lecture 7 (biol3600) genetic code and translation

Transcription - Recapitulation

• All genes (eukaryotic and prokaryotic) have a unique region (promoters) of DNA sequence upstream of (before) the transcriptional start site that serves as a binding site for the RNA polymerase enzyme• General functions of promoters: 1. Provides specificity – Each gene has a unique promoter sequence 2. Tell RNA polymerase where to start (they are usually at the beginning) - No promoter (or mutated promoter), no transcription 3. Indicate which strand will be transcribed and the direction of transcription

•Most promoters share a few common sequences called consensus sequencesProkaryotic promoters share 2 main types of consensus sequences - TATA box (aka Pribnow box) (-10-15), sequence is usually TATAAT - TTGACA – found 35 nucleotides upstream •Prok. RNA polymerase enzyme makes direct contact with the promoter at these consensus sequences• Unique seq. within and around promoters help determine rates of transcriptionProkaryotic cells only produce 1 type of RNA polymerase to produce all of the mRNA, tRNA, and rRNA in the cell.• Prokaryotic RNA polymerase structure: - 2 alpha (α), 1 beta (β), 1 beta prime (β'), 1 sigma (σ) subunit, and one omega subunit. - Together they have the basic catalytic function of producing new RNA - σ factor controls binding to the promoter (PROMOTER RECOGNITION) - After initial binding has been successful, the σ factor comes off the core

- Bacteria make many different types of sigma factors - Different sigma factors recognize different promoter sequences.


• Prokaryotic RNA polymerase structure: - β, β’, α and subunits interact and form the CORE ENZYME - Together they have the basic catalytic function of producing new RNA - σ factor controls binding to the promoter (PROMOTER RECOGNITION) - After initial binding has been successful, the σ factor comes off the core

- Bacteria make many different types of sigma factors - Different sigma factors recognize different promoter sequences• Once it binds to the specific promoter, RNA polymerase positions itself over the transcriptional start site based on its distance from the consensus sequences - No specific “start signal” exists for beginning of transcription. • RNA pol unwinds the DNA near the start site (transcription bubble created).• RNA pol continues producing a complimentary RNA molecule until it transcribes a terminator signal.Two major prokaryotic transcriptional terminator signals exist. - Both must: (a) Slow down the RNA polymerase; (b) Weaken the interaction between the DNA and RNA in the bubble.Properties of the two major prokaryotic terminator signals 1. Rho-independent terminators - The DNA sequence contains an inverted repeat followed by a string of 6 adenines. Following their transcription, the inverted repeats form Hydrogen bonds with each other within the RNA and form a hairpin loop - Loop formation causes the RNA pol to pause - The pause combined with weak hydrogen bonding between 6 straight A-U pairs cause the RNA to totally fall off of the DNA template.


• (… two major prokaryotic terminator signals) 2. Rho-dependent terminators - Also contain inverted repeats that cause hairpin loop formation in the new RNA. Slows down the polymerase - RNA contains a binding site for the Rho protein. Rho moves towards the 3’ end

- Acts as a RNA/DNA helicase. Rho is ATPase and helicase. - Many prokaryotic genes are organized in operons (genes in tandem, in similar pathway).

Eukaryotic transcription follows the same basic steps of prokaryotic transcription - Activation, initiation, elongation, termination - Major differences exist in how they accomplish the above steps• General features of transcriptional activation is similar in prokaryotic and eukaryotic cells - Some genes are constituitively expressed, others are regulated - The exact nature of the signals that activate transcription can be very different • Initiation – Making the DNA accessible. Eukaryotic DNA is tightly coiled around proteins called histones (and some nonhistone proteins) - DNA is negatively charged (phosphate groups), histones are very positively charged-A histone octamer (8 histone proteins in a complex). Each group is called a nucleosome • DNA is freed from histones in 2 major ways: 1) Histone acetylation (HATs) add an acetyl group (CH3CO) to histones. This neutralizes their positive charge and causes them to lose their attraction for DNA. - Occurs only in the area to be transcribed (it is specific!) Deacetylases remove acetyl groups after transcription 2) Chromatin remodeling - Some proteins move nucleosomes around without directly modifying histones.

