples were incubated for 30 min at roomtemperature. Competition assays were performed by addingdouble-stranded DNA fragments made with unlabeled oligo-nucleotides to the reaction mixtures for another 30 min. To testthe specificity of the complex formation with respect to theACACCC element, competition experiments were performedwith 5, 10, and 15 pmol of oligonucleotides centered on wild-type ACACCC (WT) or mutated ACAGGG (M) sequences.The oligonucleotides 59-AAAAATGACACCCAAGAAAT-39 and59-TCATTTCACACCCAACTATT-39 were used for the �530ACACCC and �288 ACACCC sequences of KLLA0E14652g,respectively, and the oligonucleotide 59-GTAAAAAGAAATCGTCATTTCACACCCAACTATTTTGCTTTTTTTCTAGTAG-39 forthe �571 ACACCC sequence of KLLA0E26400g. To test thespecificity of the complex formation with respect to thenucleotide type at position 11 of the�571 ACACCC sequenceof KLLA0E26400g, competition experiments were performedwith 25 pmol of the oligonucleotide 59-GTAAAAAGAAATCGTCATTTCXCACCCAACTATTTTGCTTTTTTTCTAGTAG-39 withX ¼ A, C, G, or T. Samples were loaded onto a 5% poly-acrylamide gel in 0.253 TBE (22 mm Tris, pH 8.3, 22 mm boricacid, 0.6 mm EDTA) and electrophoresed at 15 V/cm at 7�.Gels were preelectrophoresed for 1 hr at 7.5 V/cm at 7�. Gelswere run for 4 hr, dried, and autoradiographed for 16 hr withan intensifying screen.

Genome and protein sequences, coding sequence annota-tions, detection of orthology, and homology: Data on S.cerevisiae (strain S288C) and Kluyveromyces. lactis (strainCLIB210; release 93) were taken from the SaccharomycesGenome Database (SGD) (www.yeastgenome.org) and theGenolevures Consortium site (Sherman et al. 2009), respec-tively. Protein sequences were downloaded from http://www.genolevures.org for Candida glabrata, Debaryomyces hansenii,Kluyveromyces thermotolerans, Saccharomyces kluyveri, Yarrowia lip-olytica, and Zygosaccharomyces rouxii; from http://wolfe.gen.tcd.ie/ygob/ for Saccharomyces bayanus, Saccharomyces castellii, Kluy-veromyces waltii, and Kluyveromyces. polysporus; from http://www.ebi.ac.uk/integr8 for Ustilago maydis, Neurospora crassa, Schizosac-charomyces pombe, and Ashbya gossypii; from http://www.candida-genome.org for C. albicans; from http://genome.jgi-psf.org for P.stipitis; and from http://www.broad.mit.edu for Aspergillusnidulans.

To find orthologs of Aft1/Aft2 iron-regulated genes in theK. lactis genome, we used the Yeast Gene Order Browser(YGOB) (Byrne and Wolfe 2006), which considers bothsequence similarity and genomic context (synteny). This also

Iron Regulation in K. lactis 95

allowed identification of S. cerevisiae ohnologs, correspondingto paralogous genes that remained as duplicates after thewhole-genome duplication. When no K. lactis ortholog wasassigned to a S. cerevisiae gene in YGOB, we chose, when exist-ing, the reciprocal best hit using BLASTP (Altschul et al.1997). Reciprocal BLASTP searches between all S. cerevisiaeand K. lactis proteins were performed using the scoring matrixBLOSUM62, a lower coverage limit of 50%, and a score cutoffof 50 bits. When orthologous relations were too difficult toinfer, for the siderophore transporter- and metalloreductase-encoding gene families, the K. lactis homologs were selectedusing BLASTP with an arbitrary E-value cutoff of 1e-50. Theother genomes were searched for homologs of Aft-typeactivator encoding genes by similarity with the Pfam (Finn

et al. 2008) transcription factor Aft domain (PF08731), usingthe Conserved Domain Database (Marchler-Bauer et al.2009) and RPS-BLAST, a variant of the Psi-BLAST algorithm(Altschul et al. 1997), with 1e-6 as the E-value cutoff. We alsosearched for iron-responsive Zn-finger GATA-type transcriptionrepressor homologs in the genomes. All known repressors havethree conserved domains that distinguish them from all otherfungal GATA factors: two zinc fingers separated by a conservedintervening cysteine-rich region (Haas 2003). We used pre-vious alignments of each of the three conserved domains (Lan

et al. 2004) to build position-specific scoring matrices (PSSM)with the MEME program (Bailey and Elkan 1994). The PSSMobtained for the 28 amino acid residues of the cysteine-richdomain was the most specific of the repressor family (data notshown) and it was used with the MAST program (Bailey andGribskov 1998) and 1e-6 as the E-value cutoff to identify theproteins with the corresponding motif in proteomes.

Identification and enrichment of regulatory patterns: The23 homologs of the Aft1- and Aft2-regulated S. cerevisiae genesidentified in the K. lactis genome were considered as aregulon, possibly regulated by KlAft. We analyzed the sequencesbetween coordinates �1 and �800, upstream from the startof the coding sequence (CDS) of the 23 K. lactis genes. Weused two different approaches to find elements in this set ofsequences. First, the oligo-analysis (words) pattern discoveryprogram (van Helden et al. 1998), from the regulatorysequence analysis tools (RSAT) website, was used to detectoverrepresented oligonucleotides within our set of sequences.All regions upstream from K. lactis CDS, allowing overlap withupstream CDS, were used as the background model. Thesignificance of overrepresentation of an oligonucleotide wasbased on the observed frequency in the sequences of thebackground model, our sequence set size, and a binomialformula. This program was used for words of between six andeight nucleotides. Second, the MEME program (Bailey andElkan 1994) was used to find highly conserved elements inour set of sequences. This program was used with the anrmodel, allowing zero or multiple occurrences of an elementper sequence. In this program, the statistical significance of anelement is based on its log-likelihood ratio, its width andnumber of occurrences, the background nucleotide frequen-cies, and the size of the training set. Here, the backgroundmodel used was the letter frequencies in the set itself. For eachidentified element, the number of genes in the K. lactisgenome, with at least one occurrence of this element in theupstream sequence of its promoter, was computed usingregular expressions in a Python script.

RESULTS

The K. lactis genome contains an ortholog ofS.cerevisiae AFT1/AFT2: We searched the K. lactis ge-nome for orthologs of genes coding for known tran-

scriptional regulators of iron homeostasis. We wereunable to identify a gene encoding a GATA-type irontranscription repressor in K. lactis by searching for theconserved domain of this repressor family (see materi-

als and methods). However, analysis of the K. lactisgenome with the Yeast Gene Order Browser (Byrne andWolfe 2005) revealed one region on chromosome Dthat contains the KlAFT gene (ORF KLLA0D03256g),an ortholog of AFT1 and AFT2. KlAft, the predictedproduct of KlAFT, is very similar in sequence to Aft1(70% identity) and Aft2 (58% identity) between resi-dues 86 and 325, gaps excluded (Figure 1 and File S1).This homologous region includes the Aft1 and Aft2 N-terminal DNA binding domains and the Cys-Asp-Cyselement that confers iron sensitivity (Yamaguchi-Iwai

et al. 1995; Rutherford et al. 2001). This region con-tains two other conserved Cys residues, which have beensuggested in recent sequence comparison studies toparticipate in a zinc finger domain with two conservedHis residues (Figure 1 and Babu et al. 2006). Interest-ingly, KlAft and Aft1, but not Aft2, have additionalsegments of 72 and 49 aa, respectively, in the regionbetween these two conserved Cys residues. The N-terminal region of KlAft contains also two conservedleucine residues found in a nuclear export signal (NES)-like sequence. These residues have been demonstratedto be critical for the iron-dependent export of Aft1 fromthe nucleus to the cytoplasm (Yamaguchi-Iwai et al.2002). The C-terminal end sequences of KlAft and Aft1contain a glutamine-rich region (57.8% of residues 723–767 in KlAft and 34.1% of residues 617–657 in Aft1 areGln). This glutamine-rich region is not present in Aft2,this protein being shorter (416 amino acids) than Aft1or KlAft (690 and 823 amino acids, respectively). Thehigh degree of identity of KlAft with Aft1/Aft2 in the N-terminal region, notably the conservation of the Cys-Asp-Cys and NES-like motifs, led us to test the possibilitythat KlAft is an iron transcription regulator.

