ledgf binds to heat shock and stress-related element to activate the expression of stress-related...

LEDGF Binds to Heat Shock and Stress-Related Elementt

DL*H‡

R

LOwnaahLrpcpmLssTmL

sp

smtr

Cdr

tAT

Biochemical and Biophysical Research Communications 283, 943–955 (2001)

doi:10.1006/bbrc.2001.4887, available online at http://www.idealibrary.com on

o Activate the Expression of Stress-Related Genes

hirendra P. Singh,*,† Nigar Fatma,*,† Akira Kimura,‡eo T. Chylack, Jr.,*,† and Toshimichi Shinohara*,†,1

Center for Ophthalmic Research, Brigham and Women’s Hospital, and †Department of Ophthalmology,arvard Medical School, 221 Longwood Avenue, Boston, Massachusetts 02115; and

Department of Ophthalmology, Kumamoto University School of Medicine, Kumamoto, Japan

eceived April 10, 2001

tiple stresses. This is called “cross-protection” (1, 2). Oneotssaac

ip(pfiGnsvM(Ar(Hbtbsg

epawgnlc

We have investigated the mechanism by whichEDGF protects cells against environmental stress.ur earlier report showed that a low level of LEDGFas present in the nucleus of most cell types and sig-ificant elevation of LEDGF level was induced by heatnd oxidative stress. The cells overexpressing LEDGF-ctivated expression of heat shock proteins and en-anced survival of many cell types. Here we show thatEDGF binds to heat shock element (HSE) and stress-elated regulatory element (STRE) to activate the ex-ression of stress-related genes (Hsp27 and aB-rystallin). Apparently, HSE and STRE are present inromoters of many stress-related genes. Elevation ofany stress-related proteins (STRPs) induced byEDGF may protect cells against environmentaltress. In yeast, it has been demonstrated that a singletress can activate the expression of multiple STRPs.his is known as “cross-protection,” and now similarechanism has been found in mammalian cells andEDGF plays a vital role in it. © 2001 Academic Press

Key Words: aB-crystallin; cross-protection; consen-us core elements; Hsp27; LEDGF; stress-relatedromoter.

Cells respond and adapt to environmental stressesuch as heat shock, oxidative stress, osmotic stress byodulating several metabolic responses to counteract

hem. In yeast, a single stress activates multiple stress-elated genes promoting thereby resistance against mul-

Abbreviations used: Apaf-1, apoptotic protease activating gactor-1;AT, chloramphenicol-acetyltransferase; LEDGF, lens epithelium-erived growth factor; HSE, heat shock element; STRE, stress-elated element; Hsp, heat shock protein.

1 To whom correspondence should be addressed at Center for Oph-halmic Research, Brigham and Women’s Hospital, 221 Longwoodvenue, Boston, Massachusetts 02115. Fax: (617) 277-6717. E-mail:[email protected].

943

f the mechanisms of “cross-protection” appears to behat a single or few transcriptional factors bind to tran-criptional elements common to promoters of manytress-related genes to activate those genes and to initi-te elevation of multiple stress-related proteins. Suchctivation may enhance survival of stressed cells or res-ue cells from death.

Among stress conditions, heat shock has been stud-ed most extensively (3–6). Heat stress activates ex-ression of the heat shock transcription factors (HSFs)7, 8), then these homotrimer-HSFs bind to heat shockromoter element (HSE). The consensus HSE is de-ned by repeating 5-base pair motifs (nGAAn, so-calledAA box) (9, 10). Also stresses such as heat shock,itrogen starvation, oxidative stress, and chemicaltress (pH, sorbate, benzoate or ethanol) (11–14) acti-ate stress-related genes. Two transcription factors,sn2p and Msn4p, have been found to bind to STRE

15–17). The consensus sequence of the STRE is/TGGGGA/T that are found in promoters of Saccha-omyces cerevisiae, bacterial genes including CTT118), DDR2 (19, 20), Hsp104 GAC1 (21), Hsp26 (22),sp12 (23), and UB14 (24). This specific element haseen demonstrated to be sufficient for the activation ofhe heat shock gene (25). Interestingly, studies of dou-le mutation of Msn2p/Msn4p suggest that other tran-cription factors might be involved in stress-relatedene activation (15, 26).The LEDGF gene expresses two proteins, lens

pithelial-cell-derived growth factor (LEDGF)/p75 and52 by alternative splicing (27, 28). LEDGF also knowns p75 is a novel growth and survival factor (29, 30),hich belongs to a member of the hepatoma-derivedrowth factor family (31, 32). It is present predomi-antly in the nucleus of actively dividing cells and

ong-lived cell types such as neuronal cells (33). Inontrast, differentiating cells such as lens fiber cells

0006-291X/01 $35.00Copyright © 2001 by Academic PressAll rights of reproduction in any form reserved.

and superficial corneal epithelial cells lost LEDGFfrpimssp

lcacn(wp

magfLhrpsLa

etOaTstsH

M

pp(aaatc(m

Dlc

(Gibco-BRL). The binding site selection was performed with these 62bGsCGTctd

fL(Mrr8

mmp(pwsTrswiwsB

oawrbanfSi

twsGwwstf

oNSpwsw2

X

Vol. 283, No. 4, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

rom their nucleus (33). Although the exact functionalole of LEDGF is remained elusive, LEDGF has re-orted to be a weak coactivator of transcription, whichnteracts with transcriptional factor V16 activation do-

ain (34) and several components of the general tran-criptional factors. P52 is a general coactivator of tran-cription, and it is also a coactivator of splicing ofolymerase II restricted mRNAs (27).We speculated that LEDGF is a DNA binding regu-

atory factor, since it contains approximately 40% ofharged residues such as lysine, arginine, glutamiccid, and aspartic acid (27, 28). Computer search indi-ated that LEDGF also had consensus sequences of theuclear localization signal, DNA binding domainshelix-turn-helix), and a highly homologous sequenceith topoisomerase and high mobility group (HMG)roteins.Interestingly, rapid elevation of LEDGF and itsRNA in lens epithelial cells and cos7 cells is reported

fter exposure to heat- and oxidative-stress (35). Toenerate cells at elevated levels of LEDGF, we trans-ected lens epithelial cells and cos7 cells with pEGFP-EDGF construct. These cells expressed LEDGF atigher levels and survived remarkably well under se-um starvation, heat-, and oxidative-stresses. The ex-ression of Hsp27 and aB-crystallin in those cells wastimulated significantly (29). These data suggest thatEDGF might up-regulated expression of Hsp27 andB-crystallin genes.To understand mechanism of stress-related protein

xpression by LEDGF in cells under stress, we at-empted to identify DNA that could bind to LEDGF.ur studies revealed that LEDGF bound to the STREnd HSE and activated several stress-related genes.hese results have significant implications for under-tanding how LEDGF promotes survival of many cellypes against various stresses. We report here that aingle regulatory factor, LEDGF, is an activator of theSE and STRE in promoters of stress related genes.

ATERIALS AND METHODS

Plasmid construction, expression and purification of LEDGFroteins. Subcloning techniques were used throughout these ex-eriments as described by Sambrook et al. (36) and Ausubel et al.37). A fusion protein between glutathione-S-transferase (GST)nd LEDGF was described elsewhere (29). A construct containinggreen fluorescent protein (GFP) and LEDGF cDNA was gener-

ted with “Living Color System” (Clontech, Palo Alto, CA) usinghe plasmid vector pEGFP-C1 for eukaryotic expression and theseonstructs are called pEGFP-LEDGF and pEGFP empty vector29). The protein concentration was determined with the Bradford

ethod (38).

