Contents lists available at ScienceDirect

Brain Research

journal homepage: www.elsevier.com/locate/brainres

Research report

Levetiracetam treatment influences blood-brain barrier failure associatedwith angiogenesis and inflammatory responses in the acute phase ofepileptogenesis in post-status epilepticus mice

Kouichi Itoha,⁎,1, Yasuhiro Ishiharab,1, Rie Komoria, Hiromi Nochic, Ruri Taniguchib,Yoichi Chibad, Masaki Uenod, Fuyuko Takata-Tsujie, Shinya Dohgue, Yasufumi Kataokae

a Laboratory for Pharmacotherapy and Experimental Neurology, Kagawa School of Pharmaceutical Sciences, Tokushima Bunri University, Kagawa 769-2193, Japanb Laboratory of Molecular Brain Science, Graduate School of Integrated Arts and Sciences, Hiroshima University, Hiroshima 739-8521, Japanc Laboratory for Pharmaceutical Health Sciences, Kagawa School of Pharmaceutical Sciences, Tokushima Bunri University, Kagawa 769-2193, Japand Department of Pathology and Host Defense, Faculty of Medicine, Kagawa University, Kagawa 761-0793, Japane Department of Pharmaceutical Care and Health Sciences, Faculty of Pharmaceutical Sciences, Fukuoka University, Fukuoka 814-0180, Japan

A R T I C L E I N F O

Keywords:LevetiracetamBlood-brain barrierEpileptogenesisMicrogliaAngiogenesisStatus epilepticus

A B S T R A C T

Our previous study showed that treatment with levetiracetam (LEV) after status epilepticus (SE) termination bydiazepam might prevent the development of spontaneous recurrent seizures via the inhibition of neurotoxicityinduced by brain edema events. In the present study, we determined the possible molecular and cellularmechanisms of LEV treatment after termination of SE. To assess the effect of LEV against the brain alterationsafter SE, we focused on blood-brain barrier (BBB) dysfunction associated with angiogenesis and braininflammation. The consecutive treatment of LEV inhibited the temporarily increased BBB leakage in thehippocampus two days after SE. At the same time point, the LEV treatment significantly inhibited the increasein the number of CD31-positive endothelial immature cells and in the expression of angiogenic factors. Thesefindings suggested that the increase in neovascularization led to an increase in BBB permeability by SE-inducedBBB failure, and these brain alterations were prevented by LEV treatment. Furthermore, in the acute phase ofthe latent period, pro-inflammatory responses for epileptogenic targets in microglia and astrocytes of thehippocampus activated, and these upregulations of pro-inflammatory-related molecules were inhibited by LEVtreatment. These findings suggest that LEV is likely involved in neuroprotection via anti-angiogenesis and anti-inflammatory activities against BBB dysfunction in the acute phase of epileptogenesis after SE.

1. Introduction

Levetiracetam (LEV) is an established second-generation anti-epileptic drug (AED) that exerts broad-spectrum anti-epileptic effectsand is widely used to treat partial onset and generalized seizures(Lyseng-Williamson, 2011). In addition, LEV is a candidate second-line AED for status epilepticus (SE) (Manno, 2011; Glauser et al.,2016) and a candidate anti-epileptogenic drug (Pearl et al., 2013;Klein, et al., 2012). One of the pharmacological mechanism unique toLEV is its ability to bind to SV2A, a protein of the synaptic vesiclecomplex, to inhibit neurotransmitter release (Lynch et al., 2004;Meehan et al., 2012). In addition, several other mechanisms of LEVhave been reported concerning the control of neurotransmitter release

(Cataldi et al., 2005; Nagarkatti et al., 2008, Rigo et al., 2002;Lukyanetz et al., 2002).

Animal studies have shown that LEV exerts anti-epileptogenic andneuroprotective effects for the treatment of a pilocarpine (PILO)-SEmodel (Mazarati et al., 2004; Zheng et al., 2010; Itoh et al., 2015).However, the findings from previous reports in other post-SE animalmodels have been conflicting regarding whether LEV can prevent ormodify epileptogenesis (Löscher et al., 1998; Glien et al., 2002;Klitgaard and Pitkanen, 2003; Stratton et al., 2003; Gibbs et al.,2006; Brandt et al., 2007). Furthermore, the mechanisms responsiblefor the anti-epileptogenic and neuroprotective effects of LEV are stillunknown.

Post-brain insult epilepsy (post-traumatic, PTE; post-stroke, PSE;

http://dx.doi.org/10.1016/j.brainres.2016.09.038Received 9 July 2016; Received in revised form 9 September 2016; Accepted 26 September 2016

⁎ Corresponding author.

1 These authors contributed equally to this work.E-mail address: itoh@kph.bunri-u.ac.jp (K. Itoh).

Brain Research 1652 (2016) 1–13

0006-8993/ © 2016 Elsevier B.V. All rights reserved.Available online 28 September 2016

crossmark

and post-SE, PSEE; etc.) accounts for approximately 20% of sympto-matic seizures and 5% of all epileptic seizures (Herman, 2002; Brodieet al., 2009). Given such prevalence, the prevention of these post-braininsult epilepsies is one of important issue. However, although 47clinical studies have examined the efficacy of conventional AEDs (e.g.phenobarbital, valproate, carbamazepine, phenytoin, lamotrigine, to-piramate), none of these drugs was able to prevent the development ofepilepsy (Temkin, 2001; 2003, 2009; Krumholz et al., 2015). Therefore,several non-AEDs, such as anti-inflammatory drugs and mTOR in-hibitors, were recently examined in basic and clinical studies to preventthese acquired epilepsies (Galanopoulou et al., 2012; Jiang et al.,2012). While LEV is an AED for managing post-brain insult epilepsies,several recent clinical studies for LEV in PTE, PSE, and PSEE havesuggested that it may decrease the risk of acquired epilepsy or preventthe development of epilepsy, where conventional AEDs failed(Belcastro et al., 2008; Klein et al., 2012; Pearl et al., 2013). LEV haspromising pharmacokinetic properties, including excellent bioavail-ability ( > 90%), linear kinetics, low plasma albumin binding ( < 10%),and a rapid rate of reaching steady state concentrations. In addition,LEV does not have any drug-drug interactions with AEDs or otheragents that operate via the hepatic CYP-dependent metabolic pathway(Cloyd and Remmel, 2000; Patsalos, 2000; Panayiotopoulos, 2010).

We focused our attention on preventing the development of post-SEepilepsy. SE causes 3–5% of cases of symptomatic epilepsy; as such, SEpatients are at a high risk of developing acquired epilepsy (Hesdorfferet al., 1998; Temkin, 2003; Jacobs et al., 2009). Various clinical trialshave indicated that conventional AEDs suppressed acute seizures, butso far, none have been able to prevent the development of post-SEepilepsy ( Temkin, 2001, 2003, 2009). Although the mechanismsunderlying the relationship between SE and the development ofepilepsy as part of the epileptogenic process are not well understood,the lack of efficacy of the conventional AEDs suggests that thebiological mechanisms of the epileptogenic process may be differmarkedly from that of the established epileptic brain models(Pitkanen et al., 2009).

Therefore, in the present study, we used a mouse model of PILO-induced SE as a model of epileptogenesis and investigated whether ornot LEV treatment could protect against the SE-induced BBB failureassociated with angiogenesis and brain inflammation in the latentperiod after SE.

2. Results

2.1. PILO-induced SE developed brain edema in MR images

In the MRI study, the SI of T2WI and DWI was measured inepileptogenic brains during the latent period after SE termination byDZP (Fig. 1A). At 2 days but not at 3 h post-SE, T2WI signalhyperintense areas were identified in the limbic regions (dorsalhippocampus, amygdala and piriform cortex) (Fig. 1A, b and c). Incontrast, increased SI of DWI compared to the findings in pre-SEanimals (Fig. 1A, e) was observed in the dorsal hippocampus andamygdala and piriform cortex at both 3 h and 2 days after SE (Fig. 1A, fand g)..

In the quantitative MRI studies, the SI of T2WI and T2 values, andDWI and ADC were measured in the epileptogenic hippocampusduring the latent period with or without LEV treatment. At 2 daysbut not at 3 h post-SE, increased SI of T2 and T2 values was inhibitedby LEV treatment (Fig. 2B). In diffusion images, the SI of DWIincreased at 3 h and 2 days post-SE, and the ADC decreased at 3 h,but increased at 2 days after SE. These changes in the diffusion ofparameters returned to normal values following LEV treatment(Fig. 2C, D). These findings indicated that mice that had experiencedconsecutive SE five times developed cytotoxic edema in the early period(3 h after SE), and vasogenic edema sequentially appeared in limbicregions..