The KlaftD deletion mutant is unable to grow underlow-iron conditions: To determine wether KlAft plays arole in iron homeostasis, we deleted the KlAFT genefrom the PM6-7A K. lactis wild-type strain and com-pared the growth of this mutant to that of the isogenicwild-type strain grown under low-iron conditions.Growth was completely abolished in the KlaftD mutantunder iron-deficient conditions (Figure 2A). Thegrowth of the KlaftD mutant was also compared withthe growth of the S. cerevisiae strains with either a singledeletion of AFT1 or the double deletion of both AFT1and AFT2. The aft1Daft2D strain exhibits a more severemutant phenotype than the aft1D strain under low-ironconditions (Blaiseau et al. 2001; Rutherford et al.2001). The KlaftD mutant phenotype is similar to thatof the aft1Daft2D mutant (Figure 2A). These find-ings showed that KlAft is essential for the growth ofK. lactis under low-iron conditions. Next, we performedcross-complementation experiments. The S. cerevisiae

96 N. Conde e Silva et al.

aft1Daft2D mutant was transformed with plasmids con-taining the KlAFT, the AFT1, or the AFT2 gene (Figure2B, top). While the growth defect of the aft1Daft2D

strain under low-iron conditions was totally reversedwith a plasmid containing AFT1, it was only partiallysuppressed with plasmids containing either KlAFT orAFT2. The same results were obtained with a singleaft1D deleted mutant (data not shown). In contrast withthe results described above in S. cerevisiae, the growthdefect of the K. lactis KlaftD mutant was totally sup-pressed with a plasmid containing AFT1 (Figure 2B,bottom).

KlAft activates the transcription of iron-regulatedgenes: We performed transcription analyses to de-termine whether KlAft functions as a regulator ofgenes involved in iron homeostasis. We identified aset of 23 K. lactis homologs of the S. cerevisiae genesinvolved in iron homeostasis and regulated by Aft1 andAft2 (Rutherford et al. 2003; Shakoury-Elizeh et al.2004; Courel et al. 2005). A putative K. lactis orthologwas assigned to most S. cerevisiae Aft1/Aft2 iron-

regulated genes. For the genes belonging to the iron-siderophore transporter (ARN) or the metalloreductase(FRE) families, we could not identify orthologous genesbut did identify homologous genes (Table 1). For eachof the 23 K. lactis genes selected, we used quantitativereal-time PCR to assay their mRNAs in wild-type and theKlaftD mutant strains, both grown in a low-iron medium.We also compared mRNA levels in the wild-type straingrown in iron-depleted or iron-replete media. ThemRNAs of 15 of the 23 genes analyzed were 2.3- to 70-fold more abundant in the wild-type strain than in theKlaftD mutant; for 12 of these genes the mRNAs were 2-to 27-fold more abundant in iron-depleted than in iron-replete conditions (Figure 3A). As shown in Figure 3B,the transcription profiles obtained for the two compar-isons were strongly correlated. The group of 12 genesactivated under iron-deprivation conditions in a KlAft-dependent manner includes all homologs of the S.cerevisiae genes encoding iron transporters at the plasmamembrane and the ortholog of the post-transcriptioniron regulators CTH1 and CTH2. In contrast, there was

Figure 1.—Sequence comparison of KlAft, Aft1, and Aft2. The amino acid sequences of KlAft, Aft1, and Aft2 were aligned usingthe Clustalw program (Larkin et al. 2007). This alignment was then manually refined with the Seaview program (Galtier et al.1996). The NES-like sequence of Aft1 (Yamaguchi-Iwai et al. 2002) and the homologous regions in Aft2 and KlAft are boxed. Theconserved leucines critical for nuclear export of Aft1 are in boldface type. Conserved cysteine and histidine residues predicted toparticipate in a Zn-finger domain (Babu et al. 2006) are in boldface type. Conserved cysteines involved in the CDC element are inboldface type and this element is boxed. Glutamine-rich regions were detected with the ScanProsite tool (De Castro et al. 2006).

Iron Regulation in K. lactis 97

no difference or little difference (,2-fold change) inmRNA abundance between the wild-type strain and theKlaftD mutant or between iron-depleted and iron-repleteconditions for 8 genes. This group of genes includedall the orthologs of genes involved in the vacuolar ormitochondrial iron transport (SMF3, FET5, FTH1, andMRS4), orthologs of ATX1 and FIT1, and two homologsof the FRE metalloreductase-encoding genes. Theseresults indicated that KlAft activates the transcriptionof homologs of genes specifically involved in cell sur-face iron transport under iron limitation, but notthe transcription of genes encoding intracellular irontransporters.

Sequence analyses were performed to identify poten-tial regulatory sequences between the start codon and

800 bp upstream from the 23 analyzed genes. Twoconsensus sequences, PuCACCC and Pu[TA]GCCAAG,were identified independently by different approachesusing the MEME (Bailey and Elkan 1994) and theRSAT (van Helden et al. 1998) programs. The Pu-CACCC sequence corresponds to the core Aft1/Aft2DNA-binding sequence (Yamaguchi-Iwai et al. 1996;Rutherford et al. 2003; Courel et al. 2005). ThePu[TA]GCCAAG sequence was predicted by the MYBSprogram (Tsai et al. 2007) to be a DNA-binding site forPacC/Rim101, a C2H2 Zn finger transcription factorinvolved in the alkaline pH response in fungi (Penalva

and Arst 2004; Penalva et al. 2008). Of the 23 genesthat were analyzed, 18 contained at least one copy of thePuCACCC sequence and 13 contained at least one copyof the Pu[TA]GCCAAG sequence in either orientation(Table 2 and Table S2). Thus, PuCACCC was present in78% and Pu[TA]GCCAAG was present in 57% of the 59

regions upstream from the analyzed genes; in compar-ison, these sequences are found in 22.5 and 9.8%,respectively, of the 59 regions upstream from all openreading frames in the K. lactis genome. We then exam-ined the PuCACCC and Pu[TA]GCCAAG sequencesin the 59 regions upstream from the 23 analyzed genesand the effect of KlAft on their transcription. Thefrequency of the PuCACCC Aft-type sequence amongthe 15 genes exhibiting higher mRNAs levels (at leasttwofold) in the wild-type than in the KlaftD mutantstrain was 2.5 times higher (P-value ,0.05; chi-squaretest) than that among the 8 other genes. The ACACCCsequence was 1.8 times more frequent than the GCACCCsequence (Table 2). The putative PacC/Rim101 DNA-binding sequence Pu[TA]GCCAAG was 4.8 times morefrequent (P-value ,0.02; chi-square test) among the 15KlAft-regulated genes than among the 8 other genes(Table 2). These results suggest that the PuCACCCand/or Pu[TA]GCCAAG sequences are potential iron-regulatory elements.

