km esvelt et al . nature 000 , 1 - 5 (2011) doi:10.1038/nature09 929

1

KM Esvelt et al. Nature 000, 1-5 (2011) doi:10.1038/nature09929 Linkage of three protein activities to pIII production and phage infectivity using three distinct accessory plasmids.

Upload: lada

Post on 04-Jan-2016

32 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

DESCRIPTION

Linkage of three protein activities to pIII production and phage infectivity using three distinct accessory plasmids. KM Esvelt et al . Nature 000 , 1 - 5 (2011) doi:10.1038/nature09 929. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: KM Esvelt et al . Nature 000 , 1 - 5 (2011) doi:10.1038/nature09 929

KM Esvelt et al. Nature 000, 1-5 (2011) doi:10.1038/nature09929

Linkage of three protein activities to pIII production and phageinfectivity using three distinct accessory plasmids.

SUPPLEMENTARY INFORMATION - media.nature.com · doi: 10.1038/nmat4795 1 1 s 1)

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

doi:10.1038/nature05150 LETTERS

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

doi:10.1038/nature06481 LETTERS

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

DOI: 10.1038/ncomms1280 molecular dynamics of single

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

17 September 2009 doi:10.1038/nature08355 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo46

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

GI Motility online (May 2006) | doi:10.1038/gimo12

1 November 2007 doi:10.1038/nature06221 LETTERS

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

doi:10.1038/nature05202 LETTERS

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

GI Motility online (May 2006) | doi:10.1038/gimo31

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

GI Motility online (May 2006) | doi:10.1038/gimo6

Published in Nature Materials (2016) doi:10.1038/nmat4569

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Biotechnology: doi:10.1038/nbt

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

doi:10.1038/nature12886 Neanderthal from the Altai

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Nature Structural & Molecular Biology: doi:10.1038/nsmb Structural & Molecular Biology: doi:10.1038/nsmb.3120. reduction in the pocket volume, we combine the volumes from the closed