lecture 6 experiment 3: basic subcloning flowchart experiment 4: light regulated genes principles...
TRANSCRIPT
![Page 1: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/1.jpg)
Lecture 6
• Experiment 3: Basic subcloning
• Flowchart
• Experiment 4: Light regulated genes
• Principles and process of RNA isolation
• Assignment 1 due next week
• Discussion of Article 3
![Page 2: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/2.jpg)
Experiment 3
• Goal: To introduce basic procedures used to manipulate DNA.
• General procedures are DNA fragment isolation, ligation of DNA, transformation of bacteria, small scale DNA isolation.
![Page 3: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/3.jpg)
Lab 6
DNA fragment isolation kit
A Vector preparation
B Fragment isolation
![Page 4: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/4.jpg)
Lab 7
Ligation of vector and DNA fragment
T4 DNA ligase
![Page 5: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/5.jpg)
How do we ligate a XhoI and Sal I site together?
GTCGAC SalI
CTGCTG
CTCGAG XhoI
GAGCTC
![Page 6: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/6.jpg)
Lab 8A. Run ligation reactions on an agarose gel
B. Transform bacteria
![Page 7: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/7.jpg)
Lab 9
Blue white selection (screen)
![Page 8: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/8.jpg)
Lab 10 and 11
• Small scale DNA isolation (Lab 2)
• Restriction enzyme digestion (Lab 3)
![Page 9: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/9.jpg)
Experiment 4
• Goal: to characterize the response of light regulated genes.
• Method: RT-PCR.
• General take home messages: Use of RT-PCR to measure levels of transcript accumulation; use of mutants to characterize a biological process; environmental regulation of gene expression.
![Page 10: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/10.jpg)
Etiolation and det1
![Page 11: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/11.jpg)
Experimental set up
![Page 12: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/12.jpg)
1. wild-type grown in the light
2. wild-type grown in the dark
3. det1 grown in the light
4. det1 grown in the dark
What are the expression levels oflight regulated genes (chlorophylla/b binding proteins CHAB and CLAB)
using tubulin as loading control.
-Extract RNA-RT mRNA-PCR cDNA
WT-
light
WT-
dark
det1
-ligh
tde
t1-d
ark
Ladde
r
WT-
light
WT-
dark
det1
-ligh
tde
t1-d
ark
CHAB CLAB
TUB
CHAB or CLAB
Picture of Plants (WT and mutant)
![Page 13: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/13.jpg)
Isolation of RNA using Commercial Trizol Reagent
Liquid N2
Trizol
Homogenize
PhenolChloroform
RNA
Isopropyl alcohol
Ppt RNA DEPC H2O
Trizol:-mono-phasic solution of phenol and guanidine isothiocyanate-lyses cells and dissolves cell components while maintaining integrity of RNA
Chloroform: separate aqueous and organic phases (RNA is in the top aqueous phase)Isopropanol: Precipitates RNA75% Ethanol: Wash RNA pelletDEPC (Diethylpyrocarbonate) water: Resuspend RNA pellet in RNAse-free water
DEPC interacts with the active site histidine residue of RNAse and irreversibly inactivates RNAses.
Aq
Org
75% EtOH
![Page 14: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/14.jpg)
Assignment 1
Group Gel result Group Gel result1-1 no 2-4 YES1-2 no 2-5 no1-3 YES 2-6 no2-1 YES 3-1 YES2-2 no 3-2 no2-3 no 3-3 no
![Page 15: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/15.jpg)
Example sequence
GGTAANGGAACTGGAATCCAAACTCTCTGAAGCTGAGAAGGAATTCATCGAAGGAGCACCAACACGTAGCAAACGATCACCATCCGAGTGGATACCAAGGCCACCCGAAAAATACAGTCTTACTGGGCACAGAGCTCCTATCAACAGAGTTATTTTCCATCCGGTCTTTAGTCTTATAGTATCTGCCAGCGAAGATGCCACTATCAAGGTG
TGGGACTTCGAGAGCGGCGAATTCGAAAGAACGTTGAAGGGGCACACCGACAGCGTGCAGGACGTTTCCTTCGACGTCTCCGGGAAACTGTTAGTCTCATGCAGTGCGGACATGTCTATTAAGTTATGGGACTTTCACCAGTCATTCGCCTGCGTGAAAACCATGCACGGACATGATCACAGTGTCAGCTCTGTCGCATTTGTGCCACAAGGGGATTTCGTAGTGAGCGCCTCTAGGGATAAGACCATCAAAATATGGGAAGTAGCGACAGGGTATTGTGTCAAAACGTTAACGGGGCACAGAGAATGGGTACGGATGGCCAGAGTCAGTCCTTGTGGAGAATTAATAGCTAGTTGCTCGAACGATCAAACAGTACGGGTTTGGCACGTGGCAACAAAGGAAACGAAGGTCGAACTCAGAGACCACGAACACGTAGTGGAGTGTATCGCATGGGCACCGGACAGTGCAAGAGCATCGATCAACGCTGCTGCAGGGGCGGACAATAAGGGAGCCCATGAAGGACCTTTCCTCGCATCTGGCTCGCGAGACAAAGTAATTCGTGTATGGGATGTCGGTGCCGGTGTTTGTCTCTTCGCCCTATTGGGCCACGACAACTGGGTTCGCGGCATCGTCTTCCATCCTGGTGGCAAGTTCATCGTCAGTGNCTCTGACGACAAGANCCTGCGAGTATNGGANACGCGCAACANANGGGTAATGAAA
ACCCTCNAAGCGCACGTCCACTTCTGCNCCTCCNTTGATTTCACAAAAGCCATCCTTACGTGGTCNCCGGTAGTG
![Page 16: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/16.jpg)
Step into liquid
![Page 17: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/17.jpg)
I will be available for a large-scale public consultation on Friday from 4:00PM until we are done. Bring your laptops.
You can make appointments for consultation as well. Time is running out.
Assignment 1 due next Monday Oct. 27, 2008
Assignment 1
![Page 18: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/18.jpg)
Discussion of Article 3
![Page 19: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/19.jpg)
![Page 20: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/20.jpg)
![Page 21: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/21.jpg)
![Page 22: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/22.jpg)
Taken from Hall J. C. Science
![Page 23: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/23.jpg)
Taken from Hall Science
![Page 24: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/24.jpg)
![Page 25: Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week](https://reader036.vdocument.in/reader036/viewer/2022062305/56649e885503460f94b8be81/html5/thumbnails/25.jpg)