The ACACCC sequence is an iron-responsive acti-vating sequence in K.lactis: To test this prediction, weperformed transcription analysis with a fusion of the59-upstream region of KLLA0E14652g with the lacZreporter gene. KLLA0E14652g is a homolog of thesiderophore transporter family of genes. It exhibits thehighest sensitivity to iron, its mRNAs being 27-fold moreabundant in iron-depleted than in iron-replete condi-tions (Figure 3A). There are two ACACCC sequences ofthe Aft type (positions �530 and �288) and two TGCCAAG sequences of the PacC/Rim101 type (positions�252 and �237) within the 800-bp 59 region ofKLLA0E14652g (Table 2 and Table S2). To test if theACACCC and/or TGCCAAG sequences are involved inthe iron-regulated expression of KLLA0E14652g, weconstructed plasmids containing KLLA0E14652–lacZfusions from the wild-type and mutated versions ofthese sequences (Figure 4A). The plasmids were used totransform the MLK131 strain isogenic to PM6-A and

Figure 2.—Growth of the KlaftD, aft1D, and aft1Daft2D mu-tants under low-iron conditions and cross-complementationanalysis. (A) K. lactis and S. cerevisiae wild-type, KlaftD, aft1D,and aft1Daft2D cells were suspended in water and plated ontorich medium YPD agar plates with BPS (200 mm). (B) Theaft1Daft2D cells harboring the S. cerevisiae low-copy numberplasmid pCXJ22 (empty vector) or derived plasmids pCXJ22-AFT1, pCXJ22-KlAFT, and pCXJ22-AFT2 (top) and the KlaftDcells harboring the K. lactis low-copy number plasmid pCXJ18(empty vector) or derived plasmids pCXJ18-KlAFT, pCXJ18-AFT1, or pCXJ18-AFT2 (bottom) were suspended in waterand plated onto rich medium YPD agar plates with BPS(200 mm).

98 N. Conde e Silva et al.

inactivated for the K. lactis LAC4 gene coding forb-galactosidase. b-Galactosidase activity was 30-foldhigher with pWT-lacZ in iron-depleted than in iron-replete conditions, indicating that it retains fully iron-regulated expression (Figure 4B). In pM1-lacZ the twoPacC/Rim101-type TGCCAAG sequences were changedto TGGGAAG sequences; b-galactosidase activity wasstrongly induced from this plasmid in iron-depletedconditions. Interestingly, the mutations introduced con-ferred a slight increase of b-galactosidase activity (1.5-fold) under iron-limitation conditions (Figure 4B).Unlike with pM1-lacZ, no b-galactosidase activity wasdetected with pM2-lacZ in which the two Aft-typeACACCC sequences were changed to the sequenceACAGGG. These results indicate that ACACCC butnot TGCCAAG sequences are required for activationof KLLA0E14652g transcription in our experimentalconditions. To study the role of the �530 ACACCC

and �288 ACACCC sequences, each was individuallychanged to the sequence ACAGGG, yielding the plas-mids pM3-lacZ and pM4-lacZ, respectively (Figure 4A):under iron-limitation conditions pM4-lacZ expressed nob-galactosidase activity whereas expression from pM3-lacZ was only 1.7-fold lower (Figure 4B). These resultsindicate that the �288 ACACCC sequence is requiredfor activation of KLLA0E14652g transcription in iron-depleted conditions. The decreased b-galactosidaseactivity observed with a mutated version of the �530ACACCC sequence suggests that this sequence mayamplify the induction mediated by the �288 ACACCCsequence. The identification of ACACCC as an iron-responsive activating sequence and the conservation ofthe N-terminal DNA-binding domain in KlAft and Aft1/Aft2 strongly suggest that KlAft binds to the PuCACCCsequence found as a consensus in the 59 region up-stream from KlAft and iron-regulated genes.

TABLE 1

Putative K. lactis orthologs or homologs of the S. cerevisiae Aft1/Aft2 iron-regulated genes

S. cerevisiae gene ORF Function K. lactis gene% identity/% similarity

FET3 YMR058W Multicopper oxidase KLLA0F26400gS 66/82FTR1 YER145C High-affinity iron permease KLLA0A03025g 68/85CCC2 YDR270W Copper transport into vesicles KLLA0F07447g 52/71ATX1 YNL259C Copper chaperone KLLA0C02673gS 71/82

FIT1 YDR534C Cell wall proteins KLLA0C04994g 36/56FIT2 YOR382W KLLA0C05016g 57/71FIT3 YOR383C KLLA0A04323g 53/72

FET4 YMR319C Low-affinity iron permease KLLA0E14564g 55/70

CTH1 YDR151C mRNA degradation KLLA0D16610gS 43/59CTH2 YLR136C 49/64

HMX1 YLR205C Heme oxygenase KLLA0D12474gS 61/78FET5 YFL041W Vacuolar multicopper oxidase KLLA0D05489gS 60/77FTH1 YBR207W Vacuolar permease KLLA0F28039g 66/79SMF3a YLR034C Vacuolar iron transporter KLLA0F17391gS 73/85

MRS3 YJL133W Mitochondrial iron transport KLLA0E15532gS 71/85MRS4a YKR052C 71/86

ARN1 YHL040C Siderophore transporters KLLA0A10439g 51–64/71–80ARN2/TAF1 YHL047C KLLA0E14652gARN3/SIT1 YEL065W KLLA0C19272gARN4/ENB1 YOL158C KLLA0C00220g

FRE1 YLR214W Metalloreductases KLLA0F04950g 28–44/51–63FRE2 YKL220C KLLA0E14542gFRE3 YOR381W KLLA0E05852gFRE4 YNR060W KLLA0F00616gFRE5 YOR384W KLLA0C04906gFRE6 YLL051C

The first three columns contain the S. cerevisiae gene names, ORF names, and the associated protein functions according to theS. cerevisiae Genome Database. When possible, for each of the S. cerevisiae genes, a putative ortholog in the K. lactis genome isinferred (see materials and methods and File S1). If the putative ortholog is syntenic with the S. cerevisiae gene, there is a su-perscript s at the end of the K. lactis gene name. For each S. cerevisiae/K. lactis gene pair, the identity and similarity between the twogenes are indicated. They were computed with the high scoring pairs of BLASTP, gaps excluded. Paralog pairs are indicated oneabove the other and underlined.

a Aft2-specific target genes (Courel et al. 2005).

Iron Regulation in K. lactis 99

KlAft binds to the PuCACCC Aft-type sequence: Weperformed electrophoretic mobility shift assays withprobes corresponding to promoter regions of KlAft-regulated genes and extracts from KlaftD cells express-ing the KlAft-13Myc fusion protein, which was shown tobe fully functional (Figure S1). First, we used a probewith the sequence of nucleotides �382 to �251 ofKLLA0E14652g and containing the �288 ACACCCsequence required for its transcription (see above).Mobility shift assays showed a prominent complex ofhigh mobility and a second complex of lower electro-phoretic mobility (Figure 5A). To test the specificity ofthe complex formation, we performed competitionassays with addition of unlabeled oligomers centeredon wild-type ACACCC (WT) or mutated ACAGGG (M)sequences. The high-mobility complex was specificallydisplaced by the addition of excess wild-type but notmutated oligomers. Therefore, the high-mobility com-plex was formed by specific interactions with theACACCC sequence. To determine whether KlAft-13Myc is present in the complexes formed, we per-formed assays with addition of anti-Myc antibodies(Figure 5A). Addition of anti-Myc antibodies overshiftedthe higher mobility complex, in a dose-dependentmanner, but had no effect on the lower-mobility com-plex. This demonstrates that KlAft-13Myc is a compo-nent of the higher-mobility complex formed with the

�288 ACACCC sequence. Next, electrophoretic mobil-ity shift assays were performed with a probe correspond-ing to nucleotides�570 to�429 of KLLA0E14652g andcontaining the �530 ACACCC sequence involved in butnot required for activation of transcription under con-ditions of iron limitation (Figure 4). Mobility shift assaysshowed three mobility complexes with high-intensitysignals (Figure 5B). The highest-mobility complexwas the only complex to be specifically displaced bythe addition of excess wild-type ACACCC oligomers.Addition of anti-Myc antibodies overshifted the higher-mobility complex, indicating that it contained KlAft-13Myc. This shows that KlAft binds to the�530 ACACCCsequence of the KLLA0E14652g promoter. These resultsindicate that KlAft is able to bind to both ACACCCsequences identified in the KLLA0E14652g promoter.