Oligonucleotides, PCR and cloning. To determine the in vitroNA-LEDGF binding sites, we used randomized 12-mer oligos

inked between 59 and 39 nonrandom flanking region of 25 bp oligosonsisting EcoRI and BamHI site, respectively, so called “oligo 62”

944

p oligos, 59-CAGGTCAGTTCAGCGGATCCT GTCG-[N 12]-AGGCGAATTCAGTGCAACTGCAGC-39 containing a randomized

equence of 12 nucleotides. These oligos as well as Primer A: (59-AGGTCAGTTCAGCGGATCCTGTC-39) and Primer B: (59-CTGCAGTTGCACTGAATTCGCCTC-39) were synthesized by Life-echnologies; Gibco BRL (Grand Island, NY). Primers A and B areomplementary to the 39 and 59 non-random part of “oligo-62” respec-ively and were used in PCR amplification of selected oligos asescribed elsewhere (39).

Binding site selection. Affinity chromatography was carried outollowing the method as described elsewhere (39, 40). PurifiedEDGF was covalently bound to CNBr-activated Sepharose 4B

Pharmacia Biotech, Inc.) in coupling buffer (buffer C) containing 0.1NaHCO3 (pH 8.3) and 0.5 M NaCl. Extra bound protein was

emoved by washing with five volumes of coupling buffer and theemaining active groups were deactivated by 0.1 M Tris–HCl (pH.0) according to manufacturer’s instructions.Double-stranded radiolabeled “oligo 62” was annealed to a 3-foldolar excess of primer B followed by filling-in with Klenow poly-erase in the presence of [a-32P]-dCTP and cold dNTPS. This

robe was suspended in 100 ml of buffer C containing 50 mM TrispH 8.0), 1 mM DTT, 10 mg/ml gelatin, 0.1 M NaCl, 10 mg/mloly[dI/dC] and 20 mg/ml tRNA. This radiolabeled probe (106 cpm)as added on a 100 ml LEDGF-Sepharose column. Three rounds of

election were performed for proper binding of DNA and protein.he column was washed with buffer C containing 100 mM NaCl toemove loosely bounded oligos. After binding, the column wasuccessively washed with buffer C. The bound oligos that elutedith 1 M concentrations of salt were amplified by PCR and ligated

nto Bluescript vector between EcoRI and BamHI sites. Each oligoas cloned in Bluescript (Stratagene, La Jolla, CA) and DNA

equences were determined in the DNA sequencing facility,righam and Women’s Hospital.

Electrophoretic mobility shift assay (EMSA). EMSA was carriedut as described by Martinez-Paster et al. (15, 41). In competitionssay, 10-, 100- and 1000-fold molar excess of cold self-competitoras added. A supershift was performed by the addition of 1 ml of

abbit-anti-LEDGF antibody (Ab) or neutralized antibody to theinding mixture between [32P]-labeled nucleotide and GST-LEDGFnd incubated at 4°C for 2 h. Ab to LEDGF (0.1 ml of serum) waseutralized with 10 mg of purified GST-LEDGF (Singh et al., 2000)

or 12 h at 4°C and supernatant following centrifugation was used.equences used for unrelated competitor probe (chicken COUP-TF)

s described in elsewhere (41).

Construction of Hsp27-CAT and aB-crystallin-CAT and transfec-ion. The 59-flanking region of the human gene (EcoR1 and EcoR1)as isolated by genomic-PCR kit (Clontech; Palo Alto, CA) using

pecific Hsp27 primers. Forward primer with Sac site (59-CGTCGAGCTCTCGAATTCATTTGCTT-39) and reverse primerith Xho1 site (59-GCTCTCGAGGTCTGCTCAGAAAAGTGC-39)ere used to generate the fragment and cloned between the EcoR1

ites of TA vector (Invitrogen Corp., Carlsbad, CA). Fragment be-ween EcoRI and XhoI sites of construct was used for DNase Ioot-printing probe.

Similarly a fragment (EcoR1 and EcoR1) of the 59-flanking regionf human aB-crystallin promoter (a gift from Dr. Piatigorsky, NEI,IH) was prepared using specific primers. Forward primer havingacI site (59-CTCTCTTCCAAGAGCTCACAAAG-39) and reverserimer having XhoI site (59-ATGGTGGCTACTCGAGAGTGA-39)ere used to generate the above fragment and cloned between EcoR1

ites of TA vector. For foot printing, this fragment was endlabeledith [g-32;P]-ATP and further digested with BanI enzyme to make it37 bp (2465 to 2239).Above mentioned, Hsp27-TA construct was digested with SacI and

hoI (2214 to 121) and the promoter fragment was ligated into

pCAT Basic vector (Promega, Madison, WI). Similarly, aB-crystallinclCCc3tupp7pft

tktaTGGAPs

fEBln3tamRwb

(C(AplepCpe

R

I

waTfilc

plasmid from 46 individual clones were determined. AllosBs

C

fiALaHGDeHsuwLn

npbtbAerTe

tap(otwbc

iknkLLoast


onstruct was digested with Sac1 and Xho1 (2448 to 1 31) andigated to pCAT basic vector. CAT assay was carried out usingAT-ELISA (Roche Diagnostics GmbH, Mannheim, Germany).os-7 and lens epithelial cells were cultured at a density of 5 3 105

ells in 5 ml DMEM containing 10% serum per 60-mm petri dish at7°C in an incubator containing 5% CO2. Twenty-four hours later,he cells were washed with the same medium and cotransfectedsing the calcium phosphate method with 3 constructs; (i) 5 mg ofEGFP-LEDGF expression vector, (ii) 10 mg of promoter/CAT re-orter construct and (iii) 5 mg of pSV-b-galactosidase vector. After2 h of incubation, cells extract was prepared. CAT-ELISA waserformed following the company’s protocol. The OD405 nm was usedor a microtiter plate ELISA reader. All CAT values were normalizedo b-galactosidase activity (Kimura et al., 2000).

Site-directed mutagenesis (SDM). PCR based site-directed mu-agenesis was performed using QuickchangeSite-Directed Mutagenesisit (Stratagene) following the company’s instruction manual. Briefly,he double-stranded Hsp27-CAT construct was used as a template DNAnd two pair of complementary primers: M-1, (59-CTTACCGAG-TAATTAACCAGATGAGGGCTG-39), 59-GAATGGCTCAATTAATT-GTCTACTCCCGAC-39 and M-2, (59-AGTGCATGGTGATGTGCG-CCGTCAAACGGGTCA-39), 59-TCACGTACCACTACACGCCGGC-GTTTGCCCAGT-39 were used to construct mutated Hsp27-CAT byCR. The plasmid was amplified, and the mutation was confirmed byequencing.

DNase 1-footprinting analysis. DNase I footprinting was per-ormed as described by Sambrook et al. (36). Briefly, the 59-labeledcoR1–XhoI (224 bp) fragment for Hsp27 and the 59-labeled EcoR1–amI fragment (237 bp) for aB-crystallin were prepared. The radio

abeled fragment (30,000 dpm) was incubated with BSA, 10, and 100g/ml of GST-LEDGF in a volume of 50 ml of binding buffer (36) for0 min at room temperature. The protein-DNA complexes werereated with 0.33 U (final concentration) of DNase I for 1 to 5 min.nd the reaction was stopped by addition of 140 ml of stop buffer (768M sodium acetate, 128 mM EDTA, 0.56% SDS and 256 mg/ml yeastNA) followed by phenol and ethanol precipitation. The samplesere applied on 8% polyacrylamide gel containing 7 M urea followedy autoradiogram of the dried gel.