2.2. PILO-induced SE developed BBB failure in MR images

Vasogenic edema is generally characterized by an increase in theinterstitial space fluid volume due to the loss of BBB integrity. Toevaluate the loss of BBB integrity in vivo, the non-invasive nature ofGd-enhanced MRI using T1WI (GdET1WI) was employed. As shown inFig. 1A (j and k), hyperintensity on GdET1WI was observed in theparenchyma of dorsal hippocampus 2 days after SE, but not 3 h after.However, 7 days after SE, the SI of GdET1WI significantly decreased tothe pre-SE SI (Fig. 1A, l). Therefore, the observations in the acutephase of post-SE may have been due to cytotoxic edema where the BBBwas still intact, whereas by 2 days post-SE, vasogenic edema may havedeveloped due to transient BBB failure. The enhancement of Gd-DTPAin the parenchyma of the limbic regions peaked at post-SE day 2 andsubsequently decreased to normal SI at post-SE day 7 (Fig. 1A, l,Fig. 2E). However, after the occurrence of spontaneous recurrentseizures (SRSs), the enhancement of Gd-DTPA gradually increasedweek by week (Fig. 2E, F). Thus, the loss of BBB integrity exhibitedbiphasic responses in epileptogenesis, and the induced permeability ofthe BBB by SE was markedly ameliorated by LEV treatment (Fig. 2E).These results suggested that the prevention of the development ofepilepsy by LEV treatment was associated with the protection of theBBB in the hippocampus. Therefore, in this study, we focused on LEVintervention for BBB failure during the acute phase of the latent periodafter SE. We hypothesized that preventing the acute process using LEVwould regulate the appearance of SRS (spontaneous recurrent con-vulsive seizures) by controlling sequential molecular and cellularcascades.

2.3. Immunohistochemical studies of SE-induced BBB failure andreactive astrogliosis

To confirm the effect of LEV against BBB failure after SE,immunohistochemical studies were performed using anti-albuminand anti-GFAP antibodies in the hippocampus of PILO-SE mice withor without LEV treatment. As shown in Fig. 3A (b–d), albumin clearlydiffused into the parenchyma of the hippocampus 3 h, 2 and 7 daysafter SE termination. However, in the LEV-treated mice, the diffusionof albumin into the parenchyma was strongly inhibited (Fig. 3A, f–h).Cerebral vessels were mainly covered by the endfeet of astrocytes tocompose the BBB. GFAP-positive reactive astrogliosis appeared andpersisted in hippocampal CA1 over time after SE (Fig. 3A, j-l). Reactiveastrogliosis was inhibited by LEV treatment (Fig. 3A, n-p). In addition,the change in the GFAP mRNA expression correlated with SE-inducedastrogliosis (Fig. 3B). Taken together, these findings indicated onepossibility of protection of BBB via astrocytes by LEV treatment afterSE termination..

2.4. Effect of LEV treatment on SE-induced angiogenesis in thehippocampus

To understand the mechanisms leading to the BBB leakage involvedin SE-induced angiogenesis in the hippocampus, immunohistologicalstudies were performed using anti-CD31 (PECAM-1) antibody toidentify cerebral immature endothelial cells (Vittet et al., 1996), andthe expression of angiogenesis-related molecules was measured pre-and post-SE. The number of CD31-positive cells gradually increasedduring the acute phase after SE, and this increase was inhibitedfollowing treatment with LEV for 2 days (Fig. 4A, B). The expressionof angiopoietin-2 (Ang-2) mRNA significantly increased at 3 h and 2and 7 days after SE, and the expression of angiopoietin-1 (Ang-1)mRNA significantly increased at 7 days after SE. In addition, theexpression of the receptor Tie-2 mRNA showed biphasic changes, witha decreased expression at 1 and 3 h and an increased expression at 2days after SE (Fig. 4C). LEV treatment prevented the increase in theexpression of Ang-2 mRNA at 2 and 7 days after SE and in the

K. Itoh et al. Brain Research 1652 (2016) 1–13

2

expression of Tie-2 mRNA at 2 days after SE; however, this treatmentdid not influence the expression of Ang-1 mRNA (Fig. 4C). Theexpression of Ang-2 protein (6.27 ± 2.06 pg/mg) at 2 days post-SEwas significantly increased from the pre-SE level (1.64 ± 0.11 pg/mg),and its increased protein level at 2 days post-SE was significantlydownregulated by LEV treatment (1.99 ± 0.0.78 pg/mg). The mRNAexpression of another angiogenic factor, vascular endothelial growthfactor-A (VEGF-A), and its receptor, VEGF-R2, also gradually in-creased and peaked at 2 days after SE; this increased mRNA expressionwas also significantly inhibited by LEV treatment (Fig. 4D). Thesefindings indicated that the induction of angiogenesis in the acute phaseof the latent period coincided with the time course of BBB leakage, andthat these changes were inhibited by LEV treatment. Therefore, thesefindings suggested that the inhibition of angiogenesis in the hippo-campus by LEV treatment after SE might be another possible mechan-ism of BBB protection..

2.5. Morphological changes of the microglia in the post-SEhippocampus following LEV treatment

Neuronal cell death in hippocampal CA1 was clearly observed bycresyl violet staining at 2 days after SE, and the cell death was clearlyprotected by LEV treatment (Fig. 5). Recently, several studies havesuggested that this cellular damage was involved in neuroinflammationvia microglia activation (Marchi et al., 2014; Kosonowska et al., 2015).

To examine the effect of LEV against microglia activation after SE,immunohistological studies were performed using anti-Iba1 and CD68antibodies to identify microglia and phagocytotic microglia, respec-tively. After SE termination, the number of Iba1-positive microgliagradually increased in CA1 (Fig. 6, upper panels; w/o); however, thisincrease was dramatically inhibited by subsequent treatment with LEV(Fig. 6, bottom panels; w/LEV). The morphology of the Iba1-positivecells was a ramified-like shape at 3 h after SE, changing to anamoeboid-like shape 2 days after SE. CD68- and Iba1-double positivemicroglia appeared in the CA1 pyramidal layer 2 days after SE. Theappearance of CD68-positive phagocytotic microglia in this region wascoincident with neuronal cell death (Fig. 5). However, no phagocytoticmicroglia were observed in LEV-treated SE mice, because of theprotective effects of LEV treatment against neuronal cell death. Theseresults suggested that the relationship between microglia activationand neuronal cell death in the acute phase of epileptogenesis mightplay an important role in the development of epilepsy...

2.6. Effect of LEV on the post-SE increase in levels of pro-inflammatory cytokines in the hippocampus

As several studies reported that neuroinflammation was involved inCNS injuries in epilepsy (Vezzani et al., 2011, 2015), we determinedthe involvement of neuroinflammation after SE. To this end, weinduced the temporal mRNA expression of pro-inflammatory related-

Fig. 1. Typical coronal MR images pre- and post-SE following treatment without (A) or with (B) LEV (350 mg/kg). The limbic regions show the hippocampus (HP) (arrow head) andamygdala and piriform cortex (AG/PC) (arrow). A. Typical MR images at the level of the HP and AG/PC in representative PILO-SE mice at 3 h (b, f, j), 2 days (c, g, k), and 7 days (b, h, l)after PILO-induced SE and before PILO injection (pre-SE) (a, e, i) in mice. The increased SI in the T2WI (a–d) and DWI (e–h) represents edema in the HP and AG/PC. Panels (i–l) - i:Gd-DTPA pre-SE, j: Gd-DTPA post-SE (3 h), k: Gd-DTPA post-SE (2 days) and l: Gd-DTPA post-SE (7 days). GdET1 signals (blue) represent Gd-DTPA leaking through the brainparenchyma. B. Typical MR images in representative LEV (350 mg/kg)-treated PILO-SE mice at 3 h (n, r, v), 2 days (o, s, w), and 7 days (p, t, x) after PILO-induced SE (post-SE) andpre-SE (m, g, u) in mice. The increased SI in the T2WI (m-p) and DWI (q–t) represents edema in the HP and AG/PC. Panels (u–x) - u: Gd-DTPA pre-SE, v: Gd-DTPA post-SE (3 h), w:Gd-DTPA post-SE (2 days), and x: Gd-DTPA post-SE (7 days).