The Aft-type consensus identified in the KlAft-regulatedpromoters is the PuCACCC element including theACACCC and GCACCC sequences (Table 2 and TableS2). This suggests that KlAft–DNA binding activityexhibits a preference for a purine rather than a pyrim-idine nucleotide upstream from the CACCC core se-quence. To test this prediction and to characterize theDNA binding specificity of KlAft, we performed furtherDNA binding experiments with a facilitating promoterregion. We chose the 59 region of KLLA0E26400g, theK. lactis ortholog of the canonical Aft1-regulated FET3

Figure 3.—KlAft- and iron-dependent expression of K. lactis homologs of S. cerevisiae Aft1/Aft2 iron-regulated genes. For theKlAFT/KlaftD comparison, the wild-type and KlaftD mutant cultures were grown in Bio101 minus iron and copper. For the KlAFT(�Fe/1Fe) comparison, wild-type cultures were grown in Bio101 minus iron and copper with (1Fe) or without (�Fe) ferric am-monium sulfate (100 mm). Expression of K. lactis genes was assessed by quantitative real-time PCR. The values shown are theKlAFT/KlaftD and the KlAFT (�Fe/1Fe) ratios calculated as the means of two independent experiments, each performed in du-plicate. Standard deviations were ,10%. (A) The first column contains the corresponding S. cerevisiae homolog gene or familyname and the associated protein function. The second column contains the ORF name for the K. lactis genes analyzed. The groupof genes for which the mRNA is at least twice as abundant in the wild type as in the KlaftD mutant is underlined with a dashed line.(B) �Fe/1Fe in the wild-type strain (y-axis on a logarithmic scale) is plotted against KlAFT/KlaftD (x-axis on a logarithmic scale).The transcription profiles obtained for the two comparisons were correlated with Spearman’s rho coefficient ¼ 0.83 and P-value,0.0001.

100 N. Conde e Silva et al.

gene. KLLA0E26400g is clearly regulated by KlAft andiron (Figure 3A) and contains one single copy of the Aft-type consensus element: the �571 ACACCC sequence(Table 2). First, we demonstrated that KlAft binds to the�571 ACACCC sequence by using a probe correspond-ing to nucleotides �660 to �502 of KLLA0E26400g. Aprominent complex of high mobility was specificallydisplaced by the addition of excess wild-type oligomers(Figure 6A). Moreover, addition of anti-Myc antibodiesresulted in a dose-dependent supershift of the high-mobility complex, indicating the presence of KlAft inthe complex formed with the�571 ACACCC sequence.Then, we performed competition assays with unlabeledoligomers differing by one nucleotide (A, C, G, or T) atposition 11 of the �571 ACACCC sequence. Addition

Figure 4.—Mutational analysis of the KLLA0E14652g pro-moter. (A) pKLLA0E14652g-WT-lacZ contains the upstreamregion of the KLLA0E14652g gene (from �585 to 15 with re-spect to the start codon) inserted into the promoterless lacZoperon of pXW3 (Chen et al. 1992). pKLLA0E14652g-M1-lacZis identical to pKLLA0E14652g-WT-lacZ, except that the dinu-cleotide CC in the TGCCAAG PacC/Rim101-type sequencesat positions �249/�248 and �234/�233 (solid gray boxes)was replaced by the dinucleotide GG (open gray boxes).pKLLA0E14652g-M2-lacZ is identical to pKLLA0E14652g-WT-lacZ, except that the trinucleotide CCC in the ACACCCAft-type sequences at positions �527/�525 and �285/�283(solid black boxes) was replaced by the trinucleotideGGG (open black boxes). pKLLA0E14652g-M3-lacZ andpKLLA0E14652g-M4-lacZ contain only one CCC to GGG sub-stitution in the Aft-type sequences at positions �527/�525and �285/�283, respectively. (B) The MLK131 lac4D mutantharboring pKLLA0E14652g-WT-lacZ, pKLLA0E14652g-M1-lacZ, pKLLA0E14652g-M2-lacZ, pKLLA0E14652g-M3-lacZ,and pKLLA0E14652g-M4-lacZ (WT, M1, M2, M3, and M4, re-spectively) was grown exponentially in iron-depleted (�Fe) oriron-replete (1Fe) medium (see materials and methods).Errors bars represent the standard deviations (,10%) for as-says performed with at least three independent transform-ants.

TABLE 2

Aft- and PacC/Rim101-type elements identified in theupstream sequences of the K. lactis orthologs or homologs

of S. cerevisiae Aft1/Aft2 iron-regulated genes

No. of Aft-type

No. of Rim101-typePu[TA]

GCCAAGK. lactis gene ACACCC GCACCC

KLLA0E14652g (ARN) 2 0 2KLLA0E14542g (FRE) 2 1 2KLLA0E14564g (FET4) 0 0 0KLLA0C19272g (ARN) 1 1 2KLLA0D16610g (CTH) 3 1 2KLLA0A10439g (ARN) 1 1 1KLLA0E05852g (FRE) 1 0 2KLLA0D12474g (HMX1) 2 2 2KLLA0F26400g (FET3) 1 0 1KLLA0C00220g (ARN) 1 1 0KLLA0A04323g (FIT3) 1 0 0KLLA0A03025g (FTR1) 0 2 1KLLA0C05016g (FIT2) 0 1 0KLLA0F00616g (FRE) 3 0 1KLLA0F07447g (CCC2) 0 0 1- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -KLLA0C04994g (FIT1) 0 1 0KLLA0C04906g (FRE) 2 0 0KLLA0F17391g (SMF3) 0 0 1KLLA0D05489g (FET5) 0 1 0KLLA0E15532g (MRS) 0 0 1KLLA0F28039g (FTH1) 0 1 0KLLA0F04950g (FRE) 1 0 0KLLA0C02673g (ATX1) 0 0 0

Two elements were identified using the MEME elementfinder in sequences located between the coordinates �1and �800 upstream from the start of the CDS of the 23 K. lac-tis genes listed in Table 1. The K. lactis genes are sorted asindicated in Figure 3A and the gene name of the putativeS. cerevisiae ortholog or homolog is indicated in parentheses.The group of genes for which the mRNA is at least twice asabundant in the wild type as in the KlaftD mutant is under-lined with a dashed line. The second and third columnscontain the numbers of Aft-type ACACCC and GCACCC se-quences found in the 59-upstream region of each gene. Thefourth column contains the number of Pu[TA]GCCAAGPacC/Rim101-type sequences (Table S2).

Iron Regulation in K. lactis 101

of oligonucleotides with either A or G decreased thecomplex formation more strongly than those witheither C or T (Figure 6B). This demonstrates, in perfectagreement with bioinformatic analysis, that KlAft bindspreferentially to a purine rather than a pyrimidinenucleotide upstream from the core CACCC sequence.

DISCUSSION

In this study, we show that KlAft, the ortholog of Aft1/Aft2, mediates iron homeostasis regulation in K. lactis:(1) deletion of the KlAFT gene abolished the ability ofcells to grow under iron-limitation conditions; and (2)most homologs of Aft1-regulated genes were upregu-lated in iron-depleted conditions and markedly down-regulated in the KlaftD mutant cells.

In addition, complementation experiments indicatedthat the iron-dependent growth deficiency of the KlaftDmutant is totally suppressed by AFT1. Interestingly, thereciprocal complementation experiment showed thatKlAFT is not able to reverse totally the growth deficiencyphenotype of the S. cerevisiae aft1Daft2D mutant. Severalnonexclusive hypotheses may explain this partial com-plementation by KlAFT. This may be due to somedefaults in expression/stability/localization of the KlAftprotein in S. cerevisiae. Alternatively, this may reflectsome differences in the mechanisms of transcriptionalactivation of KlAft and Aft1. Indeed, these mechanismscould have evolved since K. lactis and S. cerevisiae di-verged from their common ancestor.