RT-PCR. To perform RT-PCR, we synthesized a pair of sense59-ATGACCGAGCGCCGCGTCCCC-39) and antisense (59-AGG-ACAGCCAGTGGCGGCA-39) for Hsp27-specific primers and sense

59-ATGGACATCGCCATCCACCA-39) and antisense (59-GCA-TTCAAGAAAGGGCATC-39) for aB-crystallin specific primers. Toerform RT-PCR, mRNA was isolated from transiently transfectedens epithelial cells (5 3 105) with pEGFP-LEDGF and pEGFPmpty vector using Micro-Fast Track kit following the company’srotocol (Invitrogen, Carlsbad, CA). Micro-Fast Track 2 (Invitrogen,arlsbad, CA), a cDNA synthesis kit for RT-PCR was used as tem-late for amplification of the transcript using above mentioned prim-rs (35).

ESULTS

solation and Sequence Determination of LEDGFBinding DNA

To study whether LEDGF is a DNA binding protein,e isolated DNA fragments that bound to LEDGF withffinity chromatography (see Materials and Methods).he bound oligonucleotides (oligos) were eluted, ampli-ed with the polymerase chain reaction (PCR) and

igated into Bluescript plasmid vector. Individuallones were isolated, and the DNA sequences in the

945

f these sequences were shown by transcription factorearch (TFSEARCH), a computer program in Gen-ank, to be highly homologous to promoter elements oftress-related genes.

onfirmation of GST-LEDGF Binding to the OligosEluted from the Affinity Column

We next confirmed whether oligos isolated from af-nity column chromatography bound to GST-LEDGF.mixture of double-stranded 12-mer oligos and GST-

EDGF were subjected to electrophoretic mobility shiftssay (EMSA). We selected randomly 7 oligos (Hs1,s2, Hs3, Hs4, Hs5, Hs6, and Hs7) that had eitherAA or AGG sequences. An intense band indicating aNA-GST-LEDGF complex (Cm1) was formed withach 12-mer-nucleotide probe (Fig. 1A, probes Hs1–s7). The intensity of the Cm1 band was reduced

lightly under a 10–100 and eliminated completelynder 1000-fold molar excess of cold self-competitoras added (Fig. 1A). These results showed thatEDGF bound to DNA sequences containing eitherGAAn or nAGGn.To further confirm importance of these nGAAn and

AGGn sequences, we altered nucleotides of the Hs1robe as shown (Fig. 1B, M1–M6). The probe Hs1ound strongly to GST-LEDGF. An alteration of GAAo AAA, ACA or GCA resulted in significant loss ofinding affinity (see Fig. 1B, M1–M3). Alteration ofGG to AGA, or AAT further loss of the affinity. Inter-stingly, alteration of GAA to TAA and AGG to AATesulted in total loss of binding affinity (Fig. 1B, M6).hese results suggest that nGAAn and nAGGn aressential nucleotides for LEDGF binding.To establish that these oligos bound specifically to

he LEDGF, a supershift assay was conducted with anntibody (Ab) to LEDGF (29). Initially, mixtures ofurified GST-LEDGF and each of the 12-mer oligosHs1, Hs3 and Hs6) were prepared, gel electrophoresisf each mixture resulted in a Cm1 band. To each mix-ure, an anti-LEDGF Ab was added and the Cm1 bandas shifted to the position of a larger complex (Ss1)and (Fig. 2A). These results indicated that the Abonjugated with LEDGF in the Cm1 complexes.Since the fusion protein, GST-LEDGF, was made

n a prokaryotic expression system, we wanted tonow whether native LEDGF presents in HeLa celluclear extracts also bound to the 12-mer oligos. Wenow that HeLa cell nuclear extract containsEDGF, since a protein blot analysis with an anti-EDGF Ab was positive (data not shown). A mixturef the Hs1 and the HeLa cell nuclear extract gener-ted a Cm1 band as shown (Fig. 2B, lane 2). Super-hift assay with anti-LEDGF Ab in combination withhe EMSA showed that the Cm1 band was shifted to

taL

bnH

a1w1oi


he position of the Ss1 band (Fig. 2B, lane 3). Thenti-LEDGF Ab neutralized with purified GST-EDGF reduced significantly the intensity of the Ss1

FIG. 1. LEDGF bound to12-mer oligos having nGAAn or nAGGnnd radiolabeled probe Hs6 (lanes 1–4), Hs1 (lanes 5 and 6), Hs2 (la3 and 14), or Hs3 (lanes 15 and 16). LEDGF and 12-mer oligos formas inhibited by addition of cold self-competitor (lane 1, none, lane 26, 1000-fold excess). Bold letter with underline in the DNA sequenf homology to the HSFs binding site. (B) EMSA assays were conductn these oligos were altered. 1 and 2 indicate the absence and pres

946

and (Fig. 2B, lane 4). These results indicate thatative LEDGF in the HeLa cells also bound to thes1 oligos.

uences. (A) The EMSA assays were conducted with 1 mg of LEDGFs 7 and 8), Hs5 (lanes 9 and 10), Hs4 (lanes 11 and 12), Hs7 (lanes

specific LEDGF-DNA complex band (Cm1). The complex formation-fold excess, lane 3, 100-fold excess, and lanes 4, 6, 8, 10, 12, 14, andndicates conserved sequence. TFSEARCH-score represents percentith radiolabeled 12-mer oligo probes. The consensus core sequences

e of self-competitor (1000-fold excess).

seqne

ed a, 10ce ied wenc

Alignment of Isolated Oligos for Determination

uMwpwswGAbscgb

soGwsa

S

sq2ACttMb

pApbApp

sf(

nsrwitcetsnew

bnSm


947

of the Consensus Recognition Sequence

To search the consensus sequences in the 46 individ-al oligos, Weight Matrix or Nucleotide Distributionatrix Program in the Genomic computer programas used and the resultant consensus sequences areresented in Table 1. We have designated the oligoith the highest probability score as the primary con-

ensus sequence and this resulted in a 20-bp sequenceith a core motif or optimal binding site, nAGGG-AGGn, in the primary consensus sequence. Here,GGGGA is known to be a STRE that can be generatedy an inverted repeat of AGG. An alternative con-ensus sequence is nAGGANAGGn (N can be any nu-leotides). We used these consensus sequences as auide to define further DNA sequences of the LEDGFinding.We demonstrated that LEDGF bound to these con-

ensus sequences using the EMSA. A double-strandedligo fragment containing a consensus CTCCGAGGG-AGGCGAAGGT or CTGATAGGAAAGGCGAAGGTas indeed bound strongly to LEDGF (data not

hown). The complex Cm1 band was eliminated by theddition of 1000 molar excess of cold self-competitor.

equence Specificity of LEDGF Binding Elements

We tried to define binding specificity these key consen-us sequences more precisely by altering the DNA se-uences in those double strand oligos. We prepared1-mer nucleotides (CTCCGAGGGGAGTCGATCGTT:S1 probe) similar to the consensus sequence (CTC-GAGGGGAGGCGAAGGT). The AS1 probe bound well

o LEDGF. Then we altered the consensus sequence inhe center of oligos. Results showed that probes M1 and2 bound well, but probes M3, M4, M5, M6, and M7

ound weakly (Fig. 3A).To define further the consensus core sequence, we

repared AAATATTAGGG GATTTTTTTAT, (probeS2) (Fig. 3B). The AS2 probe bound well, and also therobes containing TGGGGT, AGGGGA, and TGGGGAound well (M 1-3). The probes containing AGGGAA,GGAAA and AGAA bound less strongly than formerrobes (Fig. 3B). AAAAAA, (M7) lost binding com-letely (Fig. 3B, lane 8).Taken together, these results indicate that one con-

ensus core sequence (AGG) in the oligos is sufficientor binding LEDGF but two consensus core sequencesAGGGGA) bound strongly.

and shifted to a higher molecular weight (Ss1). Addition of Abeutralized with purified GST-LEDGF reduced the intensity of thes1 band significantly. Addition of cold self-competitor at 1000-foldolar excess (lane 1) eliminated the specific Cm1 band.