GENETICS

A Conceptual ApproachFOURTH EDITION

GENETICS


Benjamin A. Pierce

© 2012 W. H. Freeman and Company

CHAPTER 15The Genetic Code and Translation

HUTTERITES, RIBOSOMES, AND BOWEN-CONRADI SYNDROME

Almost all children with Bowen-Conradi syndrome are Hutterites, (1500s in Austria). Hutterites immigrated to South Dakota in the 1870s . They live on communal farms, are strict pacifists, and rarely marry outside of the Hutterite community. founder effect—the presence of the gene in one or more of the original founders—and its spread as Hutterites intermarried within their community. 2009: Bowen-Conradi syndrome results from the mutation of a single base pair in the EMG1 gene, located on chromosome 12.The protein encoded by the EMG1 gene plays an essential role in processing 18S rRNA and helps to assemble it into the small subunit of the ribosome. Because of a mutation in the EMG1 gene, babies with Bowen-Conradi syndrome produce ribosomes that function poorly and the process of protein synthesis is universally affected.

The genetic code and translation

Chapter 15 Outline

15.1 Many Genes Encode Proteins, 402

15.2 The Genetic Code Determines How the Nucleotide Sequence Specifies the Amino Acid Sequence of a Protein, 407

15.3 Amino Acids Are Assembled into a Protein Through the Mechanism of Translation, 412

15.4 Additional Properties of RNA and Ribosomes Affect Protein Synthesis, 420

15.1 Many Genes Encode Proteins

• The One Gene, One Enzyme Hypothesis

• Genes function by encoding enzymes, and each gene encodes a separate enzyme.

• More specific: one gene, one polypeptide hypothesis

Transcription, mRNA processing, and translationInstructions Product

• Reviewing how we go from instructions (DNA) to product (protein) 1. Transcription - The information contained in the DNA is copied into a complementary strand of RNA (ribonucleic acid) - This RNA copy is called messenger RNA or mRNA - It contains the same protein-building instructions as contained in the DNA 2. mRNA editing/export (only in eukaryotes) - The mRNA copy is capped, given a poly-A tail, and spliced - Processed mRNAs are shipped out of the nucleus 3. Translation - Cytosolic mRNA is recognized by a ribosome - Ribosomes read the mRNA and make a protein

Genetic codeThe language of genetics

• Ribosomes can read protein-building instructions some genetic language must exist - This language is called the genetic code • Properties of the genetic code 1. Location of the genetic code - DNA stores the genetic information, but mRNA contains the actual “words” that are read by the ribosome - Ribosomes do nothing with DNA (genetic code is found within mRNA) 2. The letters of the alphabet - mRNA contains the ribonucleotides A, U, C, G - Ribosomes read the linear order of these letters (don’t bounce around)

GCGAUUGCAAUGCUACGGA

3. How are words organized? - Ribosomes read nucleotides in separate small groups (words) - Maximizes efficiency and minimizes errors


• Properties of the genetic code 3. How are words organized? - Experimental evidence – Francis Crick and others introduced point mutations into a specific gene and monitored how they affected the amino acids

1

GCGAUUGCAAUGCUACGGACAUGCUUG

2 3 4 5 6 7 8 9amino acids

Normalsequence

GCGUAUUGCAAUGCUACGGACAUGCUUGInsert 1 nt

GCGUGAUUGCAAUGCUACGGACAUGCUUGInsert2 nt

GCGUGGAUUGCAAUGCUACGGACAUGCUUGInsert3 nt

1 2 3 4 5 6 7 8 9amino acids X X X X X X X X

amino acids 1 2 3 4 5 6 7 8 9X X X X X X X X

1 X 2 3 4 5 6 7 8amino acids 9

Ribosomesread the lettersin groups of 3

frameshiftmutation


• Properties of the genetic code 3. How are words organized? - Another way of visualizing the previous experiment (assuming 3 letter words)

Correct THEDOGBITTHEMAN THE DOG BIT THE MAN

Insert 1 THEBDOGBITTHEMAN THE BDO GBI TTH EMA N

Insert 2 THEBIDOGBITTHEMAN THE BID OGB ITT HEM AN

Insert 3 THEBIGDOGBITTHEMAN THE BIG DOG BIT THE MAN

Inserting 3 nucleotides restored the reading frame – very strong evidence that ribosomes read letters in groups of 3

- Also think about the math (remembering there are 20 amino acids): - If the words were single letters – only 4 possible words (A, U , C, or G) - If the words are made of only 2 letters (GU, CC, etc.) – only 16 possible words - If the words are made of 3 letters (CAU, ...) – 64 possible words - PLENTY!!