K. Itoh et al. Brain Research 1652 (2016) 1–13

3

molecules, focusing on the early phase in experimental epileptogenesis.At 1 h post-SE, significant increases in the levels of pro-inflammatorycytokine mRNA IL-1β (peaked 3 h), IL-6 (peaked 2 days), TNFα(peaked 2 days), and iNOS (peaked 1 h)—were observed compared topre-SE (Fig. 7A, D, E, F). The protein levels of pro-inflammatorycytokines IL-1β (peaked 3 h, 6.68 ± 1.23 pg/mg) and IL-6 (peaked 2days, 209.19 ± 83.64 pg/mg) were markedly higher post-SE than pre-SE (IL-1β, 1.95 ± 0.31 pg/mg; IL-6, 0.19 ± 0.01 pg/mg) as well. Theexpression kinetics of IL-1 R type I (IL-1R1) mRNA and Toll-like

receptor 4 (TLR4) activated by IL-1β peaked 3 h and 2 days,respectively, after SE (Fig. 7B, C). These results indicated thatinduction of pro-inflammatory-related molecules occurred in the orderof iNOS, IL-1β/IL-6/IL-1R1, and TNFα/TLR4, according to the high-est expression levels. These sequential mRNA changes in pro-inflam-matory molecules in the early phase after SE were significantlyattenuated by LEV treatment (Fig. 7), as were the protein levels ofpro-inflammatory cytokines IL-1β (3 h; 3.24 ± 0.20 pg/mg), IL-6 (2days; 0.72 ± 0.50 pg/mg) post-SE. These sequential increases in the

Fig. 2. A quantitative analysis of MRI with or without LEV treatment after PILO-induced SE in mice. The box plots of the SI of T2WI (T2 SI), A. T2 values (ms), B. the SI of DWI (DWISI), C. ADC (x 10−3 mm2/s), D in the dorsal hippocampus show the 25th and 75th percentiles as the upper and lower half of each box along, with the 10th and 90th percentiles as theupper and lower error bars plus individual outliers (n=6–8). Control animals (pre-SE) and animals at 3 h (post-SE 3 h), 2 days (post-SE 2d), and 7 days (post-SE 7d) after SE. E. Theenhancement ratio of the SI of GdET1WI in the dorsal hippocampus show the 25th and 75th percentiles as the upper and lower half of each box, with the 10th and 90th percentiles as theupper and lower error bars plus individual outliers (n=6–10). Control animals (pre-SE) and animals at 3 h (post-SE 3 h), 2 days (post-SE 2d), 7 days (post-SE 7d), 14 days (post-SE14d), and 28 days (post-SE 28d) after SE. †; p < 0.05, ††; p < 0.01 vs. pre-SE, *; p < 0.01 vs. (−) post-SE, ɸ; p < 0.05 (w/LEV, 2d vs. 7d). Enhancement ratio (%) =(SI w/Gd-HP-DO3A –

SI w/o Gd-HP-DO3A) /(SI w/o Gd-HP-DO3A) ×100. F. Typical MR images in T1WI, T2WI, DWI and GdET1WI at 28 days after PILO-induced SE (post-SE) with (w/LEV) or withoutLEV (w/o) treatment in mice. A–E. Control animals (pre-SE; blue bar) PILO-induced SE (post-SE) with (w/LEV; pink bar) or without (w/o; green bar) LEV treatment in mice.

K. Itoh et al. Brain Research 1652 (2016) 1–13

4

levels of pro-inflammatory molecules in the acute phase of post-SEwere normalized to non-inflammatory level following LEV treatment..

3. Discussion

The ZP prevented BBB failure associated with angiogenesis andneurodegeneration induced by inflammatory responses in PILO-SE

Fig. 3. The loss of BBB integrity and reactive astrogliosis in the hippocampus in post-SE mice. A. Immunohistochemistry of albumin (a-h) and GFAP (i-p) for BBB leakage and reactiveastrogliosis in the dorsal hippocampus, respectively, in mice treated without (a-d and i-l) or with (e-h and m-p) LEV. Control animals (pre-SE) and animals at 3 h (post-SE 3 h), 2 days(post-SE 2d), and 7 days (post-SE 7d) after SE. B. The box plots of the relative mRNA expression of GFAP in the hippocampus show the 25th and 75th percentiles as the upper and lowerhalf of each box, with the 10th and 90th percentiles as the upper and lower error bars plus individual outliers (n=3–8). The mRNA levels were measured 1 h, 3 h, 2 days, and 7 days afterPILO-induced SE (post-SE), and before PILO (pre-SE; blue bar) with (+; pink bar) or without LEV (−; green bar) treatment in mice. †; p < 0.05, ††; p < 0.01 vs. pre-SE, *; p < 0.01 vs. (−)post-SE.

K. Itoh et al. Brain Research 1652 (2016) 1–13

5

model mice.LEV, one of the newer AEDs, has a unique mechanism of action,

wide therapeutic spectrum, and a favorable pharmacokinetic profile(Panayiotopoulos, 2010). In addition, this drug may also prevent ormodify the development of acquired epilepsy in basic and clinical

studies (Löscher et al., 1998; Klitgaard and Pitkanen, 2003; Belcastroet al., 2008; Klein et al., 2012; Pearl et al., 2013). However, severalreports have shown that LEV did not prevent acquired epilepsy whenadministered in post-SE animal models of TLE, although it did exertneuroprotective effects (Gibbs et al., 2006; Brandt et al., 2007). The

Fig. 4. LEV treatment prevented SE-induced angiogenesis in the hippocampus. A. The immunohistochemistry of CD31 for immature endothelial cells in mice treated without (a, b) orwith (c) LEV 2 days after SE (post-SE day 2). B. The box plots of the number of CD31-positive immature endothelial cells in the dorsal hippocampus (cells/mm2) show the 25th and 75thpercentiles as the upper and lower half of each box, with the 10th and 90th percentiles as the upper and lower error bars plus individual outliers (n=3–5). The number of CD31-positivecells per mm2 in hippocampal CA1 area measured 2 days after PILO-induced SE (post-SE), and before PILO (pre-SE; blue bar) with (w/LEV; pink bar) or without LEV (w/o; green bar)treatment in mice. ††; p < 0.01 vs. pre-SE, *; p < 0.05 vs. w/o post-SE. C. The box plots of the relative expression of antigopoetin-1 (Ang-1, upper panel), antigopoetin-2 (Ang-2, middlepanel) and its receptor Tie-2 mRNA (bottom panel) in the hippocampus show the 25th and 75th percentiles as the upper and lower half of each box, with the 10th and 90th percentiles asthe upper and lower error bars plus individual outliers (n=3–8). D. The box plots of the relative expression of VEGF (upper panel) and VEGF-R2 (bottom panel) mRNAs in thehippocampus show the 25th and 75th percentiles as the upper and lower half of each box, with the 10th and 90th percentiles as the upper and lower error bars plus individual outliers(n=3–8). The levels of Ang-1, Ang-2 and Tie-2 (C), and VEGF and VEGF-R2 mRNA (D) were measured 1 and 3 h and 2 and 7 days after PILO-induced SE (post-SE), and before PILO(pre-SE; blue bar) with (+; pink bar) or without (−; green bar) LEV treatment in mice.†; p < 0.05, ††; p < 0.01 vs. pre-SE, *; p < 0.05, **; p < 0.01 vs. w/o post-SE.

K. Itoh et al. Brain Research 1652 (2016) 1–13

6

discrepancy in these findings regarding the effects of LEV in post-SE animal models were likely caused by the differences in the study design

Fig. 5. LEV treatment prevented neuronal cell loss after PILO-induced SE in mice. Typical micrographs of cresyl violet-stained coronal sections showing a pre-SE, and a PILO-SE mousetreated with vehicle (post-SE, w/o) or with 350 mg/kg LEV at 3 h, 2 days, and 7 days after SE (post-SE, w/LEV). Magnifications of CA1, CA3, and DG in each hippocampal section areshown in the insets. The arrows indicate the cresyl violet-stained pyramidal layer in dorsal hippocampal CA1.

Fig. 6. Effect of LEV treatment on Iba1- and CD68-positive microglia in post-SE hippocampal CA1. Typical double-immunofluorescence micrographs showing co-localization of CD68in Iba1-positive microglia in the dorsal hippocampal CA1 region. The upper left panels show sections labelled with an antibody against CD68 (green), the bottom left panels showsections labelled with an antibody against Iba1 (red), and the bottom right panels show sections double-labelled with antibodies against CD68 and Iba1 (yellow signal in post-S2 dayswithout LEV) (typical microglial form in inset). The upper right panels show counter-stained sections using DAPI-Fluoromount-G for DNA detection. The coronal sections of pre-SE andPILO-SE mice treated with vehicle (post-SE, w/o) or with 350 mg/kg LEV (w/LEV) at 1 h, 3 h, and 2 days after SE (post-SE).