FIG. 2. Purified GST-LEDGF and native LEDGF from HeLa celluclear extract bound to12-mer oligos having nGAAn or nAGGnequence. (A) EMSAs and supershift assay were performed withadiolabeled Hs1 (lanes 1–4), Hs6 (lanes 5–8), and Hs3 (lanes 9–12)ith a fusion protein, GST-LEDGF. When LEDGF-specific antibod-

es were added to the GST-LEDGF-DNA mixture (lanes 3, 7, and 11),he Cm1 band shifted to a higher molecular weight (Ss1). Addition ofold self-competitor at 1000-fold molar excess (lanes, 2, 6, and 10)liminated the specific Cm1 band but unrelated probe did not affecthe formation of the Cm1 band (lanes 4, 8, and 12). (B) EMSA andupershift assay were performed with probe Hs1 with HeLa celluclear extract (5 mg). A probe (Hs1) and the HeLa cell nuclearxtract formed a Cm1 band and then LEDGF-specific antibodiesere added to the EMSA reactions (lane 3), the majority of the Cm1

cwsAc


FIG. 3. Sequence specificity of LEDGF binding site. EMSA was performed using radiolabeled oligos and GST-LEDGF and the resultingomplex (Cm1) band was detected on the autoradiogram. DNA sequence and name of each probe are shown in the left margin. Bold letterith underline indicates the consensus sequences and altered sequences. (A) Radiolabeled 21-mer oligos with altered consensus core

equences. LEDGF bound to all the probes having a single consensus core sequence. The strongest binding was observed in the oligos having/TGGGGT/A. The consensus core devoid of A or G reduced binding significantly. (B) Radiolabeled consensus 21-mer oligos with alteredonsensus core sequences. Since these probes have the nonrandom 59- and 39-flanking sequence (A or T), complex band (Cm1) was observed

948

D

aD

was prepared from 2214 to 121 bp of the humanHiLP2pstt

tDttaqtr

ttLHGToC3DHmTtm

T

sHcgslmpM

TABLE 1

11111111112222

C

psir

i(ab


Nase I Footprinting Shows That LEDGF Protectsthe Consensus STRE and HSE in the Promotersof Hsp27 and aB-Crystallin Genes

To ascertain if LEDGF bound to the consensus HSEnd STRE in the Hsp27 promoter. To do this, we usedNase I foot printing analyses. A DNA probe (234 bp)

Aligned Sequences of LEDGF Binding Oligos Isolatedthrough LEDGF-CNBr Sepharose 4B Column

1 -TCGGCGCGGAAT------- 24 CGGTGAGGGCCA--------2 -TCGGCGCGGAAT------- 25 -GCAGAGGGTCAG-------3 GTCCACTCGGAT-------- 26 ---TGGTGCGCTTTG-----4 GTCTAAGCGTAT-------- 27 --CCGTGGCCCTTT------5 -TGCTAGCTGTTT------- 28 ----GGGGCTCTCGGG----6 -TGCCAGCGTATG------- 29 -TTCTACTGACGT-------7 -TTCGTGGTCAGG------- 30 -TTCTACTGACGT-------8 -TTCGTGGTCAGG------- 31 ----GATGAACGGCGA----9 TTGCGTGGTGAA-------- 32 ----GATGAACGGCGA----0 -TGCCAGGTAAGC------- 33 -----ACGAGAGGCGCC---1 ----GAGGTAATGTTA---- 34 ---TGTGGGTAGGCG-----2 ----GGATGGAGTACA---- 35 ---TGAGGCCAGACC-----3 ----GGATGGAGTACA---- 36 ---CGTTATGTGGCG-----4 CAGAGGAGGGAG-------- 37 ---ATTCAGGCGGCG-----5 CAGAGGAGGGAG-------- 38 ----TTCATGAAGCAG----6 CCCATAGGGGAG-------- 39 ------TATCCCGCGACC--7 CCCATAGGGGAG-------- 40 ------TTACCGGTGGGC--8 CCCATAGGGGAG-------- 41 --------CTGATTATTCGT9 CCCATAGGGGAG-------- 42 --------CTGATTATTCGT0 -----AAGTCAGTTGAT--- 43 -------GTGCATTGGTCG-1 -----AAGTCAGTTGAT--- 44 ------TATATGTTACAA--2 ---GAATGGGAGTAG----- 45 -------TGTTTTCGCAAG-3 ---GAATGGGAGTAG----- 46 -------TGTTTTCGCAAG-

Sequence Conservation among 46 Clones Selectedfor LEDGF Binding

Position 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

A 0 2 0 8 4 21 6 5 13 8 26 9 1 4 4 8 5 3 0 0C 7 4 10 11 2 3 5 6 6 8 3 1 2 11 2 4 2 0 0 0G 2 2 7 4 19 6 20 26 23 21 12 26 19 1 17 3 1 5 5 0T 1 12 4 5 9 8 9 6 4 8 5 9 14 9 1 2 3 0 0 2SUM 10 20 21 28 34 38 40 43 46 45 46 45 36 25 24 17 11 8 5 2

Consensus Sequence

C C G G G A GG C A GT - - - A G G - - - - - - G A - - G T

G A T A H G WT T

Note. The number of clones containing either A, C, G, or T at eachosition is presented. Sequences are aligned and position 1 repre-ents the first conserved nucleotide within the clones. Bold letterndicates the consensus sequences. H and W indicate ACG and AT,espectively.

n the probe having the consensus core sequence in the center of oligoM7, lane 8). (C) Radiolabeled 21-mer oligos; a probe (WT) obtained frnd 2173), and two mutant probes (Mut1 and Mut2) with mutatedound to LEDGF (lane 1) but did not bind to Mut1 and Mut2 (lanes

949

sp27 gene. The radio labeled probe (30,000 dpm) wasncubated with BSA (0), 10, and 100 ng/ml of GST-EDGF; then the mixtures were treated with DNase 1.rotection of two regions between 2114 and 2104 and188 and 2176 were apparent in Figs. 4A and 4B. Onerotected site contained TGGGGA, that is the sameequence the STRE and the other protected site con-ains GAAGGTTC that is an identical sequence withhe HSE.