• Properties of the genetic code 3. How are words organized? - The groups of 3 ribonucleotides in mRNA that are read by the ribosome are called codons - Codons are not separated from one another on the strand (no spaces, etc.) - Ribosomes read codons one after another with no breaks

- Each codon specifies only a single amino acid (e.g. it is unambiguous) - e.g. AUG tells the ribosome to put in the a.a. methionine AAA tells the ribosome to put in the a.a. lysine - It is universal for all species - Examples: AAA codes for lysine in bacteria, plants, fungi, animals,..... GUU codes for valine in all species - Exception: Some Archae utilize different codons for a given amino acid

http://en.wikipedia.org/wiki/Image:RNA-codon.png


• Properties of the genetic code 4. Is the genetic code overlapping? - In other words, do we see:

GUACCG 2 nonoverlapping codons (GUA CCG) GUACCG 4 overlapping codons (GUA, UAC,ACC,CCG)

- Experiment - If we change the U in the above sequence to a different letter, how many amino acids should change if its nonoverlapping? How many if its overlapping?

- Results showed that such a mutation only resulted in a single amino acid change The genetic code is NONOVERLAPPING - The ribosome reads the first three, moves down three letters and reads the second three

http://en.wikipedia.org/wiki/Image:RNA-codon.png


• Properties of the genetic code 5. Is the genetic code is degenerate (redundant) - Each codon is made up of 3 letters and there are 4 possible letters 4 x 4 x 4 = 64 possible codons - Only 20 different amino acids normally found in proteins

Possibilities: - 44 codons (64 minus 20) do not code for any amino acid (wasteful) - More than 1 codon can code for the same amino acid (smart!)

- Studies have shown that more than 1 codon can code for the same amino acid (IT IS DEGENERATE) - Example: UCU, UCC, UCA, UCG, AGU, AGC all code for the a.a. serine - If you have a codon UCU and it is mutated to UCC, what happens to the amino acid sequence? - The last nucleotide of a codon can often be changed with no effect on a.a. - Allows for a little flexibility Called wobble

64 20


• Properties of the genetic code 6. Which codon codes for which amino acid?

- Marshall Nirenberg and Heinrich Matthaei – 1961 - Did several key experiments that deciphered the genetic code a) Making polypeptides with artificial mRNAs 1) Developed an in vitro (test tube) translation system - Contained ribosomes, tRNAs, amino acids, and translation factors - Add mRNA Polypeptide chain is made in the tube

2) Made artificial mRNAs containing only 1 repeated nucleotide - Examples: UUUUUUUUUU or CCCCCCCCC or AAAAAAAAAAA - Poly U – Contains codons UUU UUU UUU UUU UUU.......

3) Set-up 20 different in vitro translation tubes - Each contained ribosomes, tRNAs, translation factors, and poly U mRNA - Each tube contained 1 radioactive amino acid - Each had a different one

http://history.nih.gov/exhibits/nirenberg/popup_htm/05_mathNiren.htm


• Properties of the genetic code 6. Which codon codes for which amino acid? - Marshall Nirenberg and Heinrich Matthaei – 1961 - Did several key experiments that deciphered the genetic code a) Making polypeptides with artificial mRNAs

4) Looked to see which radioactive amino acid formed a chain

- Results from above: UUU codes for Phe - Repeated for poly A and poly C

Ala* Met* Lys* Phe* Tyr* His*

Poly Uexp.

http://history.nih.gov/exhibits/nirenberg/popup_htm/05_mathNiren.htm


• Properties of the genetic code 6. Which codon codes for which amino acid? a) Making polypeptides with artificial mRNAs - Different picture of the experiment just described

b) Triplet binding assay - Review of transfer RNA (tRNA) function - tRNAs TRANSFER different amino acids to the ribosome - Each type of tRNA molecule carries 1 of the 20 a.a. (different tRNAs carry different amino acids) - Review of tRNA structure - All tRNAs fold into a complex 3-D shape that looks like a cloverleaf - All possess two distinct structural regions: - Amino acid binding site - Anticodon loop

• Degenerate code: Amino acid may be specified by more than one codon.