The genes encoding homologs of the S. cerevisiaereductive and nonreductive high-affinity iron transport-

Figure 6.—DNA bind-ing of KlAft to the �571ACACCC sequence of theKLLA0E26400g promoter(A) and effect of the 11nucleotide of the ACACCCsequence on the formationof the KlAft-DNA complex(B). Gel-shift assays werecarried out with extractsfrom KlaftD (MLK53) cellsexpressing the KlAft-13Mycfusion protein. The radio-labeled probes used to per-form the gel-shift assayscorrespond to the sequen-ces of positions �660 to�502 of KLLA0E26400g.The arrowhead indicatesthe KlAft-containing com-plexes. (A) Competitive as-

says were performed with oligonucleotides centered on the wild-type (competitor WT) ACACCC sequence (lanes 2–4) and mutant(competitor M) ACAGGG sequence (lanes 5–7). Where indicated, 1 and 2 ml of a monoclonal antibody raised against the Mycepitope were added (lanes 8 and 9, respectively). (B) Competition assay with various unlabeled oligonucleotides centered on thewild-type �571 ACACCC. Nucleotides that deviate from the KLLA0E14652g promoter sequence are underlined.

Figure 5.—DNA bind-ing of KlAft to the �288ACACCC (A) and �530ACACCC (B) sequences ofthe KLLA0E14652g pro-moter. Gel-shift assays werecarried out with extractsfrom KlaftD (MLK53) cellsexpressing the KlAft-13Myc fusion protein. Theradiolabeled probes usedto perform the gel-shift as-says correspond to the se-quences of positions �382to �251 and �570 to�429 of KLLA0E14652g(A and B, respectively).The arrowhead indicatesthe KlAft-containing com-

plexes. Competitive assays were performed with excess oligonucleotide centered on the wild-type (competitor WT) ACACCC se-quence (lanes 2–4) and mutant (competitor M) ACAGGG sequence (lanes 5–7). Where indicated, 1 and 2 ml of a monoclonalantibody raised against the Myc epitope were added (lanes 8 and 9, respectively).

102 N. Conde e Silva et al.

ers at the plasma membrane (FET3, FTR1, and ARN1-4)are strongly regulated by both KlAft and iron (by atleast 4.6- and 3.5-fold, respectively). All of them containbetween one and three copies of the PuCACCC Aft-typeelement in their 59-upstream region. Moreover, gel shiftexperiments demonstrate that KlAft binds to the Aft-typeelements in the promoter regions of KLLA0E14652g andKLLA0E26400g that belong to this group of genes. Theseresults indicate that KlAft regulates directly the homologsof high-affinity iron-transporter genes in K. lactis. Incontrast, KLLA0E14564g, the ortholog of the FET4 genethat encodes a low-affinity iron and zinc transporter, isclearly regulated by KlAft (by 13-fold) but weakly so byiron (by 2-fold). Moreover, its promoter does not containany copies of the PuCACCC sequence. These datasuggest that KLLA0E14564g is not a direct target geneof KlAft and that it may be regulated by other transcrip-tion factors associated with the KlAft-mediated pathway.In S. cerevisiae, FET4 is controlled by zinc- and oxygen-responsive regulators in addition to Aft1 (Jensen andCulotta 2002; Waters and Eide 2002). Similarly, in K.lactis, KLLA0E14564g might be under the control ofnumerous environmental regulatory pathways that mightbe disturbed by KlAFT deletion.

Previous computer analyses identified the TGCACCCsequence as a consensus in the promoters of the Aft1-regulated genes (Rutherford et al. 2003; Courel et al.2005). DNA-binding experiments and transcriptionanalyses with promoter variants of FET3 confirmed thatAft1 is specific for the TGCACCC sequence (Yamaguchi-Iwai et al. 1996; Courel et al. 2005). Here in K. lactis, weidentify the more simple PuCACCC sequence as a con-sensus in KlAft-regulated promoters. Only 4 of 28 se-quences identified (14%) conformed entirely to theTGCACCC sequence; the other sequences differ byone or two nucleotides at the 59 end of the TGCACCCsequence (Table S2). Moreover, electrophoretic mobilityshift assays confirm that KlAft does not exhibit preferen-tial DNA binding to the TGCACCC sequence: KlAft isable to bind to the GACACCC and CACACCC sequencesof the KLLA0E14652g promoter and to the TACACCCsequence of KLLA0E26400g promoter. These bioinfor-matic and experimental analyses reveal that homologgenes are controlled by KlAft and Aft1 through similarbut distinct iron-regulatory sequences. Interestingly, Aft2has the same PuCACCC DNA binding sequence as KlAft(Courel et al. 2005). The presence of the PuCACCCsequence in both the K. lactis and the S. cerevisiae lineagessuggests that it corresponds to an ancestral Aft-typeelement. This presumably subsequently evolved towardthe more precise TGCACCC sequence in the case of theAft1-regulatory function.

In addition to the PuCACCC sequence, computeranalysis identified the sequence Pu[TA]GCCAAG as an-other consensus in the promoters of K. lactis iron-regulated genes. This sequence contains the coreDNA binding site GCCAAG of the PacC/Rim101 pH-

responsive transcription factor conserved in fungi(Penalva and Arst 2004; Penalva et al. 2008). PacC/Rim101 has been shown to be required in alkalineenvironments for the activation of genes involved iniron homeostasis (Lamb et al. 2001; Bensen et al. 2004;Eisendle et al. 2004). In A. nidulans and C. albicans,PacC/Rim101 directly activates the alkaline pH-inducedgenes whereas in S. cerevisiae Rim101 acts in an indirectmanner through repression of the transcription re-pressor Nrg1 (Penalva and Arst 2004). Here, in K.lactis, the presence of the GCCAAG sequence in the 59

region of most iron-regulated genes and its absencefrom that of KLLA0F18524g, the K. lactis ortholog ofNRG1 (data not shown), suggests that the ortholog ofRim101 (Bussereau et al. 2006) may directly drive theexpression of most iron-regulated genes. Further inves-tigations are needed to confirm this prediction.

In most fungi, the iron-regulatory pathway is under thecontrol of a conserved Zn-finger GATA-type transcriptionrepressor (Haas et al. 2008). Because it is widespread infungi, this negative mode of iron-dependent regulationof transcription may be an ancestral mechanism of re-gulation. In the yeast K. lactis that diverged before theWGD, we did not find any ortholog of the iron-responsive GATA-binding transcription repressor (seematerials and methods and Figure 7). On thecontrary, we show that, in K. lactis, iron homeostasis isregulated by KlAft, a transcription activator ortholog ofthe S. cerevisiae Aft1/Aft2 iron-responsive activators.This indicates that the Aft-type iron-regulatory functionwas acquired before the WGD event. We identified alsoan ortholog of Aft1/Aft2 in all pre-WGD hemiascomy-cetes analyzed, except in the species Y. lipolytica (Figure7). In contrast, and as described previously (Haas et al.2008), we could not identify any ortholog of Aft1/2 infungi other than hemiascomycetes. Thus, these resultsindicate that a transition from negative to positiveregulation occurred in the hemiascomycete lineagebefore the WGD. To date, only the negative or the posi-tive regulatory mechanism, but not both, has beenidentified in any one species, raising the question ofthe existence of species with both regulatory systems.Interestingly, the C. albicans genome contains an ortho-log of AFT1/AFT2 in addition to the SFU1 gene encod-ing the iron repressor (Haas 2003; Lan et al. 2004). Wealso identified an ortholog of AFT1/AFT2 in D. hanseniiand P. stipitis species belonging to the same clade as C.albicans (Figure 7). Characterization of one of these AFT1/AFT2 orthologous genes as an iron-responsive transcrip-tion activator would be valuable to improve our un-derstanding of the iron-regulatory mechanisms in fungi.