Similarly, we investigated whether LEDGF boundo HSE and STRE of the aB-crystallin promoter.Nase I footprinting analyses showed that two dis-

inct regions of the aB-crystallin promoter were pro-ected; they were located between 2370 and 2360nd 2414 and 2401 as shown (Fig. 4C). These se-uences correspond to AAGGGGA and GAAGATTChat are identical with the STRE and HSE (nGAAn),espectively.DNase I footprinting indicated that LEDGF bound

o the promoter region of HSE located between 2188o 2176 of Hsp27 promoter. To ascertain further,EDGF bound to the HSE (nGAAnnTTCn) in thesp27 promoter, we prepared a fragment, TTAAC-AG AGAAGGTTCCCAGA, a mutant fragmentTAACTATATAATTTTACAAA (Mut 1), and an-ther mutant having TTAACGAATTTTTTAC-CAGA (Mut 2) in the HSE were synthesized (Fig.C). The EMSA analyses between LEDGF and eachNA fragment indicated that LEDGF bound to thesp27 fragment (WT) but did not bind these twoutant fragments (Mut 1 and Mut 2) (Fig. 3C).hese results further confirmed that LEDGF boundo HSEs (nGAAn or nGAAnnTTCn) in Hsp27 pro-oter.

ransactivation of Hsp27 and aB-CrystallinPromoters by LEDGF

To investigate whether LEDGF activated expres-ion of the Hsp27 promoter, a construct between thesp27 promoter 2214 and 121 was fused with a

hloramphenicol acetyl transferase (CAT) reporterene (Hsp27-CAT) (Fig. 5A). We transfected the con-truct into cos7 cells (Fig. 5Aa and 5Ab) and mouseens epithelial cells (Fig. 5Ac). Prior to this experi-

ents, the cos7 cells were stably transfected with alasmid construct having LEDGF (pEGFP-LEDGF).ore than a 2-fold transactivation of CAT was dem-

ligos devoid of consensus core sequence showed no LEDGF bindinghuman Hsp27 promoter having HSE (nGAAnnTTCn, between 2193cleotides at HSE and its adjacent region. Probes having HSE (WT)6).

s. Oomnu3–

otH

5tc

arso


nstrated in these stably transfected cells. We alsoransiently cotransfected the construct containingsp27-CAT and pEGFP-LEDGF into cos7 cells (Fig.

FIG. 4. DNase I footprinting of promoter regions of Hsp27 andB-crystallin promoters (C) are indicated by bars I, II, III, and IV onegions (I and II for Hsp27 and III and IV for aB-crystallin) are indiequencing reaction. The amount of GST-LEDGF, 10 ng in lane 2, 1f lanes 2–4.

950

B) and lens epithelial cells (Fig. 5Ab). A 2-foldransactivation of the CAT was generated in theseells (Fig. 5A, compare bars 1 and 3).

-Crystallin genes. Protection pattern for the Hsp27 (A and B) andright and left margins. The relevant sequences of the four protectedd in the left and right margins. Lane 1, represents G 1 A chemicalng in lanes 3 and 4; and BSA in lane 5. Lanes 5–7 in A is a repeat

aBthecate00

ps1

5B). Cos7 cells were cotransfected with the constructc(CocHp

T

pHHT(tso(rmi

Cspcvowfb

cHaLtCsHlmCt(7ewoaft


Similarly, we studied whether LEDGF activated ex-ression of a human aB-crystallin promoter. A con-truct between the aB-crystallin promoter 2448 and31 was fused with bacterial CAT reporter gene (Fig.

FIG. 5. Transactivation of human Hsp27-CAT or aB-Cry-CAT inos7 and lens epithelial cells. (A) Cos7 cells were transfected with thesp27-CAT construct. After 72 h, the CAT activity in the cells wasssayed. (a) Cos7 cells were stably transfected with a pEGFP-EDGF or empty pEGFP vector (Singh et al., 2000). (b) Cos7 cellsransiently transfected with pEGFT-LEDGF and Hsp27-CAT andAT activity was analyzed after 72 h. (c) Lens epithelial cells tran-iently transfected with pEGFT-LEDGF or pEGFP vector, andsp27-CAT and CAT activity was analyzed after 72 h. Both cos7 and

ens epithelial cells transfected with the Hsp27-CAT expressed CATore than twofold in comparison to transfected pEGFP vector. (B)os7 cells were transfected with aB-Cry-CAT construct. Prior to

ransfection of aB-Cry-CAT, the cells were stably (a) or transientlyb) transfected with pEGFP-LEDGF or pEGFP empty vector. After2 h from transfection, the CAT value was assayed. To normalize thefficiency of transfection, all cells were transfected simultaneouslyith a plasmid containing the b-galactosidase gene under the controlf the SV40 promoter (pSVb-Gal) and normalized with the samemount of b-galactosidase activity. CAT value in cos7 cells trans-ected with aB-Cry-CAT expressed CAT-value more than twofoldhat transfected pGFP vector.

951

ontaining the aB-crystallin promoter and a CAT geneaB-Cry-CAT). More than a 2-fold transactivation ofAT was produced by stable and transient transfectionf LEDGF into cos7 cells (Fig. 5B). These results indi-ated that LEDGF bound to HSE and STRE in thesp27 and aB-crystallin promoters and activated ex-ression of the CAT gene.

ransactivation by LEDGF Is Downregulated byMutations in HSE or STRE of the hsp27 Promoter

To prove further that transactivation of the Hsp27romoter is due to interactions between LEDGF andSE or STRE and not other transcriptional factors,SE and STRE were mutated from AGAAGGTTC toTAATTAAC, and AGGGGA to ATTTTA as shown

Fig. 6A) using site-directed mutagenesis. In vitroransactivation of a mutant construct in HSE (M1)howed 60% reduction in CAT value compared to thatf the wild type in cos7 cells over expressing LEDGFFig. 6B). Mutation in M1 and M2 lost 60% and 20%,espectively, suggests that each consensus elementay have different transactivation potency. Mutations

n both M1 1 M2 lost 80% of transactivation but re-

FIG. 6. Mutant constructs of Hsp27-CAT showed reduction ofAT value in cos7 cells. (A) Schematic drawing showed the con-tructs between Hsp27 promoter and CAT and two mutant Hsp27romoters in M1 or M1 1 M2 and CAT. (B) Prior to the experiments,os7 cells were stably transfected with pEGST-LEDGF or pEGFPector. The cells were transfected with Hsp27-CAT, Hsp27-M1-CAT,r Hsp27-M1 1 M2-CAT or plasmid empty vector and CAT activityas analyzed after 72 h as described above. All cells were cotrans-

ected with pSVb-Gal and normalized with the amount of-galactosidase.

tLti

A

rltnadtwNet

D

bHsbsvGDbp

ss

expression of HSFs that trimerize and bind directly toHca(SmufimdhtM(pL

tabtizaiDA

rdlHaBmpap

sgHitstHmtisdcbi

PplaRvasa


ained 20%. These results suggest that some eclipticEDGF-dependent elements in the Hsp27 promoterhat might be activated and responsible for the remain-ng of 20% in the cos7 cells.

ctivation of Stress-Related Genes

To ascertain whether LEDGF activated the stress-elated genes, we extracted mRNAs from lens epithe-ial cells stably transfected with pEGFP-LEDGF, con-rol lens epithelial cells with empty pEGFP vector, andormal epithelial cells. The amount of mRNA of Hsp27,B-crystallin, antioxidant protein 2, and alcohol dehy-rogenase was quantified by semiquantitative reverseranscription-polymerase chain reaction (RT-PCR)ith appropriate probes. Although, we found that mR-As of all genes mentioned above are elevated in lens

pithelial cells overexpressing LEDGF, we presentedhe results of Hsp27 and aB-crystallin (Fig. 7).