• Synonymous codons: codons that specify the same amino acid

• Isoaccepting tRNAs: different tRNAs that accept the same amino acid but have different anticodons

The Degeneracy of the Code


• Properties of the genetic code 6. Which codon codes for which amino acid? 3) Triplet binding assay - Two major regions of tRNAs: a) Amino acid binding site (acceptor stem) - Single-stranded 3' end that binds to the amino acid - Enzymes called aminoacyl-tRNA synthetases read the tRNA sequence and add the appropriate amino acid to the stem - Amino acid addition is VERY SPECIFIC! b) Anticodon loop - at center of middle loop - Sequence of three bases that is complementary to a codon in the mRNA - Each type of tRNA contains a different anticodon (and each is carrying a specific a.a.)

Anticodons bind to the complimentary codons in mRNA!

aa


• Properties of the genetic code 6. Which codon codes for which amino acid? 3) Triplet binding assay a) Made an artificial mRNA consisting of just 1 codon b) Added to ribosomes - The triplet (just 1 codon) binds to the mRNA binding site in the ribosome c) Have 20 tubes set-up - To each, add a different tRNA-amino acid (radioactive) - The codon will only bind to the tRNA with the matching anticodon - Example: CAG in mRNA will recruit tRNA with the anticodon GUC d) Look to see which radioactive amino acid is brought into the ribosome

Was able to assign an amino acid to all the codons (but 3)

• Found that 61 of 64 possible codons code for an amino acid

• Notice the redundancy (degeneracy) - UCU, UCC, UCA, UCG, AGU, AGC all code for serine - Third position often unimportant (UC_) - H bonding is more important in 1st 2 positions • Not all codons code for an amino acid - 3 stop codons exist - When ribosome reads, termination occurs and protein synthesis ceases • AUG is always the start codon - Thus, all proteins start with a methionine


• Codons – Sense codons: encoding amino acid– Initiation codon: AUG– Termination codon: UAA, UAG, UGA

• Wobble hypothesis

The Degeneracy of the Code

Concept Check 3

Through wobble, a single can pair with more than one .

a. codon, anticodon

b. group of three nucleotides in DNA, codon in mRNA

c. tRNA, amino acid

d. anticodon, codon

15.3 Amino Acid Are Assembled into a Protein Through the Mechanism of Translation

•The Binding of Amino Acids to Transfer RNAs

•The Initiation of Translation

•Elongation

•Termination

• Aminoacyl-tRNA syntheses and tRNA charging

• The specificity between an amino acid and its tRNA is determined by each individual aminoacyl-tRNA synthesis. There are exactly 20 different aminoacylt-tRNA syntheses in a cell.

The Binding of Amino Acids to Transfer RNAs

Concept Check 4

Amino acids bind to which part of the tRNA?

a. anticodon

b. DHU arm

c. 3’ end

d. 5’ end

• Translation – Process by which a ribosome reads the sequence of codons in a strand of mRNA and uses the information to produce a polypeptide from amino acids

• Ribosomes are made up of 2 subunits – a small and a large - Each subunit contains 20-50 different proteins and several molecules of ribsomal RNA (rRNA) - Differences in sizes exist between prokaryotic and eukaryotic ribosomes 1) Prokaryotic – 70S - Large (50S) + small (30S) - Contains 16S rRNA - Used for species ID

2) Eukaryotic – 80S - Large (60S) + small (40S)

TranslationReview and ribosomes

• All ribosomes have 1 mRNA binding site and 3 binding sites for tRNAs - Remember tRNAs are going to bring the appropriate amino acids to the ribosome - A (aminoacyl) site = Holds a tRNA that just arrives to the ribosome - P (peptidyl) site = Holds a tRNA that contains the growing polypeptide chain - E (exit) site = Holds a tRNA that has already given up its amino acid and is getting ready to exit the ribosome