K. Itoh et al. Brain Research 1652 (2016) 1–13

7

(e.g. dose, timing and duration of intervention, severity of SE, includingthe number of seizures, and kind of animal models, including speciesand strains) (Dudek et al., 2008).

In our previous study, we reported that the incidence of SRS afterPILO (290 mg/kg) induced 5 consecutive seizures was inhibited byLEV treatment, and mortality, brain edema, and neuronal cell loss afterSE were also prevented (Itoh et al., 2015). The severity of SE, whichwas determined based on the dose of PILO and the number of seizures,was important for assessing the effect of LEV. Indeed, high doses ofPILO ( > 350 mg/kg, i.p.) or more than 6 consecutive seizures resultedin poor outcomes, including mortality, brain edema (MRI), and BBBdisruption (Fig. 1S, Tables 1S–3S). In addition, LEV was not aseffective in models induced at lower doses of PILO ( < 290 mg/kg) orwith fewer than 3 consecutive seizures (Tables 1S and 2S), and whenadministered more than 2 d post-SE (Fig. 2S). The severity of SE andtiming of LEV intervention after SE were found to be important factorsinfluencing the efficacy of LEV.

DZP is commonly used to treat SE, especially in Japan. It is a well-known in the SE model that convulsive SE was terminated by DZP, butnonconvulsive SE was not. To attenuate nonconvulsive SE after DZPtreatment, the addition of continuous LEV treatment was found to beeffective (Mazarati et al., 2004). A recent report indicated that interictalspiking and high-frequency oscillation during post-SE occurred atsignificantly lower rates following LEV plus DZP treatment comparedto DZP-only controls (Lévesque et al., 2015). Therefore, the LEVtreatment after SE probably decreases or prevents the acute molecularand cellular alterations resulting from nonconvulsive SE in addition to

convulsive SE.

3.1. SE-induced angiogenesis associated with BBB leakage againstLEV

The potential mechanisms of LEV may involve the protectionagainst BBB leakage via angiogenesis after SE. Indeed, BBB phasicfailure after SE was coincident with morphological changes of theassociated cells of BBB, especially astrocytes and endothelial cells.

Changes in the morphology and function of astrocyte in response tobrain insults are collectively termed “reactive astrogliosis”, althoughastrocytes are essential for the maintenance of the cytoarchitecture andhomeostasis under normal brain conditions (Sofroniew and Vinters,2010). LEV treatment inhibited GFAP-positive astrogliosis after SE andSE-induced angiogenesis (Figs. 3 and 4). Reactive astrogliosis isassociated with BBB failure and may trigger angiogenesis (Kovácset al., 2012; Morin-Brureau et al., 2012). Angiogenesis, the formationof new blood vessels, is induced by various growth factors andcytokines that act either directly or indirectly. In the present study,the expression of VEGF and VEGF-R2, which are involved in angiogen-esis and vascular permeability (Pages and Pouyssegur, 2005), wassignificantly upregulated at 2 days after SE (Fig. 4D). A previous studyproposed that the upregulation of VEGF-A after SE depends onhypoxia-inducible factor (HIF1-α), as SE causes hypoxia via a decreasein the cerebral blood flow (Rigau et al., 2007). However, given that wedid not detect any upregulation of HIF1-α mRNA in the acute phase (1or 3 h and 2 days) (Fig. 4S), the upregulation of VEGF may have

Fig. 7. LEV treatment prevented increases in pro-inflammatory-related molecule expression in the hippocampus after SE. The levels of pro-inflammatory-related molecules mRNA werenormalized to the β-actin mRNA level, and then the values of each group were divided by those of the control group to calculate the relative mRNA levels. The box plots of the relativeexpression of IL-1β (A), IL-1β type 1 receptor (IL-1R1) (B), toll-like receptor 4 (TLR4) (C), IL-6 (D), TNF-α (E) and iNOS (F) mRNAs in the hippocampus show the 25th and 75thpercentiles as the upper and lower half of each box, with the 10th and 90th percentiles as the upper and lower error bars plus individual outliers (n=4–8). These mRNAs were measured1 h, 3 h, 2 days, and 7 days after PILO-induced SE (post-SE), and before PILO (pre-SE; blue bar) with (+; pink bar) or without LEV (−; green bar) treatment in mice. **; p < 0.01 vs. pre-SE, †; p < 0.05 vs. w/o.

K. Itoh et al. Brain Research 1652 (2016) 1–13

8

instead been induced by other factors, such as pro-inflammatorycytokines (Pages and Pouyssegur, 2005; Vezzani and Granata, 2005).Indeed, in the present study, the expression of TNFα, IL-1β, and IL-6,were markedly upregulated in the acute phase after SE compared withpre-SE (Fig. 7).

Angiopeitin-1 (Ang-1)/its receptor Tie-2 control vessel maturationand maintain vasculature, while Ang-2/its receptor Tie-2 destabilizevessels and promote angiogenesis (Maisonpierre et al., 1997). Asshown in Fig. 1A, l and Fig. 2E, the SI of GdET1WI was significantlyincreased at 2 days post-SE and subsequently decreased to the pre-SElevel by 7 days post-SE. A concomitant marked increase in Ang-2expression was also noted at the gene and protein levels, raising thepossibility that Ang-2 may play a role in BBB failure in the acute phaseof post-SE (Fig. 4C). However, the expression of Ang-1 was actuallyupregulated at 7 days after SE but not in the acute phase, until 2 dayspost-SE (Fig. 4C). These results suggested that Ang-1 and Ang-2 havereciprocal effects for angiogenesis during the latent period of epilepto-genesis. In addition, the Ang-2/Tie2 cascade regulated the early stepsof angiogenesis associated with one of more angiogenic factors, theVEGF-A/VEGF-R2 cascade (Lobov et al., 2002; Scholz et al., 2015).Upregulation of Ang-2/Tie2 and VEGF-A/VEGF-R2 therefore leads toBBB leakage via angiogenesis (Morin-Brureau et al., 2012; Nag et al.,2005).

Some studies have shown that BBB injury is part of a pathophy-siological process affecting the neovasculature via seizures in brain(Rigau et al., 2007). The BBB leakage after SE may have several causes.One possible cause is that the morphological changes of the astrocytesobserved after SE transiently damage the functional BBB architecture,causing leakage. Another possible cause is the initial angiogenicprocesses due to the migration and proliferation of endothelial cellsinduced by angiogenic factors such as Ang-2/Tie2 and VEGF-A/VEGF-R2 cascades, as the vascular leakage was caused by neovasculaturewithout the BBB functional architecture.

In the present study, we showed that LEV treatment protectedagainst the transient breakdown of BBB due to angiogenic processes(Figs. 2–4). Although how LEV induces these protective effects isunknown, one possibility is that LEV may be associated with theprevention of SE-induced brain edema, which would consequently leadto protection against BBB leakage associated with angiogenesis.Therefore, we hypothesize that LEV treatment prevents the develop-ment of epilepsy as a result of protection against the angiogenesisassociated with an immature BBB, although LEV treatment did notenhance the expression of Ang-1 to antagonize the effect of Ang-2. LEVmay affect angiogenic processes such as Ang-2/Tie2 and VEGF-A/VEGF-R2 cascades in the neovasculature associated with reactiveastrogliosis, although further studies will be required to resolve thedetailed mechanism.

3.2. SE-induced activation of microglia against LEV treatment

Recent emerging reports on basic and clinical studies have focusedon the role of microglia in epilepsy, as excessive microglia activationmay be involved in brain inflammation, contributing to the pathophy-siological process of epilepsy (Vezzani et al., 2015). The braininflammation induced by activated microglia in the BBB may compro-mise barrier function and subsequently kill neurons, in addition toangiogenesis as described above.