ISCUSSION

In the present study, we have shown that LEDGFound to HSE and STRE to activate promoters ofsp27 and aB-crystallin genes. It is evident from our

tudies that consensus core sequences for LEDGFinding were defined as nGAAn and nAGGn. One con-ensus core was sufficient for binding to LEDGF in initro experiments, but if two consensus cores (nGAAG-TTCn and nAGGGGAn) were present, the LEDGF-NA binding affinity was stronger. The interaction(s)etween LEDGF and HSE or STRE transactivated theromoters of Hsp27 and aB-crystallin.HSE and STRE, activated by a broad spectrum of

tress conditions, are found in promoters of manytress-related genes. Heat shock signals initiate the

FIG. 7. Reverse transcription-polymerase chain reaction (RT-CR) of mRNAs from lens epithelial cells stably transfected withEGFP-LEDGF or empty pEGFP-vector. Messenger RNAs were iso-ated from cells transfected with pEGFP-LEDGF (lanes 2, 4, and 6)nd cells transfected empty pEGFP vector (lanes 1, 3, and 5) andT-PCR experiment was conducted. Cells transfected empty pEGFPector and RT-PCR was carried out using specific primers of Hsp27nd aB-crystallin. The resulted cDNA bands were visualized by EtBrtaining. We obtained consistent results with antioxidant protein 2nd alcohol dehydrogenase.

952

SE to stimulate expression of Hsps (see 3, 6). Theonsensus HSE is initially defined as nGAAnnTTCnnd later re-defined as repeating 5-base pair motifsnGAAn, so-called “GAA boxes”) (9, 10). In yeast,chuller et al. (14) summarized that upstream ele-ents of stress-related genes (STRE) are also activated

nder heat-stress and the consensus sequence is de-ned as T/AGGGGA. These elements are found in pro-oters of stress-related genes in yeast and bacteria as

escribed in the introduction. The sequence AGGGGAas been demonstrated to be sufficient for the activa-ion of reporter genes by heat-stress (25). Although,sn2p and Msnp4 are known to be activators for STRE

15, 26), other unidentified activator(s) are predicted tolay on STRE (15). We believe that one of them may beEDGF.Our studies demonstrated that LEDGF recognized

wo distinct elements and the consensus core elementsre GAA and AGG. LEDGF may be a bipartite DNA-inding protein. Sequence studies of LEDGF showedhat it has at least three, helix-turn-helix, DNA bind-ng sites. Bipartite DNA binding was reported in manyinc finger binding proteins: MZF1 (42), NGF1-A (43),nd ZFP95 (44). Furthermore, our preliminary studyndicated that one of the helix-turn-helix (a potentialNA binding motif) in LEDGF bound exclusively toGG sequence.Our RT-PCR studies indicated that multiple stress-

elated proteins such as antioxidant protein 2, alcoholehydrogenase, Hsp27, and aB-crystallin are stimu-ated by LEDGF, and others and we found that theSE and STRE are present in promoters of all ofbove-mentioned genes (sequence search in the Gen-ank). The promoter of alcohol dehydrogenase hasore than one dozen of HSEs (45). The antioxidant

rotein-2 gene that is induced by osmotic-stress (46)lso contains the STRE in the regulatory region of itsromoter (47).Products of these genes have been shown to induce

tress resistance. Recently, several independentroups have identified HSPs, Hsp27, aB-crystallin andsp70, that exert a direct, but in this case negative

nfluence on apoptosis signaling. Interestingly, al-hough both Hsps promote the inhibition of apopto-ome function, they independently target different pro-eins. The report by Bruey et al. (48) showed thatsp27 binds to cytochrome c upon its release from theitochondrion, thus preventing a productive interac-

ion with Apaf-1. In a complementary series of exper-ments, Beer et al. (49) and Shaleh et al. (50) havehown that Hsp70 inhibits an apoptosis by bindingirectly to Apaf-1, thereby precluding the eventual re-ruitment of precaspase-9 to the apoptosome. A papery Li et al. (51) similarly supports there finding regard-ng Hsp70, demonstrating that it exerts its inhibitory

effect down stream of the release of cytochrome c anduKpciHpacdbotaoprrss

aaLideilemeHig

s(scsamimromt

psL(S

stress conditions, and they are found in promoters ofmdaut

ptmma

A

a

R

1

1

1

1

1


pstream of the activation of caspase-3. The report byamradt et al. (52) showed that aB-crystallin binds to24 upon its clave from procaspase-3. The p24 is auto-laved into active caspase (p20) and p17, thus prevent-ng a productive the autoproteolysis of p24. In addition,sp10 and Hsp60 are also known to interact withrocaspase-3 (53). These results indicate that Hsps arenti-apoptotic proteins and inhibits activationaspases-3 and exerts antiapoptotic effects. Antioxi-ant protein-2 (54) and glutathione peroxidase areoth important proteins in the cellular resistance toxidative stress (55). Alcohol dehydrogenase catalyzeshe reduction of acetaldehyde to ethanol by NADH (56),nd it may reduce aldehydes produced by thexidative-stress in mammalian cells. Individual stressrotein may contribute a little to counteract aldehyde-elated stress, but the collective expression of stress-elated proteins induced by LEDGF, may contributetrong resistance to aldehyde and other oxidativetresses.Expression of Hsps at physiological condition is not

ctivated since there is no trimolecule of HSFs is avail-ble to HSE in the Hsp promoter (7). In contrast,EDGF is present in the nucleus under normal phys-

ological condition and available to HSE (29, 33). Un-er the heat stress, both LEDGF (35) and HSF (7) arelevated in various cell types. We speculate that bind-ng between LEDGF and HSE may stimulate a lowerevel of expression of Hsps at normal physiologicalnvironment, and under heat-stress, trimeric HSFsay bind to the HSE, this binding might induce an

levated level of expression of Hsps. How LEDGF andSF interact to the HSE (cooperative or independent

nteraction) facing a stress is currently under investi-ation in our laboratory.LEDGF has been shown to be a novel general tran-

cription coactivator that interacts with the VP16Greenblatt and Ingles, 1996) activation domain andeveral components of the general transcriptional ma-hinery (57). It joins other coactivators, general tran-criptional factors, and RNA polymerase II to mediateccurate transcription through the common core pro-oter element (TATA box). In contrast, our results

ndicate that LEDGF binds to specific up-stream pro-oter elements and enhances transcription of stress-

elated genes. Thus, LEDGF belongs to another classf transcriptional activators that bind to DNA ele-ents distal to the TATA box and is able to regulate

he sequence specific transcription (58, 59).We provide evidence that LEDGF induces “cross-

rotection” in cos7 cells and lens epithelial cells undertress. The following evidence supports this notion: 1)EDGF binds to STRE (nA/TGGGGA/Tn) and HSE

nGAAn) and activates Hsp27 and aB-crystallin. 2)TRE and HSE are activated by a broad spectrum of

953

any stress related genes. 3) Our RT-PCR results in-icated that at least four stress-related genes werectivated in the cells over-expressing LEDGF. 4) Prod-cts of stress-related genes have been shown to con-ribute in the stress resistance.

We propose that cross-protection against stress isresent in the mammalian cells and not only confinedo microorganisms such as yeast (14). Although mam-alian cells live in a constant environment, the basicechanisms of cross-protection in both prokaryotic

nd eukaryotic cells must be similar.

CKNOWLEDGMENT

We are grateful to Dr. Harold White for many helpful discussionnd critical comments on the manuscript.