TranslationRibosomes

TranslationThe process

• Translation can be divided into 3 major stages: 1) Initiation – Getting the ribosome ready a) Several initiation factors bind to the small ribosomal subunit - Initiation factors (IFs) are proteins that help get the ribosome/mRNA/tRNA assembled - IF3 binds to the small subunit and helps keep it apart from the large subunit

b) Recruitment of an initiator tRNA to the small subunit - IF2 (euk and prok) binds to an initiator tRNA and brings it to the P site of the small subunit - Initiator tRNA contains the anticodon UAC and a the amino acid methionine - Why this tRNA? - Remember the universal start codon is AUG - Thus need to start with a tRNA that has the anticodon UAC

• Initiation factors IF-3, initiator tRNA with N-formylmethionine attached to form fmet-tRNA

• Energy molecule: GTP

The Initiation of Translation

• The Shine–Dalgarno consensus sequence in bacterial cells is recognized by the small unit of ribosome.

• The Kozak sequence in eukaryotic cells facilitates the identification of the start codon.

The Initiation of Translation


• Translation can be divided into 3 major stages: 1) Initiation – Getting the ribosome ready c) The mRNA binds to the small ribosomal subunit - In eukaryotic cells, a complex of initiation factors (collectively called IF4) binds to the mRNA 5' cap - IF4 on the mRNA interacts with IF3, which is already bound to the small subunit - Starting at the end, the small subunit begins scanning the mRNA until reaching the first available AUG (start codon) - Ribosome helps identify the start codon by the presence of an upstream Kozak sequence

- Bacterial mRNA don't have a cap – bind to ribosome via IF3 only (no scanning from the end). - Shine-Dalgarno sequence before AUG helps the ribosome find it

AUG AUG


• Translation can be divided into 3 major stages: 1) Initiation – Getting the ribosome ready d) The large subunit binds to the assembled complex - The large ribosomal subunit comes in and attaches to the small subunit complex

- Most of the other initiation factors then come off the complex

The ribosome is now ready to begin constructing a polypeptide

• Exit site E

• Peptidyl site P

• Aminoacyl site A

• Elongation factors: Tu, Ts, and G

Elongation


• Translation can be divided into 3 major stages:

2) Elongation – Stage when the polypeptide is actually made a) The ribosome reads the next codon (3 nucleotides) and the specific tRNA with the complimentary anticodon will come into the A site - Attachment of tRNAs to the ribosome is aided by various elongation factors (EFs) in prokaryotes and eukaryotes

b) The methionine is removed from the 1st tRNA and enzymatically added to the amino acid on the 2nd tRNA (the one in the A site) - A peptide bond is formed - This transfer reaction is catalyzed by the rRNA in the ribosome


• Translation can be divided into 3 major stages: 2) Elongation – Stage when the polypeptide is actually made c) The empty (uncharged) tRNA in the P site moves into the E site briefly and exits the ribosome - tRNA movement is aided by other EFs

d) mRNA shifts by 3 nucleotides (also aided by EFs) - The tRNA with the 2 amino acids moves to the P site - The 3rd codon is now exposed in the A site e) The tRNA with the complimentary anticodon comes into the A site


• Translation can be divided into 3 major stages: 2) Elongation – Stage when the polypeptide is actually made f) Dipeptide on the tRNA in the P site is transferred onto the amino acid in the A site............ The whole process continues – a polypeptide chain is created

The order of codons determines the order of amino acids!!