S. cerevisiae, a yeast that underwent whole-genomeduplication, has two well-studied Aft-type iron-responsivetranscriptional activator genes: AFT1 and AFT2. Theycorrespond to a duplicated gene pair that was createdby the WGD. All post-WGD yeasts analyzed also have twomembers of the Aft family, except K. polysporus, the most

Iron Regulation in K. lactis 103

divergent from S. cerevisiae (Figure 7). We showed in aprevious study that Aft1 and Aft2 display functionalspecialization in the control of iron homeostasis in S.cerevisiae. Aft1 specifically activates the transcription ofgenes involved in cell-surface uptake systems, whereasAft2 but not Aft1 directly activates the transcription ofgenes involved in vacuolar and mitochondrial irontransport, such as SMF3 and MRS4 (Courel et al.2005). The results of transcription analysis reportedherein indicate that KlAft activates the transcription ofmost homologs of the Aft1-target genes but not those ofspecifically Aft2-target genes encoding intracellular iron

transporters. Additionally, SMF3 and MRS4 orthologsdid not have the PuCACCC sequence in their promoterregions. These results suggest that KlAft and Aft1 keptthe ancestral function of the Aft-type regulator family,which was the regulation of genes specifically involvedin cell surface iron transport. Thus, and in line with thetheory proposed by Ohno (1970), it is tempting tospeculate that the WGD event, by creating two copies ofthe AFT1/AFT2 genes, favored the emergence of a newiron-regulatory function in the Aft-type regulator family.This new function, encoded by AFT2, appears to bespecialized in the iron-dependent transcriptional con-

Figure 7.—Evolution ofiron-responsive transcrip-tion regulators in ascomy-cota. The species tree ofascomycota with the basi-diomycota Ustilago maydisas the outgroup was adap-ted from Fitzpatrick

et al. (2006) and Souciet

et al. (2009). The S. castelliilocation in the tree (out-group to the clade con-taining C. glabrata andS.cerevisiae) is supported byshared rearrangement data(Gordon et al. 2009). Thewhole-genome duplicationis indicated with a black oval.Thenumbersinthetablecor-respond to the number ofhomologs of iron-responsivetranscription regulator-encoding genes per ge-nome. TheAft-type proteinswere identified by similaritywith the Pfam transcriptionfactor Aft domain (PF08731)and the GATA-type proteinswere identified with thecysteine-rich domain ofthe Zn-finger GATA-typerepressors (see materials

and methods and File S2and File S3).

104 N. Conde e Silva et al.

trol of genes involved in vacuolar and mitochondrialtransport.

We thank Eduardo Rocha, Ingrid Lafontaine, Guillaume Achaz,Pierre Netter, and Micheline Wesolowski-Louvel for generous helpand suggestions. This work was supported by a grant from theGroupement des Entreprises Francxaises dans la Lutte contre le Cancer.

LITERATURE CITED

Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang

et al., 1997 Gapped BLASTand PSI-BLAST: a new generation ofprotein database search programs. Nucleic Acids Res. 25: 3389–3402.

Babu, M. M., L. M. Iyer, S. Balaji and L. Aravind, 2006 The nat-ural history of the WRKY-GCM1 zinc fingers and the relationshipbetween transcription factors and transposons. Nucleic AcidsRes. 34: 6505–6520.

Bailey, T. L., and C. Elkan, 1994 Fitting a mixture model by expec-tation maximization to discover motifs in biopolymers. Proc. Int.Conf. Intell. Syst. Mol. Biol. 2: 28–36.

Bailey, T. L., and M. Gribskov, 1998 Combining evidence usingp-values: application to sequence homology searches. Bioinfor-matics 14: 48–54.

Bensen, E. S., S. J. Martin, M. Li, J. Berman and D. A. Davis,2004 Transcriptional profiling in Candida albicans revealsnew adaptive responses to extracellular pH and functions forRim101p. Mol. Microbiol. 54: 1335–1351.

Blaiseau, P. L., E. Lesuisse and J. M. Camadro, 2001 Aft2p, a noveliron-regulated transcription activator that modulates, with Aft1p,intracellular iron use and resistance to oxidative stress in yeast.J. Biol. Chem. 276: 34221–34226.

Bussereau, F., S. Casaregola, J. F. Lafay and M. Bolotin-Fukuhara,2006 The Kluyveromyces lactis repertoire of transcriptional reg-ulators. FEMS Yeast Res. 6: 325–335.

Byrne, K. P., and K. H. Wolfe, 2005 The Yeast Gene Order Browser:combining curated homology and syntenic context reveals genefate in polyploid species. Genome Res. 15: 1456–1461.

Byrne, K. P., and K. H. Wolfe, 2006 Visualizing syntenic relation-ships among the hemiascomycetes with the Yeast Gene OrderBrowser. Nucleic Acids Res. 34: D452–D455.

Chen, X. J., 1996 Low- and high-copy-number shuttle vectors forreplication in the budding yeast Kluyveromyces lactis. Gene172: 131–136.

Chen, X. J., M. Wesolowski-Louvel and H. Fukuhara,1992 Glucose transport in the yeast Kluyveromyces lactis. II.Transcriptional regulation of the glucose transporter geneRAG1. Mol. Gen. Genet. 233: 97–105.

Courel, M., S. Lallet, J. M. Camadro and P. L. Blaiseau,2005 Direct activation of genes involved in intracellular ironuse by the yeast iron-responsive transcription factor Aft2 withoutits paralog Aft1. Mol. Cell. Biol. 25: 6760–6771.

de Castro, E., C. J. Sigrist, A. Gattiker, V. Bulliard, P. S.Langendijk-Genevaux et al., 2006 ScanProsite: detection ofPROSITE signature matches and ProRule-associated functionaland structural residues in proteins. Nucleic Acids Res. 34:W362–W365.

Eisendle, M., H. Oberegger, R. Buttinger, P. Illmer and H. Haas,2004 Biosynthesis and uptake of siderophores is controlled bythe PacC-mediated ambient-pH regulatory system in Aspergillusnidulans. Eukaryot. Cell 3: 561–563.

Finn, R. D., J. Tate, J. Mistry, P. C. Coggill, S. J. Sammut et al.,2008 The Pfam protein families database. Nucleic Acids Res.36: D281–D288.

Fitzpatrick, D. A., M. E. Logue, J. E. Stajich and G. Butler,2006 A fungal phylogeny based on 42 complete genomes de-rived from supertree and combined gene analysis. BMC Evol.Biol. 6: 99.

Galtier, N., M. Gouy and C. Gautier, 1996 SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecularphylogeny. Comput. Appl. Biosci. 12: 543–548.

Gordon, J. L., K. P. Byrne and K. H. Wolfe, 2009 Additions, losses,and rearrangements on the evolutionary route from a recon-

structed ancestor to the modern Saccharomyces cerevisiae ge-nome. PLoS Genet. 5: e1000485.

Guarente, L., 1983 Yeast promoters and lacZ fusions designed tostudy expression of cloned genes in yeast. Methods Enzymol.101: 181–191.

Haas, H., 2003 Molecular genetics of fungal siderophore biosynthe-sis and uptake: the role of siderophores in iron uptake and stor-age. Appl. Microbiol. Biotechnol. 62: 316–330.

Haas, H., M. Eisendle and B. G. Turgeon, 2008 Siderophores infungal physiology and virulence. Annu. Rev. Phytopathol. 46:149–187.

Halliwell, B., and J. M. Gutteridge, 1984 Oxygen toxicity, oxy-gen radicals, transition metals and disease. Biochem. J. 219: 1–14.

Hentze, M. W., M. U. Muckenthaler and N. C. Andrews,2004 Balancing acts: molecular control of mammalian iron me-tabolism. Cell 117: 285–297.

Jensen, L. T., and V. C. Culotta, 2002 Regulation of Saccharomy-ces cerevisiae FET4 by oxygen and iron. J. Mol. Biol. 318: 251–260.

Kellis, M., B. W. Birren and E. S. Lander, 2004 Proof and evolu-tionary analysis of ancient genome duplication in the yeast Sac-charomyces cerevisiae. Nature 428: 617–624.

