lecture 2 - genetic re combination
TRANSCRIPT
![Page 1: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/1.jpg)
1. General homologous recombination
2. Site-specific recombination
1
![Page 2: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/2.jpg)
2
2 types in bacteria General recombination
• Require long (>50 bp) sequence homology• RecA-dependent
Site-specific recombination• Require very short (<5 bp) sequence homology;• Special site recognition• RecA-independent but require specialized proteins
E.g. transposition
![Page 3: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/3.jpg)
Genetic exchange takes place between 2 pieces of homologous DNA sequences
May be intra- or inter-molecular events
3
![Page 4: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/4.jpg)
4
Heteroduplexformation at the site of crossover
No alteration of nucleotide sequences at the site of exchange
New recombinant DNA molecules are produced
![Page 5: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/5.jpg)
5
Recombination is initiated by a nick in one strandRecA, RecBCD RecA Ligase
Single stranded DNA, coated by RecA, invades homologous duplex
Holliday junction
Resolution & Ligation
Single-strand invasion model (Messelson-Radding model)
![Page 6: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/6.jpg)
6
1. Limited degradation at double-strand break by a 5’3’ exonuclease to create protruding single-stranded 3’ tails
2. Single-stranded DNA are recognized by RecA protein which initiates homology search in the other chromosome
3. ATP-dependent strand exchange occurs followed by DNA synthesis and ligation
4. Branch migration of Holliday junctions
5. Resolution by strand cutting
Double strand break model
![Page 7: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/7.jpg)
7
Involvement of homologous
recombination in repair of ds breaks
![Page 8: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/8.jpg)
8
![Page 9: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/9.jpg)
9
![Page 10: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/10.jpg)
10
binds to single-stranded DNA (produced from nicks, dsbreaks or gaps)
mediates ATP-dependent strand invasion and exchange catalyzes branch migration
352 a.a.
6 RecA monomers per turn
Spooling in
Spooling out
![Page 11: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/11.jpg)
RecA is a long filamentous multisubunit protein complex that coats DNA in vivo
11
![Page 12: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/12.jpg)
12
Rad51 protein in yeast, mice, humans In humans, Rad51 function together with
accessory proteins, e.g. BRCA1 and BRCA2, which are mutated in human breast cancers
Human Rad51 was shown to be involved in the resolution of Holliday junctions [Science (2004) 303:243-246]
![Page 13: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/13.jpg)
13
![Page 14: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/14.jpg)
14
![Page 15: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/15.jpg)
15
helicase
3’5’ & 5’3’ exonucleases
ss DNA is coated by RecA for homologous recombination
![Page 16: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/16.jpg)
16
~1000 chi sites (5'-GCTGGTGG-3’) are present on the E. coli chromosome
Chi sites are “hotspots” for general recombination
![Page 17: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/17.jpg)
17
RuvA22 kD protein which binds to
RuvB and Holliday junctions
RuvB37 kD DNA-dep ATPase
which drives branch migration
RuvC 19 kD nuclease which
resolves Holliday structures (resolvase)
DNA ligase
![Page 18: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/18.jpg)
18
![Page 19: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/19.jpg)
19
RuvC cleaves DNA strands at
the H-J
Ligase seals the nicked strands
RuvA and RuvBrecognize H-J and promotes branch
migration
![Page 20: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/20.jpg)
20
RecA mediated single-strand invasion
Heteroduplex DNA is formed
Gene conversion is non-reciprocal exchange
Only small sections of DNA or part of a gene undergoes gene conversion
![Page 21: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/21.jpg)
21
Mismatched DNA in a heteroduplex are recognized and removed by the DNA repair enzymes and replaced with a copy of the complementary strand
NO GENE CONVERSION
![Page 22: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/22.jpg)
22
Homologous recombination pathways are shared by DNA repair mechanisms
Occurs predominantly in mitotic cells
Occurs predominantly in meiotic cells
Homologous strand exchange initiated by double strand break
5’5’
5’3’
5’3’
3’
3’
5’3’
5’5’
5’
3’3’
3’
![Page 23: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/23.jpg)
23
General or homologous recombination in bacteria is RecA-dependent and requires large regions of homology
Other enzymes involved include RecBCD, RuvA, RuvB, RuvC, DNA ligase
Mechanisms of general recombination can be explained using
• Single-strand invasion model (initiated by a nick)• Double-strand break model (initiated by a ds break)
Branch migration determines the extent of heteroduplex formation
Isomerization and resolution of Holliday structures determine whether “splices” or “patches” are obtained
![Page 24: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/24.jpg)
24
General recombination together with DNA repair can produce gene conversion
Eukaryotes also have RecA homologs which participate in general recombination
![Page 25: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/25.jpg)
25
1. Transpositional site-specific recombination
2. Conservative site-specific recombination
![Page 26: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/26.jpg)
26
![Page 27: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/27.jpg)
27
Class description and structure
Genes in complete element
Mode of movement Examples
DNA-only transposons
Short inverted repeats at each end
Encodes transposase