As shown in Fig. 6, morphological changes to the microglia wereobserved in the hippocampus after PILO-induced SE. Recently, micro-glial activation has been suggested to proceed in three phases withrespect to the morphology and function (Saijo and Glass, 2011;Kettenmann et al., 2011). Ramified shape microglia converted to anactivated microglia accompanying partial round shape at 3 h after SE,and then sequentially changed to an amoeboid-like shape 2 days afterSE (Fig. 6). The activated microglia produce many pro-inflammatorymolecules, such as cytokines, chemokines, and reactive oxygen/nitro-

gen species (Brown and Neher, 2010; Venzzani et al., 2015). In thepresent experimental model, in the acute phase at 1 or 3 h after SE, theexpression of pro-inflammatory molecules such as TNF-α, IL-1β, IL-6,and iNOS increased markedly, accompanying morphological activation(Figs. 6 and 7). LEV prevented the increase in the numbers of Iba1-positive microglia and the conversion to an amoeboid-like shape from aramified shape after SE, as well as significantly inhibited the expressionof pro-inflammatory molecules (Figs. 6 and 7).

In general, excess pro-inflammatory molecules are harmful toneuronal cells (Brown and Neher, 2010). Therefore, these findingssuggest that neuronal cell death was induced by excess pro-inflamma-tory molecules generated by microglia, and that LEV protects neuronsby preventing the production of pro-inflammatory molecules via theinhibition of SE-induced microglia activation. Although we did notdirectly investigate the crosstalk between the activated microglia andastrocytes, the production of pro-inflammatory molecules by activatedmicroglia enhances the drive of pro-inflammatory molecules fromreactive astrocytes, which further enhance the activation of the micro-glia via a positive feedback pathway.

As mention above, these findings suggest that the transient BBBleakage after SE may also be caused by such crosstalk. Therefore,although the functional significance of the microglial and astrocytecrosstalk in vivo remains to be defined, the amplification of braininflammation by this crosstalk is important for understanding themechanism of epileptogenesis and the effects of LEV.

3.3. Effects of LEV treatment on SE-induced CD68-positivephagocytotic microglia

Microglia showed a CD68-positive phagocytotic phenotype at day 2post-SE but not 3 h after SE and congregated in hippocampal CA1(Fig. 6). Given that the loss of pyramidal neurons in the hippocampalCA1 of PILO-treated mice occurred 2 days after SE, the microgliachanged to a phagocytotic phenotype due to the clearance of the debris.

Almost no reports have clearly shown the relationship betweenpathogenesis and microglial phagocytosis, although a phagocytoticreaction is generally an adaptive response to remove bacteria or debristhat are not required for survival. Pro-inflammatory molecules appearto induce neuronal loss via microglial activation and phagocytosis,causing neuronal death by phagocytosis (Neniskyte et al., 2014). Giventhat LEV treatment prevented SE-induced microglial activation andneuronal cell death, CD68-positive phagocytotic microglia conse-quently might not need to congregate.

However, we cannot rule out the permeability of blood-borne cells,including phagocytotic cells such as macrophages as well as neutro-phils, through the damaged BBB or neovasculature without a matureBBB, since it is difficult to distinguish between microglia and macro-phages. In the present study, given that Iba1/CD68 double-positivecells existed in the perineovasculature, some of these cells might havebeen blood-borne phagocytotic cells. Nevertheless, the LEV treatment-induced protection against BBB leakage due to angiogenesis and braininflammation may have prevented any attack by blood-borne phago-cytotic cells. Future studies should investigate whether LEV directly orindirectly inhibits SE-induced microglia activation by protecting neu-rons, and the significance of the suppression of microglial activation byLEV should also be examined to reveal the cellular and molecularmechanisms of LEV in epileptogenesis and subsequent SRS.

Brain damage following TBI and stroke may develop via mechan-isms similar to that of brain injury following SE (Donkin and Vink,2010; Manley et al., 2000). Therefore, the development of post-braininsult epilepsies may be associated with BBB failure due to braininflammation, and LEV treatment may suppress the brain inflamma-tory process after these insults. Further prospective evaluations areneeded to elucidate the molecular and cellular mechanisms of actionfor inhibiting angiogenesis, brain inflammation, and brain edemaunderlying repeated LEV treatment for protecting against BBB leakage

K. Itoh et al. Brain Research 1652 (2016) 1–13

9

in the acute phase of the latent period.In conclusion, we found that LEV inhibited SE-induced angiogen-

esis and microglia activation, and the novel mechanism of LEVnormalized the abnormalities in the transient BBB breakdown duringthe acute phase of the latent period after SE. However, the molecularmechanisms of the cerebrovascular and parenchymal homeostaticmechanisms during epileptogenesis remain poorly understood. Thepresent findings indicated that the development of BBB leakage due tobrain inflammation and angiogenesis is critical in the initial process ofdeveloping acquired epilepsy after SE. Clarifying the effects of LEVtreatment on the balance between the damage and recovery processesduring the acute phase post-SE will open new avenues for under-standing the mechanism of acquired epilepsy and may be key todeveloping new therapies.

4. Experimental procedures

4.1. Experimental animals

The protocols for all animal experiments were approved by theTokushima Bunri University Animal Care Committees and wereperformed in accordance with the National Institutes of Health(USA) Animal Care and Use Protocol. All efforts were made tominimize the number of animals used and their suffering. Male,eight-week-old ICR mice were purchased from Japan SLC (Shizuoka,Japan). All mice were maintained with laboratory chow and water adlibitum on a 12-h light/dark cycle. The utilized animals were eutha-nized using saturated KCl.

4.2. PILO-induced SE model and seizure assessment

The PILO-induced SE model is a well-studied animal model of SE-based acquired epilepsy, as temporal lobe epilepsy (Cavalheiro et al.,1996). After a designated fasting period (16 h), ICR (CD-1) mice (9–10weeks old; weighing 35–45 g, Shizuoka, Japan) were injected withmethyl scopolamine (1 mg/kg, Sigma Aldrich, St Louis, MO, USA)intraperitoneally [i.p.] in 0.9% NaCl (Otsuka Pharmaceutical Factory,Inc. Tokushima, Japan) 30 min prior to PILO. A single dose of PILO(Sigma Aldrich) was then administered (290 mg/kg, i.p. in 0.9% NaCl)(Itoh et al., 2015, Fig. 1S). The animals were placed in a plasticchamber (10×15×30 cm), and their behavior was observed before andafter PILO injection. The control mice received 0.1 mL/10 g salineinjections. SE was defined by the incidence of five consecutive general-ized convulsive seizures, in accordance with our previous report (Itohet al., 2015, Fig. 1S, Tables 2S, 3S). Less than 10% of the PILO-injectedmice did not develop SE. To terminate the SE, all mice were injectedwith diazepam (DZP; Cercine®, 10 mg/kg, i.p.; Takeda PharmaceuticalLtd. Osaka, Japan), once or more as needed to suppress convulsiveseizures. The average duration between the PILO injection and theonset of SE (first convulsive seizure) was 12′ 31″ ± 2′ 50″. The averageduration between the PILO injection and the end of SE (five convulsiveseizures) was 30′ 21″ ± 11′ 29″. We randomly selected mice fromamong those with five convulsive seizures to use for these experiments.The post-SE care of the animals included oral rehydration therapy toincrease the number of SE survivors; all mice were fed moistenedrodent chow in a petri dish inside the cage and were orally adminis-tered a rehydration solution (OS-1®; Otsuka Pharmaceutical Factory,Inc.) at 2 mL a day for at least 2 days after SE to help replenish fluids,and thereafter when needed. Mice were placed in individual blocks in aplastic chamber, and their seizures were monitored and recorded usinga Vcam01-1.3Mpix with infrared night vison mode (JSEED, Inc.,Osaka, Japan) every day for 24 h, for 7–10 days after SE. SRS wasobserved in 84% of PILO-SE animals with 5 seizures not treated withLEV (40 of 48 mice) between 7 and 10 days after SE in this study(Table 2S). Thirty-four of 167 PILO-injected mice (20%) died duringand after SE (Table 2S). Seizure monitoring and recordings were

manually reviewed by well-trained investigators.

4.3. Administration of Levetiracetam

The doses of LEV (LKT Labs, Inc., St. Paul, MN, USA) used in thisstudy were 180 and 360 mg/kg. LEV dissolved in distilled water wasorally administered at an injection volume of 0.1 mL/10 g of bodyweight within 30 min after DZP injection, and thereafter twice a day (at8:30 and 17:30) for 7–10 days. To determine the pharmacokinetics ofLEV, the concentrations of LEV in the plasma and hippocampus weremeasured by HPLC at 0, 5, 1, 2, 3, 8, 12 and 24 h after a single injectionof LEV (180 mg/kg, 360 mg/kg, p.o.) (Fig. 3S).