Kosman, D. J., 2003 Molecular mechanisms of iron uptake in fungi.Mol. Microbiol. 47: 1185–1197.

Kuras, L., H. Cherest, Y. Surdin-Kerjan and D. Thomas, 1996 Aheteromeric complex containing the centromere binding factor1 and two basic leucine zipper factors, Met4 and Met28, mediatesthe transcription activation of yeast sulfur metabolism. EMBO J.15: 2519–2529.

Lamb, T. M., W. Xu, A. Diamond and A. P. Mitchell, 2001 Alkalineresponse genes of Saccharomyces cerevisiae and their relation-ship to the RIM101 pathway. J. Biol. Chem. 276: 1850–1856.

Lan, C. Y., G. Rodarte, L. A. Murillo, T. Jones, R. W. Davis et al.,2004 Regulatory networks affected by iron availability in Can-dida albicans. Mol. Microbiol. 53: 1451–1469.

Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A.McGettigan et al., 2007 Clustal W and Clustal X version 2.0.Bioinformatics 23: 2947–2948.

Longtine, M. S., A. McKenzie, 3rd, D. J. Demarini, N. G. Shah, A.Wach et al., 1998 Additional modules for versatile and econom-ical PCR-based gene deletion and modification in Saccharomycescerevisiae. Yeast 14: 953–961.

Marchler-Bauer, A., J. B. Anderson, F. Chitsaz, M. K. Derbyshire,C. DeWeese-Scott et al., 2009 CDD: specific functional anno-tation with the Conserved Domain Database. Nucleic AcidsRes. 37: D205–D210.

Merico, A., P. Sulo, J. Piskur and C. Compagno, 2007 Fermen-tative lifestyle in yeasts belonging to the Saccharomyces complex.FEBS J. 274: 976–989.

Miele, R., D. Barra and M. C. Bonaccorsi di Patti, 2007 A GATA-type transcription factor regulates expression of the high-affinityiron uptake system in the methylotrophic yeast Pichia pastoris.Arch. Biochem. Biophys. 465: 172–179.

Neil, H., M. Hnatova, M. Wesolowski-Louvel, A. Rycovska andM. Lemaire, 2007 Sck1 activator coordinates glucose transportand glycolysis and is controlled by Rag8 casein kinase I in Kluy-veromyces lactis. Mol. Microbiol. 63: 1537–1548.

Ohno, S., 1970 Evolution by Gene Duplication. Springer-Verlag,Berlin/Heidelberg/New York.

Penalva, M. A., and H. N. Arst, Jr., 2004 Recent advances in thecharacterization of ambient pH regulation of gene expressionin filamentous fungi and yeasts. Annu. Rev. Microbiol. 58:425–451.

Penalva, M. A., J. Tilburn, E. Bignell and H. N. Arst, Jr.,2008 Ambient pH gene regulation in fungi: making connec-tions. Trends Microbiol. 16: 291–300.

Philpott, C. C., and O. Protchenko, 2008 Response to iron dep-rivation in Saccharomyces cerevisiae. Eukaryot. Cell 7: 20–27.

Protchenko, O., and C. C. Philpott, 2003 Regulation of intracel-lular heme levels by HMX1, a homologue of heme oxygenase, inSaccharomyces cerevisiae. J. Biol. Chem. 278: 36582–36587.

Puig, S., E. Askeland and D. J. Thiele, 2005 Coordinated remod-eling of cellular metabolism during iron deficiency through tar-geted mRNA degradation. Cell 120: 99–110.

Iron Regulation in K. lactis 105

Puig, S., S. V. Vergara and D. J. Thiele, 2008 Cooperation of twomRNA-binding proteins drives metabolic adaptation to iron de-ficiency. Cell Metab. 7: 555–564.

Rutherford, J. C., S. Jaron, E. Ray, P. O. Brown and D. R. Winge,2001 A second iron-regulatory system in yeast independent ofAft1p. Proc. Natl. Acad. Sci. USA 98: 14322–14327.

Rutherford, J. C., S. Jaron and D. R. Winge, 2003 Aft1p and Aft2pmediate iron-responsive gene expression in yeast through relatedpromoter elements. J. Biol. Chem. 278: 27636–27643.

Shakoury-Elizeh, M., J. Tiedeman, J. Rashford, T. Ferea, J. Demeter

et al., 2004 Transcriptional remodeling in response to iron dep-rivation in Saccharomyces cerevisiae. Mol. Biol. Cell 15: 1233–1243.

Sherman, D. J., T. Martin, M. Nikolski, C. Cayla, J. L. Souciet

et al., 2009 Genolevures: protein families and synteny amongcomplete hemiascomycetous yeast proteomes and genomes. Nu-cleic Acids Res. 37: D550–D554.

Souciet, J. L., B. Dujon, C. Gaillardin, M. Johnston, P. V. Baret

et al., 2009 Comparative genomics of protoploid Saccharomyce-taceae. Genome Res. (in press).

Tsai, H. K., M. Y. Chou, C. H. Shih, G. T. Huang, T. H. Chang et al.,2007 MYBS: a comprehensive web server for mining transcriptionfactor binding sites in yeast. Nucleic Acids Res. 35: W221–W226.

van Helden, J., B. Andre and J. Collado-Vides, 1998 Extractingregulatory sites from the upstream region of yeast genes by com-putational analysis of oligonucleotide frequencies. J. Mol. Biol.281: 827–842.

Voisard, C., J. Wang, J. L. McEvoy, P. Xu and S. A. Leong,1993 urbs1, a gene regulating siderophore biosynthesis inUstilago maydis, encodes a protein similar to the erythroid tran-scription factor GATA-1. Mol. Cell. Biol. 13: 7091–7100.

Wach, A., 1996 PCR-synthesis of marker cassettes with long flankinghomology regions for gene disruptions in S. cerevisiae. Yeast 12:259–265.

Waters, B. M., and D. J. Eide, 2002 Combinatorial control of yeastFET4 gene expression by iron, zinc, and oxygen. J. Biol. Chem.277: 33749–33757.

Wolfe, K. H., and D. C. Shields, 1997 Molecular evidence for anancient duplication of the entire yeast genome. Nature 387:708–713.

Yamaguchi-Iwai, Y., A. Dancis and R. D. Klausner, 1995 AFT1: amediator of iron regulated transcriptional control in Saccharo-myces cerevisiae. EMBO J. 14: 1231–1239.

Yamaguchi-Iwai, Y., R. Stearman, A. Dancis and R. D. Klausner,1996 Iron-regulated DNA binding by the AFT1 protein controlsthe iron regulon in yeast. EMBO J. 15: 3377–3384.

Yamaguchi-Iwai, Y., R. Ueta, A. Fukunaka and R. Sasaki,2002 Subcellular localization of Aft1 transcription factor re-sponds to iron status in Saccharomyces cerevisiae. J. Biol. Chem.277: 18914–18918.

Communicating editor: L. Pillus

106 N. Conde e Silva et al.

Supporting Information http://www.genetics.org/cgi/content/full/genetics.109.104364/DC1

KlAft, the Kluyveromyces lactis Ortholog of Aft1 and Aft2, Mediates Activation of Iron-Responsive Transcription Through the

PuCACCC Aft-Type Sequence

Natalia Conde e Silva, Isabelle R. Gonçalves, Marc Lemaire, Emmanuel Lesuisse, Jean Michel Camadro and Pierre Louis Blaiseau

Copyright © 2009 by the Genetics Society of America DOI: 10.1534/genetics.109.104364

N. Conde e Silva et al. 2 SI

FILES S1-S3

Files S1-S3 are available for download as text files at http://www.genetics.org/cgi/content/full/genetics.109.104364/DC1.