Elongation summary

Concept Check 5

In elongation, the creation of peptide bonds between amino acids is catalyzed by .

a. rRNA

b. protein in the small subunit

c. protein in the large subunit

d. tRNA

• Termination codons: UAA, UAG, and UGA

• Release factors

Termination


• Translation can be divided into 3 major stages: 2) Elongation - How are a.a. chemically-linked during elongation? - The amino group of one amino acid reacts with the carboxyl group of an adjacent amino acid - Water is removed (dehydration) and a peptide bond is formed - All peptides/polypeptides/proteins have 2 ends - N-terminus (a.a. 1) – Free NH2 group - C-terminus (last a.a.) – Free COOH group

• Termination codons: UAA, UAG, and UGA

• Release factors

Termination


• Translation can be divided into 3 major stages: 3) Termination – The process stops - As the ribosome reads the mRNA, it eventually will arrive at one of the 3 stop codons (UAA, UAG, UGA) - No tRNA has a corresponding anticodon No amino acid can be added to the chain - This acts as a signal to the ribosome that it needs to end translation - Protein release factors bind to the ribosome and release both the mRNA and polypeptide (and cut the polypeptide from the last tRNA)


• Review of translation

Animation: http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations.html

GENETICS


GENETICS


Benjamin A. Pierce

© 2012 W. H. Freeman and Company

CHAPTER 16

Control of Gene Expression in Prokaryotes

Chapter 16 Outline

16.1 The Regulation of Gene Expression Is Critical for All Organisms, 432

16.2 Operons Control Transcription in Bacterial Cells, 435

16.3 Some Operons Regulate Transcription Through Attenuation, the Premature Termination of Transcription, 448

16.4 RNA Molecules Control the Expression of Some Bacterial Genes, 451

16.1 The Regulation of Gene Expression is Critical for All Organisms

•Genes and Regulatory Elements

•Levels of Gene Regulation

•DNA-Binding Proteins

Genes and Regulatory Elements

• Structural genes: encoding proteins

• Regulatory genes: encoding products that interact with other sequences and affect the transcription and translation of these sequences

• Regulatory elements: DNA sequences that are not transcribed but play a role in regulating other nucleotide sequences

Genes and Regulatory Elements

Constitutive expression: continuously expressed under normal cellular conditions

Positive control: stimulate gene expression

Negative control: inhibit gene expression

Regulation of transcription Prokaryotic cells

• Transcriptional regulation in prokaryotic cells 2) Gene grouping (operons) - Bacteria organize their genes much more efficiently than do eukaryotic cells - Examples Genes controlling eye color in humans may be found on 7 different chr. All genes controlling Trp production in bacteria are found 1 after another - Bacteria typically organize all genes that have a related function together into what is known as an operon

- Operons contain: 1) A promoter region, which contains the operator region - Operator = Binding site for a repressor protein (ON/OFF switch) 2) Set of related genes found in tandem (back-to-back) - Because they share a promoter, TURN 1 GENE ON, TURN THEM ALL ON!!

gene 1 gene 2 gene 3 gene 4reg gene

operator

promoter


• Transcriptional regulation in prokaryotic cells 2) Gene grouping (operons) b) Negative regulation of operons (repressible operons) - Transcription is normally on - A corepressor comes along and activates the repressor, - The activated repressor then binds to the operator - Transcription of all genes in the operon is shut off!! - Example: Trp operon

http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter18/animations.html#

http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter18/animations.html

The lac Operon of E. coli

• A negative inducible operon

• Lactose metabolism

• Regulation of the lac operon

• Inducer: allolactose

–lacI: repressor encoding gene

–lacP: operon promoter

–lacO: operon operatorhttp://www.youtube.com/watch?v=iPQZXMKZEfw&list=PL8091AA96CA7136B2&index=14&feature=plpp_video

http://www.youtube.com/watch?v=iPQZXMKZEfw&list=PL8091AA96CA7136B2&index=14&feature=plpp_video


a) Positive regulation of operons (inducible operons)

- Transcription is normally turned off (because the repressor is active when it is unbound by anything)

- An inducer comes along, binds to the repressor, and inactivates it - With the repressor shut down, transcription of all genes in the operon is allowed to occur - Example: Lac operon

http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter18/animations.html#

http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter18/animations.html

Concept Check 4

In the presence of allolactose, the lac repressor .

a. binds to the operator

b. binds to the promoter

c. cannot bind to the operator

d. binds to the regulator gene

Attenuation in the trp Operon of E. coli

• Four regions of the long 5′ UTR (leader) region of trpE mRNA

• When tryptophan is high, region 1 binds to region 2, which leads to the binding of region 3 and region 4, terminating transcription prematurely.