EFERENCES

1. Ruis, H., and Schuller, C. (1995) Stress signaling in yeast.BioEssays 17, 959–965.

2. Hohmann, S., and Mager, W. H. (Eds.) (1997) Yeast Stress Re-sponses, pp. 101–134. R. G. Landes Co., Austin, TX.

3. Craig, E. A. (1992) in The Molecular and Cellular Biology of theYeast Saccharomyces cerevisiae Gene Regulation (Jones, E. W.,Pringle, J. R., and Broach, J. R., Eds.), pp. 501–537. Cold SpringHarbor Laboratory Press, Cold Spring Harbor, NY.

4. Mager, W. H., and Moradas-Ferreira, P. (1993) Osmostress re-sponse of the yeast. Biochem. J. 290, 1–13.

5. Parsell, D. A., and Lindquist, S. (1994) Heat shock proteins andstress tolerance. In The Biology of Heat Shock Proteins andMolecular Chaperones (Morimoto, R. I., Tissieres, A., and Geor-gopoulos, C., Eds.), pp. 457–494. Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, NY.

6. Wu, C. (1995) Heat shock transcription factors: Structure andregulation. Annu. Rev. Cell Dev. 11, 441–469.

7. Sorger, P. K. (1990) Yeast heat shock factor contains separabletransient and sustained response transcriptional activators. Cell62, 793–805.

8. Sorger, P. K. (1991) Heat shock factor and the heat shock re-sponse. Cell 65, 363–366.

9. Xiao, H., and Lis, J. T. (1988) Germline transformation used todefine key features of heat-shock response elements. Science239, 1139–1142.

0. Amin, J., Ananthan, J., and Voellmy, R. (1988) Key features ofheat shock regulatory elements. Mol. Cell Biol. 9, 3761–3769.

1. Pringle, J. R., and Hartwell, L. H. (1981) in The MolecularBiology of the Yeast Saccharomyces: Life Cycle and Inheritance(Strathern, J. N., Jones, E. W., and Broach, J. R., Eds.), pp.97–142. Cold Spring Harbor Laboratory Press, Cold Spring Har-bor, NY.

2. Cheng, L., and Piper, P. W. (1994) Weak acid preservatives blockthe heat shock response and heat-shock-element-directed lacZexpression of low pH Saccharomyces cerevisiae cultures, an in-hibitory action partially relieved by respiratory deficiency. Mi-crobiology 140, 1085–1096.

3. Varela, J. C., van Beekvelt, C., Planta, R. J., and Mager, W. H.(1992) Osmostress-induced changes in yeast gene expression.Mol. Microbial. 15, 2183–2190.

4. Schuller, C., Brewster, J. L., Alexander, M. R., Gustin, M. C.,

and Ruis, H. (1994) The Hog pathway controls osmotic regula-

1

1

1

1

1

2

2

2

2

2

2

2

2

2

2

3

epithelium-derived growth factor: Effects on growth and survival

3

3

3

3

3

3

3

3

3

3

4

4

4

4

4

4


tion of transcription via the stress response element (STRE) ofthe Saccharomyces cerevisiae CTT1 gene. EMBO J. 18, 4382–4389.

5. Martinez-Pastor, M., Marchler, G., Schuller, C., Marchler, BA.,Ruis, H., and Estruch F. (1996) The Saccharomyces cerevisiaezinc finger proteins Msn2p and Msn4p are required for tran-scriptional induction through the stress response element(STRE). EMBO J. 15, 2227–2235.

6. Schmitt, A., and McEntee, K. (1996) Msn2p, a zinc finger DNA-binding protein, is the transcriptional activator of the multi-stress response in Saccharomyces cerevisiae. Proc. Natl. Acad.Sci. USA 93, 5777–5782.

7. Gorner, W., Durchschchlag, E., Martinez-Paster, M. T., Estruch,F., Ammerer, G., Hamilton, et al. (1998) Nuclear localization ofthe C2H2 zinc finger protein Msn2p is regulated by stress andprotein kinase activity. Gene Dev. 12, 596–597.

8. Hartig, A., and Ruis, H. (1986) Nucleotide sequence of the Sac-charomyces cerevisiae CTT1 gene and deduced amino acid se-quence of yeast catalase T. Eur. J. Biochem. 160, 487–490.

9. Wieser, R., Adam, G., Wagner, A., Schuller, C., Marchler, G.,Ruis, H., Krawiec, Z., and Bilinski, T. (1991) Heat shock factor-independent control of transcription of the CTT1 gene encodingthe cytosolic catalase T of Saccharomyces cerevisiae. J. Biol.Chem. 266, 12406–12411.

0. Kobayashi, N., and McEntee, K. (1993) Identification of cis andtrans components of a novel heat shock stress regulatory path-way in Saccharomyces cerevisiae. Mol. Cell Biol. 13, 248–256.

1. Francois, J. M., Thompson-Jaeger, S., Skroch, J., Zellenka, U.,Spevak, W., and Tatchell, K., (1992) GAC1 may encode a regu-latory subunit for protein phosphatase type 1 in Saccharomycescerevisiae. EMBO J. 11, 87–96.

2. Petko, L., and Lindquist, S. (1986) Hsp26 is not required forgrowth at high temperature, nor for thermo tolerance, sporedevelopment, or germination. Cell 45, 885–894.

3. Praekelt, U. M., and Meacock, P. A. (1990) HSP12, a new smallheat shock gene of Saccharomyces cerevisiae: Analysis of struc-ture, regulation and function. Mol. Gen. Genet. 223, 97–106.

4. Ozkaynak, E., Finley, D., Solomon, M. J., and Varshavsky, A.(1987) The yeast ubiquitin genes: A family of natural gene fu-sions. EMBO J. 5, 1429–1439.

5. Marchler, G., Schuller, C., Adam, G., and Ruis, H. (1993) ASaccharomyces cerevisiae UAS element controlled by proteinkinase A activates transcription in response to a variety of stressconditions. EMBO J. 12, 1997–2003.

6. Estruch, F., and Carlson, M. (1993) Two homologous zinc fingergenes identified by multicopy suppression in a SNF1 proteinkinase mutant of Saccharomyces cerevisiae. Mol. Cell Biol. 13,3872–3881

7. Ge, H., Si, Y., and Wolffe, A. P. (1998) A novel transcriptionalcoactivator, p52, functionally interacts with the essential splic-ing factor ASF/SF2. Mol. Cell 2, 751–59.

8. Singh, D. P., Kimura, A., Chylack, L. T., Jr., and Shinohara, T.(2000) Lens epithelium-derived growth factor (LEDGF/p75) andp52 are derived from a single gene by alternative splicing. Gene242, 265–273.

9. Singh, D. P., Ohguro, N., Chylack, L. T., Jr., and Shinohara, T.(1999) Lens epithelium-derived growth factor (LEDGF) in lensepithelial cells stimulates the expression of small heat shockprotein 27 and aB-crystallin and confers resistance to thermaland oxidative stress. Invest Ophthalmol. Vis. Sci. 40, 1444–1451.

0. Singh, D. P., Ohguro, N., Kikuchi, T., Sueno, T., Reddy, V. N.,Yuge, K., Chylack, L. T., Jr., and Shinohara, T. (2000) Lens

954

of lens epithelial cells, keratinocytes, and fibroblasts. Biochem.Biophys. Res. Commun. 267, 373–381.

1. Nakamura, H., Izumoto, Y., Kambe, H., Kuroda, T., Mori, T.,Kawamura, K., Yamamoto, H., and Kishimoto, T. (1994) Molec-ular cloning of complementary DNA for a novel humanhepatoma-derived growth factor. J. Biol. Chem. 269, 25143–25149.