S1 : Kluyveromyces lactis protein sequences used in the manuscript (text file, fasta)

S2 : Aft-like protein sequences (text file, fasta)

S3 : GATA-type protein sequences (text file, fasta)

N. Conde e Silva et al. 3 SI

TABLE S1

Primer sets used in quantitative real-time PCR

ORF name Upper primer Lower primer

KLLA0F26400g TCCATTCGATCCAGAAGACC CGCAGACTTGCTTGTGGTTA

KLLA0A03025g ATTGGACAACGGTTGGGATA GTTCAGCAGCGGTCAACTCT

KLLA0F07447g TAATGATTCTCCGGCTTTGG TTACGCGCAATATCAAGTGC

KLLA0C02673g CAAATGTCCTGCAGTGGTTG AGTGCCACTGATGACTTCCTT

KLLA0C04994g CCAGTACCATCCCATGCTCT CGCCAGTGTAAGTGGAGACA

KLLA0C05016g ACCCAATCATCACTGCTTCC CAACAACGTTGGTCTTGGTG

KLLA0A04323g ACCAAGACTGTCACCCAAGC AGAGCAGCAGCACCAGTGTA

KLLA0E14564g TTGTTCGAGCCAACTCAGTG TCGCCCCTTCGTGTAGTATC

KLLA0D16610g TGAGCTTTGTGAATCGTTCG CATCGTCACCGTGTTTGAAG

KLLA0D12474g GGGTACGAGCTTGCTACGAG CGATCAATGCAAAAACGATG

KLLA0D05489g CCAAGGGTAATGCTGTTGGT AAGACCGTATTGAGCGATGG

KLLA0F28039g ATATCTCGCGTTCGGTATGG TCCATGTTTCTCTTCGAGCA

KLLA0F17391g TTGGGAGAAAAGGGGGTATC TGGACTTAACGCCTTTCGAT

KLLA0E15532g GATCCATTGCTTGTGTGGTG CCATATGGCTTGAGCAGCTT

KLLA0A10439g TCCTGGTTGCCTTGGTATTC TCTGGACCATTTGTCATGGA

KLLA0E14652g TTTCGAGAATTGGTGGAGGT GTGTGCCCCAAGCATAAACT

KLLA0C19272g TACTGCCGCCTATGGAAGTC CTGAGCCTGGTCATCAGTCA

KLLA0C00220g TTTGGGGTATAGCCAGTTGC GCCGAAGCCAACTCTACATC

KLLA0F04950g ACCAAGGATATCGGCTCTGA GGAAGAAGGGCCACATGATA

KLLA0E14542g ATCTGCTGGCGAAACAGACT GACCGCAACTCAAAATTGCT

KLLA0E05852g GAAAGCACCGTGGATGAAAT TTCCAGAGATATCCGCGACT

KLLA0F00616g ACCCATCTCGTACCTGCAAA TTCCATGGTGAATGCTCAAA

KLLA0C04906g GCACGAAAACTCGGAAGAAG CGAGCCGCATGTCACTACTA

KLLA0D05357g CCATGTTCCCAGGTATTGCT TCAAGTGAACGATGGATGGA

N. Conde e Silva et al. 4 SI

TABLE S2

Aft-and PacC/Rim101-type elements identified in the upstream sequences of the K. lactis orthologs or

homologs of S. cerevisiae Aft1/Aft2 iron-regulated genes

Probability matrix and MEME consensus

Aft-type A

C

G

T

A C A C C C

G

PacC/Rim101-type A

C

G

T

G T G C C A A G

A A K. lactis Gene

KLLA0E14652g (ARN)

KLLA0E14542g (FRE)

KLLA0E14564g (FET4)

KLLA0C19272g (ARN)

KLLA0D16610g (CTH)

KLLA0A10439g (ARN)

KLLA0E05852g (FRE)

KLLA0D12474g (HMX1)

KLLA0F26400g (FET3)

KLLA0C00220g (ARN)

KLLA0A04323g (FIT3)

KLLA0A03025g (FTR1)

KLLA0C05016g (FIT2)

KLLA0F00616g (FRE)

KLLA0F07447g (CCC2)

KLLA0C04994g (FIT1)

KLLA0C04906g (FRE)

KLLA0F17391g (SMF3)

KLLA0D05489g (FET5)

KLLA0E15532g (MRS)

KLLA0F28039g (FTH1)

KLLA0F04950g (FRE)

KLLA0C02673g (ATX1)

D -293 AAATGACACCCAAGAA –278

D -535 ATTTCACACCCAACTA –520

D -261 GAATAACACCCCGAAT –246

D -631 AAATGGCACCCTTTTT –616

D -796 TAGTGACACCCAATTT –781

D -221 ATTTGACACCCATTTT –206

R -499 TCTCGGCACCCCCAAA –514

R -233 GACTGACACCCAGAAA –248

D -279 TAAGAGCACCCAGATT –264

R -484 ATGCGACACCCGGAAA –499

D -596 TACACACACCCAAAAC –581

D -30 AACAAGCACCCTAGCC –15

D -374 CATCGACACCCTTTTT –359

D -641 TCTGCACACCCCCATT –626

D -296 TTGCCACACCCGAAAA –281

R -418 CATACGCACCCAGTTG –433

R -428 CAGTTGCACCCCTGGT –443

R -451 CAGGAACACCCAGGAC –466

D -576 ATTGTACACCCCGAAT –561

D -512 GAATTGCACCCTGTGA –497

R -662 CACCAACACCCGGAAT -677

R -642 TTTCCACACCCAAAAC –657

R -297 TACATGCACCCTTCCC -312

R -253 TTTATGCACCCAAAAC –268

D -659 ATTACGCACCCCATTT -644

R -357 ACTTGACACCCGTATT –372

R -694 ATTCAACACCCTAAAA –709

R -741 AAAACACACCCCGAAA -756

D -204 TGTCTGCACCCAACCA –189

D -518 GTAATACACCCTTCCC –503

D -607 TCTGCACACCCGTAAA –592

R -321 TTTTTGCACCCTCGAA –336

R -152 TTTTTGCACCCCATTC -167

R -131 TATATACACCCAGATG -146

D -242 TTGATCTGCCAAGTTTTT –225

D -257 TTAAAGTGCCAAGTCTTG –240

R -412 CAACAGTGCCAAGCGTTA -429

R -601 CATAAATGCCAAGAAAAA -618

R -186 TTCATGCGCCAAGGCATT –203

R -463 ACCGGGAGCCAAGAAGTC –480

D -721 TGATAATGCCAAGTGCAG -704

R -106 CAAAGGAGCCAAGATAAC –123

R -695 TGGCTGCGCCAAGCATTT -712

R -255 TTATAGTGCCAAGAATGC -272

R -535 CATCTCTGCCAAGAGTTT –552

D -738 TCTAAAAGCCAAGCCTTT -721

R -152 GGAGTGAGCCAAGACATC –169 D -236 TATCGGTGCCAAGGGTCT -219

R -729 TTTCTGAGCCAAGAAACT -746

D -338 CGAAAAAGCCAAGACCTC –321

D -745 GTTTTGTGCCAAGATTCT –728

D -376 TTGAAATGCCAAGAGCTA -359

R -39 GTAACGTGCCAAGAATAA –56

D -648 TATTCGAGCCAAGGCATC –631

0-12-34-56-88-10

N. Conde e Silva et al. 5 SI

The scale indicates the probability of each base occurring at each position in the motif multiplied by 10 and

rounded to the nearest integer. The gene name of the putative S.cerevisiae ortholog or homolog is indicated in

brackets. The sequence of the motif is shown in bold with 5 bp of flanking sequence. Numbering starts from the

putative translation start site (defined as +1). (D): direct. (R): reverse. The group of genes for which the mRNA is

at least twice as abundant in the wild type as in the Klaft∆ mutant is underlined by a dashed line.

N. Conde e Silva et al. 6 SI

FIGURE S1.—KlAFT-13Myc is functional. K. lactis Klaft∆ (MLK53) cells transformed with either of

the high-copy plasmids pCXJ22-KlAFT and pCXJ22-KlAFT-13Myc were suspended in water and plated onto rich medium YPD agar plates with or without BPS (200 µM).