4.4. Magnetic resonance imaging (MRI)

The all mice who developed SE were anesthetized with a 1.5–1.8%isoflurane (Escain®, 160 mL/min: MERCK, Kenilworth, NJ, USA)-oxygen mixture. During MRI, the body temperature was measuredusing a rectal thermocouple and maintained at a constant 37 ± 0.2 °Cwith a feedback-controlled warm-water blanket (Yamashita TechSystem, Tokushima, Japan) connected to the rectal probe (PhotonControl Inc., Burnaby BC, Canada). The MRI data were acquired usingan MRmini-SA (DS Pharma Biomedical, Osaka, Japan), consisting of a1.5-Tesla permanent magnet made of Nd-Fe-B material, a compactcomputer-controlled console, and a solenoid MRI coil with a 30-mminner diameter.

We obtained coronal MR images in all SE survivors using T1-weighted imaging (T1WI), T2-weighted imaging (T2WI), and diffusion-weighted imaging (DWI) sequences, in accordance with our previousreport (Itoh et al., 2015). To measure the T2 relaxation time andapparent diffusion coefficient (ADC) from T2WI and DWI, respectively,in the hippocampus on a brain slice (bregma −1.70 to −2.06 mm)according to the mouse brain atlas (Paxions and Franklin, 2012)(Fig. 1y) were defined as regions of interest (ROIs) in the dorsalhippocampus, and the mean value of the signal intensity (SI) in thethree ROIs of six animals treated with or without LEV at each timepoint was determined using the INTAGE Realia Professional softwareprogram (Cybernet Systems Co. Ltd., Tokyo, Japan).

To investigate the BBB permeability after SE, all SE survivors werebolus injected via a femoral vein with 0.4 mmol/kg Gd-DTPA (gado-pentetate dimeglumine, Magnevist®; Bayer HealthCare LLC,Leverkusen, Germany) as an ionic gadolinium complex MRI contrastagent. Since Gd complex MRI contrast agents such as Gd-DTPA cannotcross the intact BBB, this agent does not accumulate in the normalbrain parenchyma (Ichikawa and Itoh, 2011; Danjo et al., 2013; Itohet al., 2015). Therefore, any accumulation of T1SI in the brainparenchyma indicates BBB leakage. The MRI observations wererepresented as typical micrographs of the first SRS-induced mice atday 7 after SE. However, the quantitative MRI parameters wereincluded with the data of the first SRS-induced mice between days 7and 10 after SE.

4.5. Total RNA extraction and real-time polymerase chain reaction(RT-PCR)

Determination of the mRNA levels was performed in accordancewith our previous report (Ishihara et al., 2015). Briefly, total RNA wasextracted from the mouse whole hippocampus using a High Pure RNAIsolation Kit (Roche Diagnostics K.K., Tokyo, Japan). Single-strandedcDNA was synthesized from 1 μg of total RNA following the ReverTraAce protocol (Toyobo, Osaka, Japan) with a random primer (9-mer;Takara Bio, Shiga, Japan). RT-PCR was performed using a LightCyclerinstrument (Roche Diagnostics) in a total reaction mixture volume of20 μL containing 10 μL of Sybr Green Real-time PCR master mix(Toyobo), 1 μL cDNA, and 10 pmol of each of the primers, as shown inTable 1. The levels of target mRNA were normalized to the β-actin

K. Itoh et al. Brain Research 1652 (2016) 1–13

10

mRNA level, and then the values of the treated slices were divided bythose of the control group to calculate the relative mRNA levels(Schmittgen and Livak, 2008). The relative expressions of mRNA wereincluded with the data of the first SRS-induced mice between days 7and 10 after SE.

4.6. Histological, immunohistochemical, and stereological analyses

For the histological and immunohistochemical analyses, three micefor all groups were deeply anesthetized and euthanized with sodiumpentobarbital (50 mg/kg; Sigma Aldrich) and then perfused transcar-dially with heparinized 0.1 M phosphate-buffered saline (PBS), fol-lowed by 4% paraformaldehyde (PFA) in 0.1 M PBS, pH 7.4. The fixedtissues were embedded in paraffin and sectioned on a microtome at4 µm for the immunohistochemical examination. The sections wereincubated in 0.3% hydrogen peroxide in PBS for 30 min and then in 2%bovine serum albumin (BSA) for 30 min, followed by overnightincubation with a rabbit antibody for GFAP (1/400; Dako AgilentTechnologies, Glostrup, Denmark), Iba1 (1/500; Wako Pure ChemicalIndustries, Ltd. Osaka, Japan), or mouse albumin (1/1000; MPBiomedicals, LLC- Cappel, Santa Ana, CA, USA). Staining was achievedwith a Simple Stain kit (Nichirei, Tokyo, Japan) and developed with3,3′-diaminobenzidine tetrahydrochloride and hydrogen peroxide(Nichirei) at room temperature for 5–7 min. The sections werecounterstained with hematoxylin.

For immunofluorescent histochemistry, the brains were removedfrom three mice for all groups, post-fixed overnight in 4% buffered PFAat 4 °C after perfusion, and then cryoprotected in 30% sucrose. Thebrain was frozen in powdered dry ice, and 50-μm-thick floatingsections were prepared using a Cryostat (CM3050 S; LeicaBiosystems, Nussloch, Germany). The sections were blocked andpermeabilized with PBS including 10% normal goat serum (SigmaAldrich) and 0.3% Triton-X 100 for 1 h at room temperature. Thesections were then incubated with primary antibody (Anti-Iba1, 1/500,Wako; Anti-CD68, 1/200, Serotec/Bio-Rad, Raleigh, NC, USA; Anti-CD31, 1/100, Abcam, Cambridge, UK) for 3 h at room temperature,followed by secondary antibody (Anti-rat IgG, Alexa488, 1/200; Anti-rabbit IgG, Alexa568, 1/200, Molecular Probes-Thermo FisherScientific, Waltham, MA, USA) for 1 h at room temperature in thedark. The sections were then mounted on slide glass with DAPI-Fluoromount-G (Southern Biotech, Birmingham, AL, USA). Confocalimages were obtained using a Zeiss LSM700 confocal fluorescencemicroscope equipped with diode lasers (405, 488, and 568 nm; CarlZeiss, Oberkochen, Germany). The images were processed using theaccompanying Zen image acquisition software package (Carl Zeiss).The histological data were represented as typical micrographs of the

first SRS-induced mice at day 7 after SE.

4.7. Measurement of IL-1β, IL-6 and angiopoietin-2 in hippocampusof post- SE mice

The frozen whole hippocampus was weighed and homogenized in5× volume of extraction buffer (20 mM Tris-HCl [pH 7.5], 150 mMNaCl, 1 mM PMSF, 0.05% Tween20, and 1% protease inhibitor cock-tail; Nacalai Tesque, Kyoto, Japan). The samples were centrifuged at1000g for 10 min at 4 °C, and then the supernatant was collected andcentrifuged at 20,000g for 40 min at 4 °C to remove any remainingdebris. The protein concentration was measured with a BCA ProteinAssay kit (Thermo Scientific, Rockford, IL, USA). The concentrations ofmouse angiopoietin-2 and IL-6 in 25 μL of each brain supernatant weremeasured using a Milliplex™ MAP Mouse CVD Magnetic Bead Panel 2(Millipore, Billerica, MA, USA) in accordance with the manufacturer'sinstructions. Mouse IL-1β levels were measured using a commerciallyavailable ELISA kit (mouse IL-1β ELISA Ready-SET-Go! ; eBioscience-Affymetrix, San Diego, CA, USA) in accordance with the manufacturer'sinstructions. The concentrations of each analyte in the brain sampleswere normalized to the total protein concentration (n=3 for all groups).The expressions of cytokines were included with the data of the firstSRS-induced mice between days 7 and 10 after SE.

4.8. Statistical analysis

All data are shown as the mean ± standard deviation (SD) or as themedian and box plots showing the 25th and 75th percentiles as theupper and lower half of each box along with the 10th and 90thpercentiles as the upper and lower error bars plus individual outliers.The BellCurve for Excel software program (Social Survey Res. Info. Co.,Ltd. Tokyo, Japan) was used to perform the Kruskal Wallis post-hocSteel or Steel-Dwass test. A p-value less than 0.05 was considered to bestatistically significant.

Conflicts of interest

The authors declare that there are no potential conflicts of interestrelated to the present manuscript.

Acknowledgements

This work was supported by JSPS KAKENHI Grant numberJP16K10216 (to K.I.), JP15K18947 (to R.K.) JP15K08122 (to H.N.)and JP26740024 (to Y. I.) and was financially supported in part byTokushima Bunri University. This manuscript has been checked by a

Table 1The primers used for the real-time PCR.