Attenuation in the trp Operon of E. coli

• Four regions of the long 5′ UTR (leader) region of trpE mRNA

• When tryptophan is low, region 2 binds to region 3, which prevents the binding of region 3 and region 4, and transcription continues.

http://www.youtube.com/watch?v=42RqqAYs8Fk&list=PL8091AA96CA7136B2&index=17&feature=plpp_video

http://www.youtube.com/watch?v=42RqqAYs8Fk&list=PL8091AA96CA7136B2&index=17&feature=plpp_video

TranscriptionRegulation in eukaryotic cells

• Eukaryotic cells utilize much more complicated mechanisms of controlling transcription

• Some mechanisms of eukaryotic transcriptional control: 1) Regulatory transcription factors - Basal TFs only provide baseline levels of transcription - Sole function: Get the RNA polymerase onto the DNA

- Regulatory TFs function to alter transcription above or below basal levels - Provides fine control over transcription - Cells have 100s of them

- Regulatory TFs bind to 2 types of DNA seq.: - Promoters (not just consensus seq) - Enhancers - Function to increase rates of transcription - Can be located far from the promoter (up or down) - TF binding causes DNA bending so that enhancer/promoter close in 3-D

Levels of Gene Regulation

in Eukaryotes


• Some mechanisms of eukaryotic transcriptional control: 1) Regulatory transcription factors - Regulatory transcription factors do their job by: a) Binding to DNA and directly altering recruitment/binding/movement of basal TF and RNA pol - Some may sterically block binding whereas others stabilize it

b) Others bind to DNA and recruit or block HATs - Increasing or decreasing histone acetylation can alter how well basal TF get to the DNA

End result of both: - Clear the way for basal TF (or increase their affinity) enhancement

- Block basal TF in any way reduce transcription

2) DNA methylation - A methyl group is enzymatically added to cytosines via specific methyltransferases - CG is usually the recognition sequence


DNA methylation (cont) - Methylated bases serve as binding sites for methyl-CpG-binding domain proteins (MGDs) - These block transcription factor assembly, block chromatin remodeling, and also recruit histone deacetylases DNA methylation usually functions to block transcription - Methylation is cell and tissue-specific - Programmed during early development - During cell differentiation, different genes become methylated in different cell types - Example: Brain-specific genes methylated in liver cells and vice versa

brain liverembryo embryo


DNA methylation (cont)

- Pattern of methylation is unique in each person and is somewhat influenced by environment - Total collection of DNA structural alterations = epigenetics

- Epigenetics and relationship to reproductive animal cloning - Somatic cell nuclear transfer procedure - Take nucleus out of a donor somatic cell (e.g. skin cell) - That cell already has certain genes methylated - Inject it into an empty egg and implant into a surrogate mom - Theory: All methylated DNA gets demethylated once inside an egg again (reset) - Baby born will have identical genome as the donor animal

http://upload.wikimedia.org/wikipedia/en/8/8c/Dolly_clone.svg


DNA methylation (cont) - Epigenetics and relationship to reproductive animal cloning - Two problems result from the above procedure: a) Demethylation is never complete in the egg - Ideal situation: All genes get demethylated and the zygote starts with a blank slate - All genes start in the “on” position and can be methylated differently in the different tissues - Actual situation: A few genes fail to be demethylated - Start a new animal with certain genes in the “off” position permanently - Imagine if that gene is involved in brain development - Will never be turned on!! Result: Most clones die very young!!

ideal

real


DNA methylation (cont)

b) Methylation is affected by the environment - Methylation of the original donor’s DNA can be different from that of the clone - We still can’t predict or control it - Genome is identical Epigenome is not End result: Clone can have different appearance and personality as the donor - Example: CopyCat and Rainbow

- Epigenetics and imprinting - Imprinting = Specific case of DNA methylation whereby a given gene is methylated differently depending on what parent it came from - Transcription of gene A may be shut off on mom’s chr. 10 ,but active on dad’s chr. 10 (essentially only having 1 functional copy)

Original Clone

lecture 7 (biol3600) genetic code and translation

Technology