Moves as DNA, either excising or following a replicative pathway
P element (Drosophila)Ac-Ds (maize)Tn3 and IS1 (E.coli)Tam3 (snapdragon)
Retroviral-like transposons
Directly repeated long terminal repeats (LTRs) at ends
Encodes reverse transcriptase and integrase -resembles retrovirus
Moves as DNA, but via an RNA intermediate produced by promoter in LTR
Copia (Drosophila)Ty1 (yeast)THE-1 (human)Bs1 (maize)
Nonretroviral retrotransposons
Poly A at 3’ end of RNA transcript; 5’ end is often truncated
Encodes reverse transcriptase; transposition is catalyzed by the RNA
Moves via an RNA intermediate that is often produced from a neighboring promoter
F element (Drosophila)L1 (human)Cin4 (maize)
Three Major Classes of Transposable Elements
AAATTT
![Page 28: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/28.jpg)
28
CLASS I: DNA-only transposons (1)
(2)
(3)
Bacteria has 3 classes
(1)
(3)
(2)
Examples:
![Page 29: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/29.jpg)
Bacterial transposons
29
![Page 30: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/30.jpg)
30
1. Non-replicative mechanismSimple, cut-and-paste, no new DNA synthesis
2. Replicative mechanismMore complicated, copy-and-paste, with new DNA synthesis
Catalyzed by specialized recombination enzymes which recognize special DNA sequences (sites)
• Transposase (always)• Resolvase (sometimes)• Transposase inserts into target sites (<20 nt) on chromosome
Transposition is rare (~ once in 105 cell generations)
![Page 31: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/31.jpg)
31
Model for non-replicative transposition
Transposase cuts at the ends of the short inverted repeats and inserts transposon into new target DNA site
Insertion of transposon results in duplication of target sites
![Page 32: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/32.jpg)
32
A model for replicative transpostion
Involves DNA synthesis Tn3 transposes via
cointegrate formation
Tn3
![Page 33: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/33.jpg)
33
Transposase is a specialized recombination enzyme
Functions as a dimer, each monomer recognizes the same specific DNA sequence at the ends of the transposon
Dimerization of the subunits creates a DNA loop
Staggered cuts made on ends of target site
DNA Pol + Ligase
![Page 34: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/34.jpg)
34Insertion of tranposon into new site & duplication of target sites
Recognition of target site
Mechanism of Transposition by Tn5
![Page 35: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/35.jpg)
35
Some viruses use transpositional site-specific recombination to move themselves into host chromosomesE.g. Bacteriophage Mu, retroviruses
Move via an RNA intermediate Use a reverse transcriptase and an integrase
(transposase)
![Page 36: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/36.jpg)
36
Retrovirus
![Page 37: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/37.jpg)
37
Integrase (transposase)
![Page 38: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/38.jpg)
38
Staggered cuts at target site
Insertion of retroviral DNA (or retrotransposons) into host genome
![Page 39: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/39.jpg)
39
CLASS III: Non-viral retrotransposons
Decendants of retroviral DNA (remnants of polyA tail)
no LTRs Occur as repetitive DNA
sequences (e.g. L1 element) Move via an endonuclease-
reverse transcriptase complex
![Page 40: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/40.jpg)
Mechanism of retrotransposition
40
2. An integrase (an endonuclease) generates staggered break at target site
3. A reverse transcriptase generates a cDNA copy of the retrotransposon
1. Retrotransposon is transcribed
E.g. LINE1
![Page 41: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/41.jpg)
Petunia hybrida line W138 contains a disrupted rt locus for anthocyaninpigment production due to the.insertion of transposon dTph1. The mutation gives rise to a white flower.
Excision of Tph1 transposon in some cells during development restored pigment production (i.e. pink).
The pie-shaped pattern of cells reveals that the flower grows outward from a small number of cells in the center of the primordial flower head.
41Kroon, J et al 1994
![Page 42: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/42.jpg)
42
1. DNA-only transposons move by DNA breakage and joining
2. Retroviral-like retrotransposons also move by breakage and joining, but via an RNA intermediate
3. Non-retroviral retrotransposons move by making an RNA copy which acts as a direct template for a DNA target-primed reverse transcription event
![Page 43: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/43.jpg)
43
![Page 44: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/44.jpg)
44
RecA-independent process Breakage and joining of DNA molecules occur
at a pair of specific sites involving very short homology (<50 bp)
Recombination is catalyzed by specific enzymes
Involved in the integration & excision of bacteriophage λ from the E.coli genome, and in the inversion of a DNA fragment
![Page 45: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/45.jpg)
45
![Page 46: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/46.jpg)
46
attP and attB share a common core sequence recognized by Int & Xis
Site-specific recombination occurs between direct repeats - attP & attBor attL & attR, respectively
attP CAGCTTTTTTTATACTAAGTTGGTCGAAAAAAATATGATTCAAC
O site
(POP)
(Int, IHF)
attL attRattP
attB
POP’
BOB’
BOP’ POB’attL attR
(Xis)
(Integrase)
Integration and excision of λ into E. coli DNA
+ IHF
![Page 47: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/47.jpg)
47
“prophage”
Integration of λ
![Page 48: Lecture 2 - Genetic Re Combination](https://reader034.vdocument.in/reader034/viewer/2022051817/547ffac1b379596a2b8b5978/html5/thumbnails/48.jpg)
Alberts et al, Molecular Biology of the Cell 5th
Edition, p304-326
48