Gene Forward primer sequence Reverse primer sequence

TNF-α ATGGCCTCCCTCTCATCAGT CTTGGTGGTTTGCTACGACGIL-1β AGCTTCCTTGTGCAAGTGTCT GCAGCCCTTCATCTTTTGGGIL-6 TCCTCTCTGCAAGAGACTTCC TTGTGAAGTAGGGAAGGCCGHIF1-α ACAAGTCACCACAGGACAG AGGGAGAAAATCAAGTCGiNOS TCCTGGACATTACGACCCCT CTCTGAGGGCTGACACAAGGTGF-β1 AGCTGCGCTTGCAGAGATTA AGCCCTGTATTCCGTCTCCTIL1R1 GCTGACTTGAGGAGGCAGTT TATTCTCCATTTGTGTTGTTCACGGTLR4 TGGTTGCAGAAAATGCCAGG AGGAACTACCTCTATGCAGGGATGFAP AGGGCGAAGAAAACCGCATC GGTGAGCCTGTATTGGGACAAng-1 CGAAGGATGCTGATAACGACAA ACAGGCATCGAACCACCAAAng-2 CTGTGCGGAAATCTTCAAGTCA CATGTCACAGTAGGCCTTGATCTCTie-2 CGGCCAGGTACATAGGAGGAA TCACATCTCCGAACAATCAGCVEGF-A TGTACCTCCACCATGCCAAGT CTTCGCTGGTAGACATCCATGGAVEGF-R2 CGACATAGCCTCCACTGTTTATG TTTGTTCTTGTTCTCGGTGATGβ-actin CTAGGCACCAGGGTGTGATG GGGGTACTTCAGGGTCAGGA

All primers are listed in the 5′→3′direction.

K. Itoh et al. Brain Research 1652 (2016) 1–13

11

professional language editing service (Japan Medical Communication,Inc).

Appendix A. Supplementary material

Supplementary data associated with this article can be found in theonline version at doi:10.1016/j.brainres.2016.09.038.

References

Belcastro, V., Costa, C., Galletti, F., Autuori, A., Pierguidi, L., Pisani, F., Calabresia, P.,Parnetti, L., 2008. Levetiracetamin newly diagnosed late-onset post-stroke seizures:a prospective observational study. Epilepsy Res. 82, 223–226.

Brandt, C., Glien, M., Gastens, A.M., Fedrowitz, M., Bethmann, K., Volk, H.A., Potschka,H., Löscher, W., 2007. Prophylactic treatment with levetiracetam after statusepilepticus: lack of effect on epileptogenesis, neuronal damage, and behavioralalterations in rats. Neuropharmacology 53, 207–221.

Brodie, M.J., Elder, A.T., Kwan, P., 2009. Epilepsy in later life. Lancet Neurol. 8,1019–1030.

Brown, G.C., Neher, J.J., 2010. Inflammatory neurodegeneration and mechanisms ofmicroglial killing of neurons. Mol. Neurobiol. 41, 242–247.

Cataldi, M., Lariccia, V., Secondo, A., di Renzo, G., Annunziato, L., 2005. Theantiepileptic drug levetiracetam decreases the inositol 1,4,5-trisphosphatedependent[Ca2+]i increase induced by ATP and bradykinin in PC12 cells. J. Pharmacol. Exp.Ther. 313, 720–730.

Cavalheiro, E.A., Santos, N.F., Priel, M.R., 1996. The pilocarpine model of epilepsy inmice. Epilepsia 37, 1015–1019.

Cloyd, J.C., Remmel, R.P., 2000. Antiepileptic drug pharmacokinetics and interactions:impact on treatment of epilepsy. Pharmacotherapy 20, 139S–151S.

Danjo, S., Ishihara, Y., Watanabe, M., Nakamura, Y., Itoh, K., 2013. Pentylentetrazole-induced loss of blood-brain barrier integrity involves excess nitric oxide generationby neuronal nitric oxide synthase. Brain Res. 1530, 44–53.

Donkin, J.J., Vink, R., 2010. Mechanisms of cerebral edema in traumatic brain injury:therapeutic developments. Curr. Opin. Neurol. 23, 293–299.

Dudek, F.E., Bertram, E.H., Staley, K.J., 2008. Antiepileptogenesis therapy withlevetiracetam: data from kindling versus status epilepticus models. Epilepsy Curr. 8,28–30.

Galanopoulou, A.S., Gorter, J.A., Cepeda, C., 2012. Finding a better drug for epilepsy: themTOR pathway as an antiepileptogenic target. Epilepsia 53, 1119–1130.

Gibbs, J.E., Walker, M.C., Cock, H.R., 2006. Levetiracetam: antiepileptic properties andprotective effects on mitochondrial dysfunction in experimental status epilepticus.Epilepsia 47, 469–478.

Glien, M., Brandt, C., Potschka, H., Löscher, W., 2002. Effects of the novel antiepilepticdrug levetiracetam on spontaneous recurrent seizures in the rat pilocarpine model oftemporal lobe epilepsy. Epilepsia 43, 350–357.

Glauser, T., Shinnar, S., Gloss, D., Alldredge, B., Arya, R., Bainbridge, J., Bare, M., Bleck,T., Dodson, W.E., Garrity, L., Jagoda, A., Lowenstein, D., Pellock, John, Riviello, J.,Sloan, E., Treiman, D.M., 2016. Evidence-based guideline: treatment of convulsivestatus epilepticus in children and adults: report of the Guideline Committee of theAmerican Epilepsy Society. Epilepsy Curr. 16, 48–61.

Hesdorffer, D.C., Logroscino, G., Cascino, G., Annegers, J.F., Hauser, W.A., 1998. Risk ofunprovoked seizure after acute symptomatic seizure: effect of status epilepticus. Ann.Neurol. 44, 908–912.

Herman, S.T., 2002. Epilepsy after brain insult: targeting epileptogenesis. Neurology 59,21–26.

Ichikawa, H., Itoh, K., 2011. Blood-arachnid barrier disruption in experimental ratmeningitis detected using gadolinium-enhancement ratio imaging. Brain Res. 1390,142–149.

Ishihara, Y., Takemoto, T., Itoh, K., Ishida, A., Yamazaki, T., 2015. Dual Role ofSuperoxide Dismutase 2 induced in activated microglia: oxidative stress toleranceand convergence of inflammatory responses. J. Biol. Chem. 290, 22805–22817.

Itoh, K., Inamine, M., Oshima, W., Kotani, M., Chiba, Y., Ueno, M., Ishihara, Y., 2015.Prevention of status epilepticus-induced brain edema and neuronal cell loss byrepeated treatment with high-dose levetiracetam. Brain Res. 1608, 225–234.

Jacobs, M.P., Leblanc, G.G., Brooks-Kayal, A., Jensen, F.E., Lowenstein, D.H., Noebels,J.L., Noebels, J.L., Spencer, D.D., Swann, J.W., 2009. Curing epilepsy: progress andfuture directions. Epilepsy Behav. 14, 4384–4445.

Jiang, J., Ganesh, T., Du, Y., Quan, Y., Serrano, G., Qui, M., Speigel, I., Rojas, A., Lelutiu,N., Dingledine, R., 2012. Small molecule antagonist reveals seizure-inducedmediation of neuronal injury by prostaglandin E2 receptor subtype EP2. Proc. Natl.Acad. Sci. USA 109, 3149–3154.

Kettenmann, H., Hanish, U.K., Noda, M., Verkhratsky, A., 2011. Physiology of microglia.Physiol. Rev. 91, 461–553.

Klein, P., Herr, D., Pearl, P.L., Natale, J., Levine, Z., Nogay, C., Sandoval, F., Trzcinski, S.,Atabaki, S.M., Tsuchida, T., van den Anker, J., Soldin, S.J., He, J., McCarter, R.,2012. Results of phase II safety and feasibility study of treatment with levetiracetamfor prevention of posttraumatic epilepsy. Arch. Neurol. 9, 1–6.

Klitgaard, H., Pitkanen, A., 2003. Antiepileptogenesis, neuroprotection, and diseasemodification in the treatment of epilepsy: focus on levetiracetam. Epileptic Disord. 5,(S9-16).

Kovács, R., Heinemann, U., Steinhäuser, C., 2012. Mechanisms underlying blood–brainbarrier dysfunction in brain pathology and epileptogenesis: role of astroglia.Epilepsia 53, 53–59.