2. Ishimoto, Y., Kuroda, T., Harada, H., Kishimoto, T., and Naka-mura, H. (1997) Hepatoma-derived growth factor belongs to agene family in mice showing significant homology in the aminoterminus. Biochem. Biophys. Res. Commun. 238, 26–32.

3. Kubo, E., Singh, D. P., Shinohara, T., and Chylack, L. T., Jr.(2001) Loss of lens epithelium-derived growth factor (LEDGF)from the nucleus in differentiating fiber cells. Submitted.

4. Greenblatt, J., and Ingles, CJ. (1996) Interaction between acidictranscriptional activation domains of herpes simplex virus acti-vator protein VP16 and transcriptional initiation factor IID.Methods Enzymol. 274, 120–133.

4. Nakamura, M., Singh, D. P., Chylack, L. T., Jr., and Shinohara,T., (2000) Lens epithelium-derived growth factor (LEDGF): Sur-vival of embryonic chick neuroretinal cells. Invest. Ophthalmol.Vis. Sci. 41, 1168–1175.

5. Sharma, P., Singh, D. P., Fatma, N., Chylack, L. T., Jr., andShinohara, T. (2000) Activation of LEDGF gene by thermal- andoxidative-stress. Biophys. Biochem. Res. Commun. 276, 1320–1324.

6. Sambrook, J., Fritsch, E. G., and Maniatis, T. (1989) MolecularCloning: A Laboratory Manual, 2nd ed. Cold Spring HarborLaboratory, Cold Spring Harbor, NY.

7. Ausubel, F. M., Brent, R. B., Kingston, R. E., Moore, D. D.,Seidman, J. G., Smith J. A., and Struhl, K. (1987) in CurrentProtocols in Molecular Biology, pp. 2, 10.1.1–10.1.3. Wiley., andNew York..

8. Bradford, M. M. (1976) A rapid sensitive method for the quan-titation of microgram quantities of protein utilizing the principleof protein–dye binding. Anal. Biochem. 72, 248–254.

9. Pollack, R., and Treisman, R. (1990) A sensitive method for thedetermination of protein–DNA binding specificities. Nucleic. Ac-ids Res. 18, 6197–6204.

0. Oliphants, A. R., Brandl, C. J., and Struhl, K. (1989) Definingthe sequence specificity of DNA-binding proteins by selectingbinding sites from random-sequence oligonucleotides: Analysisof yeast GCN4 protein. Mol. Cell Biol. 9, 2944–2949.

1. Kimura, A., Singh, D. P., Wawrousek, E. F., Kikuchi, M., Naka-mura, M., and Shinohara, T. (2000) Both PCE-1/RX and OXT/CRX interactions are necessary for photoreceptor-specific geneexpression. J. Biol. Chem. 275, 1152–1160.

2. Morris, J. F., Hromas, R., and Pauscher, F. J., III (1994) Char-acterization of the DNA-binding properties of the myeloid zincfinger protein MZF1: Two independent DNA-binding domainsrecognized two DNA consensus sequences with a common G-richcore. Mol. Cell. Biol. 14, 1786–1795.

3. Swirnoff, A. H., and Milbrandt, J. (1995) DNA-binding specificityof NGF1-A and related zinc finger transcription factors. Mol.Cell. Biol. 15, 2275–2287.

4. Dreyer, S. D., Zheng, Q., Zabel, B., Winterpacht, A., and Lee, B.(1999) Isolation, characterization, and mapping of a zinc fingergene, ZFP95, containing both a SCAN box and an alternativelyspliced KRAB A domain. Genomics 62, 119–122.

5. Hur, M. W., and Edenberg, H. J. (1995) Cell-specific function ofcis-acting elements in the regulation of human alcohol dehydro-genase 5 gene expression and effect of the 59-nontranslated re-gion. J. Biol. Chem. 270, 9002–9009.

46. Marquez, J. A., Pascual-Ahuir, A., Proft, M., and Serrano, R.

4

4

4

5

5

5

and caspase-8-dependent activation of caspase-3 by inhibiting its

5

5

5

5

5

5

5


(1998) The Ssn6-Tup1 repressor complex of Saccharomyces cer-evisiae is involved in the osmotic induction of HOG-dependentand -independent genes. EMBO J. 17, 2543–2553.

7. Phelan, S., Johnson, K. A., Beier, D. R., and Paigen, B. (1998)Characterization of the murine gene encoding Aop2 (antioxidantprotein 2) and identification of two highly related genes. Genom-ics 54, 132–139.

8. Bruey, J. M., Ducasse, C., Bonniaud, P., Ravagnan, L., Susin,S. A., Diaz-Latoud, C., Gurbuxani, S., Arrigo, A. P., Kroemer, G.,Solary, E., and Garrido, C. Hsp27 negatively regulates cell deathby interacting with cytochrome c. Nat. Cell Biol. 2, 645–652.

9. Beere, H. M., Wolf, B. B., Cain, K., Mosser, D. D., Mahboubi, A.,Kuwana, T., Railor, P., Morimoto, R. I., Cohen, G. M., and Green,D. R. (2000) Heat-shock protein 70 inhibits apoptosis by prevent-ing recruitment of procaspase-9 to the Apaf-1 apoptosome. Nat.Cell Biol. 2, 469–475.

0. Saleh, A., Srinivasula, S. M., Balkir, L., Robbins, P. D., andAlnemri, E. S. (2000) Negative regulation of the Apaf-1 apopto-some by Hsp70. Nat. Cell. Biol. 2, 476–483.

1. Li, C. Y., Lee, J. S., Ko, Y. G., Kim, J. I., and Seo, J. S. (2000)Heat-shock protein 70 inhibits apoptosis downstream of cyto-chrome c release upstream of caspase-3 activation. J. Biol.Chem. 275, 25665–25671.

2. Kamradt, M. C., Chen, F., and Cryns, V. L. (2001) The small heatshock protein aB-crystallin negative regulatoes cytochrome c-

955

autoproteolytic maturation. J. Biol. Chem. March 1st.3. Samali, A., Cai, J., Zhivotovsky, B., Jones, D. P., and Orrenius,

S. (1999) Presence of a pro-apoptotic complex of pro-caspase-3,Hsp60 and Hsp10 in the mitochondrial fraction of Jurkat cells.EMBO J. 18, 2040–2048.

4. Kang, S. W., Baines, I. C., and Rhee, S. G. (1998) Characteriza-tion of a mammalian peroxiredoxin that contains one conservedcysteine. J. Biol. Chem. 273, 6303–6311.

5. Mehlen, P., Kretz-Remy, C., Preville, X., and Arrigo, A. P. (1996)Human hsp27, Drosophila hsp27 and human alpha B-crystallinexpression-mediated increase in glutathione is essential for theprotective activity of those proteins against TNF alpha-inducedcell death. EMBO J. 15, 2695–2706.

6. Muirhead, H. (1983) Triose phosphate isomerase, pyruvate ki-nase, and other a/b-barrel enzymes. Trends Biochem. Sci. 8,326–330.

7. Ge, H., Si, Y., and Roeder, R. G. (1998) Isolation of cDNA encod-ing novel transcription co-activators p52 and p75 reveals analternate regulatory mechanism of transcriptional activation.EMBO J. 17, 6723–6729

8. Ptashne, M., and Gann, A. A. F. (1990) Activators and targets.Nature 346, 329–331.

9. Pugh, B. F. (1996) Mechanisms of transcription complex assem-bly. Curr. Opin. Cell Biol. 8, 303–311.

ledgf binds to heat shock and stress-related element to activate the expression of stress-related...

Documents