Kosonowska, E., Janeczko, K., Setkowicz, Z., 2015. Inflammation induced at differentdevelopmental stages affects differently the range of microglial reactivity and thecourse of seizures evoked in the adult rat. Epilepsy Behav. 49, 66–70.

Krumholz, A., Wiebe, S., Gronseth, G.S., Gloss, D.S., Sanchez, A.M., Kabir, A.A.,Liferidge, A.T., Martello, J.P., Kanner, A.M., Shinnar, S., Hopp, J.L., French, J.A.,2015. Evidence-based guideline: management of an unprovoked first seizure inadults Report of the Guideline Development Subcommittee of the AmericanAcademy of Neurology and the American Epilepsy Society. Neurology 84,1705–1713.

Lévesque, M., Behr, C., Avoli, M., 2015. The anti-ictogenic effects of levetiracetam aremirrored by interictal spiking and high-frequency oscillation changes in a model oftemporal lobe epilepsy. Seizure 25, 18–25.

Löscher, W., Hönack, D., Rundfeldt, C., 1998. Antiepileptogenic effects of the novelanticonvulsant levetiracetam (ucb L059) in the kindling model of temporal lobeepilepsy. J. Pharmacol. Exp. Ther. 284, 474–479.

Lobov, I.B., Brooks, P.C., Lang, R.A., 2002. Angiopoietin-2 displays VEGF-dependentmodulation of capillary structure and endothelial cell survival in vivo. Proc. Natl.Acad. Sci. USA 99, 11205–11210.

Lukyanetz, E.A., Shkryl, V.M., Kostyuk, P.G., 2002. Selective blockade of N-type calciumchannels by levetiracetam. Epilepsia 43, 9–18.

Lynch, B.A., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A.,Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for theantiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA 26, 9861–9866.

Lyseng-Williamson, K.A., 2011. Levetiracetam: a review of its use in epilepsy. Drugs 71,489–514.

Maisonpierre, P.C., Suri, C., Jones, P.F., Bartunkova, S., Wiegand, S.J., Radziejewski, C.,Compton, D., McClain, J., Aldrich, T.H., Papadopoulos, N., Daly, T.J., Davis, S., Sato,T.N., Yancopoulos, G.D., 1997. Angiopoietin-2, a natural antagonist for Tie2 thatdisrupts in vivo angiogenesis. Science 277, 55–60.

Manley, G.T., Fujimura, M., Ma, T., Noshita, N., Filiz, F., Bollen, A.W., Chan, P.,Verkman, A.S., 2000. Aquapolin-4 deletion in mice reduces brain edema after acuteintoxication and ischemic stroke. Nat. Med. 6, 159–163.

Manno, E.M., 2011. Status Epilepticus: current treatment strategies. Neurohospitalist 1,23–31.

Marchi, N., Granata, T., Janigro, D., 2014. Inflammatory pathways of seizure disorders.Trends Neurosci. 37, 55–65.

Mazarati, A.M., Baldwin, R., Klitgaard, H., Matagne, A., Wasterlain, C.G., 2004.Anticonvulsant effects of levetiracetam and levetiracetam diazepam combinations inexperimental status epilepticus. Epilepsy Res. 58, 167–174.

Meehan, A.L., Yang, X., Yuan, L.L., Rothman, S.M., 2012. Levetiracetam has an activity-dependent effect on inhibitory transmission. Epilepsia 53, 469–476.

Morin-Brureau, M., Rigau, V., Lerner-Natoli, M., 2012. Why and how to targetangiogenesis in focal epilepsies. Epilepsia 53, 64–68.

Nag, S., Papneja, T., Venugopalan, R., Stewart, D.J., 2005. Increased angiopoietin2expression is associated with endothelial apoptosis and blood–brain barrierbreakdown. Lab. Invest. 85, 1189–1198.

Nagarkatti, N., Deshpande, L.S., DeLorenzo, R.J., 2008. Levetiracetam inhibits bothryanodine and IP3 receptor activated calcium induced calcium release inhippocampal neurons in culture. Neurosci. Lett. 436, 289–293.

Neniskyte, U., Vilalta, A., Brown, G.C., 2014. Tumour necrosis factor alpha-inducedneuronal loss is mediated by microglial phagocytosis. FEBS Lett. 588, 2952–2956.

Pages, G., Pouyssegur, J., 2005. Transcriptional regulation of the Vascular EndothelialGrowth Factor gene–a concert of activating factors. Cardiovasc. Res. 65, 564–573.

Panayiotopoulos, C.P., 2010. A Clinical Guide to Epileptic Syndromes and theirTreatment springer; 2nd revised edit. pp.173–235.

Patsalos, P.N., 2000. Pharmacokinetic profile of levetiracetam: toward idealcharacteristics. Pharmacol. Ther. 85, 77–85.

Paxions, G., Franklin, K.B.J., 2012. Paxinos and Franklin’s the Mouse Brain inStereotaxic Coordinates Fourth ed.. Academic Press, New York.

Pearl, P.L., McCarter, R., McGavin, C.L., Yu, Y., Sandoval, F., Trzcinski, S., Atabaki, S.M.,Tsuchida, T., van den Anker, J., He, J., Klein, P., 2013. Results of phase IIlevetiracetam trial following acute head injury in children at risk for posttraumaticepilepsy. Epilepsia 54, e135–e137.

Pitkanen, A., Immonen, R.J., Grohn, O.H., Kharatishvili, I., 2009. From traumatic braininjury to posttraumatic epilepsy: what animal models tell us about the process andtreatment options. Epilepsia 50, 21–29.

Rigo, J.M., Hans, G., Nguyen, L., Rocher, V., Belachew, S., Malgrange, B., Leprince, P.,Moonen, G., Selak, I., Matagne, A., Klitgaard, H., 2002. The anti-epileptic druglevetiracetam reverses the inhibition by negative allosteric modulators of neuronalGABA- and glycine-gated currents. Br. J. Pharmacol. 136, 659–672.

Rigau, V., Morin, M., Rousset, M.C., de Bock, F., Lebrun, A., Coubes, P., 2007.Angiogenesis is associated with blood brain barrier permeability in temporal lobeepilepsy. Brain 130, 1942–1956.

Saijo, K., Glass, C.K., 2011. Microglial cell origin and phenotypes in health and disease.Nat. Rev. Immunol. 11, 775–787.

Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT

method. Nat. Prot. 3, 1101–1108.Scholz, A., Plate, K.H., Reiss, Y., 2015. Angiopoietin-2: a multifaceted cytokine that

functions in both angiogenesis and inflammation. Ann. N.Y. Acad. Sci. 1347, 45–51.Sofroniew, M.V., Vinters, H.V., 2010. Astrocytes: biology and pathology. Acta

Neuropathol. 119, 7–35.Stratton, S.C., Large, C.H., Cox, B., Davies, G., Hagan, R.M., 2003. Antiepileptogenic like

effects of lamotrigine in a rat amygdala kindling model. Epilepsy Res. 53, 95–106.Temkin, N.R., 2001. Antiepileptogensis and seizure prevention trials with antiepileptic

drugs. Meta-analysis of controlled trials. Epilepsia 42, 515–524.Temkin, N.R., 2003. Risk factors for posttraumatic seizures in adults. Epilepsia 44,

K. Itoh et al. Brain Research 1652 (2016) 1–13

12

18–20.Temkin, N.R., 2009. Preventing and treating posttraumatic seizures: the human

experience. Epilepsia 50, 10–13.Vezzani, A., French, J., Bartfai, T., Baram, T.Z., 2011. The role of inflammation in

epilepsy. Nat. Rev. Neurol. 7, 31–40.Vezzani, A., Granata, T., 2005. Brain inflammation in epilepsy: experimental and clinical

evidence. Epilepsia 46, 1724–1743.Vezzani, A., Lang, B., Aronica, E., 2015. Immunity and inflammation in epilepsy. Cold

Spring Harb. Perspect. Med.. http://dx.doi.org/10.1101/cshperspect.a022699.Vittet, D., Prandini, M.H., Berthier, R., Schweitzer, A., Martin-Sisteron, H., Uzan, G.,

Dejana, E., 1996. Embryonic stem cells differentiate in vitro to endothelial cellsthrough successive maturation steps. Blood 88, 3424–3431.

Zheng, Y., Moussally, J., Cash, S.S., Karnam, H.B., Cole, A.J., 2010. Intravenouslevetiracetam in the rat pilocarpine-induced status epilepticus model: behavioral,physiological and histological studies. Neuropharmacology 58, 793–798.

K. Itoh et al. Brain Research 1652 (2016) 1–13

13