(liopygia) argyrostoma

INTRODUCTION

Sarcophaga (Liopygia) argyrostoma is a com-mon species in some parts of Poland; it has beenrecorded from the Baltic Coast, Pomeranian Lakeland,Mazovian Lowland, Lower Silesia, Małopolska Upland,Lublin Upland, Roztocze, Tatra Mts and the formerGalicia (Draber-Mońko 1973, 1982, 1991, 1998).

Larvae of Sarcophaga (Liopygia) argyrostoma(Robineau-Desvoidy) are important from the point ofview of forensic entomology. According to Wyss (1997),the flesh fly most often inhabits corpses left indoors.Out of the ten records from human corpses in Switzer-land, only in one case were the fly larvae found on a corpse out of doors. In Poland, in one forensic case,the fly laid larvae on a corpse in a flat (Grochowskaunpublished). Knowledge of the morphology and of theduration of particular developmental stages of the fly isuseful when determining the PMI (post mortem inter-valum).

The species was originally described as Myophoraargyrostoma Robineau-Desvoidy in 1830 from theCape of Good Hope, Cape Province in South Africa. Later, it was included in various genera. Recently, thename of this species has been used in many combina-tions, for example: Sarcophaga argyrostoma (R.-D.)(Smith 1986), Liopygia (Thomsonea) argyrostoma(R.-D.) (Povolný and Verves 1997, Peris et al. 1999, Parchami-Araghi et al. 2001), Liopygia (= Sarco-phaga) argyrostoma (R.-D.) (Grassberger and Reiter2002, Grassberger and Frank 2004), Sarcophaga(Liopygia) argyrostoma (R.-D.) (Pape 1996), Liopy-gia argyrostoma (R.-D.) (Fan and Pape 1996), Para-sarcophaga argyrostoma (R.-D.) (Benecke 1998,Awad et al. 2003) and Thomsonea argyrostoma(R.-D.) (Lehrer 2006).

In the catalogue of the World Sarcophagidae, it wasplaced in the genus Sarcophaga Meigen, 1826, thesubgenus Liopygia Enderlein, 1928, with seven otherspecies (Pape 1996: 345–348). The nomenclature used

ON THE MORPHOLOGY AND MITOCHONDRIAL DNA BARCODING OF THE FLESH FLY SSAARRCCOOPPHHAAGGAA

(LLIIOOPPYYGGIIAA) AARRGGYYRROOSSTTOOMMAA (ROBINEAU-DESVOIDY, 1830)(DIPTERA: SARCOPHAGIDAE) – AN IMPORTANT

SPECIES IN FORENSIC ENTOMOLOGY

AA NN NN AA LL EE SS ZZ OO OO LL OO GG II CC II ((WWaarrsszzaawwaa)),, 22000099,, 5599((44)):: 446655--449933

AGNIESZKA DRABER-MOŃKO, TADEUSZ MALEWSKI,JAN POMORSKI, MARTA ŁOŚ and PIOTR ŚLIPIŃSKI

Museum and Institute of Zoology, Polish Academy of Sciences, Wilcza 64, 00-679Warsaw, Poland; e-mails: [email protected], [email protected]

Abstract.— Descriptions of the developmental stages of Sarcophaga (Liopygia)argyrostoma (R.-D.) are given. Scanning electron microscope images of most of itsimmature stages are presented for the first time. The sequence of mitochondrialcytochrome c oxidase subunit I (COI) gene fulfilling DNA barcoding standards is presentedfor the first time.

�

Key words.— Diptera, Sarcophagidae, developmental stages, forensic entomology, mito-chondrial DNA, cytochrome oxidase (COI).

PL ISSN 0003-4541 © Fundacja Natura optima duxdoi: 10.3161/000345409X484865

in the present study follows the classification of Pape(1996).

Complete descriptions of the preimaginal stages ofS. (L.) argyrostoma (R.-D.) were provided by Tölg(1913), Aldrich (1916), Thompson (1921), Greene(1925), Knipling (1936), Hafez (1940), Yates (1967),Abou-El Ela and El-Gindi (1999) and Awad et al.(2003).These authors presented more or less detaileddescriptions and figures of all preimaginal instars ofthe species. Unfortunately, they applied no moderndocumentation techniques. Scanning electron micro-scopy (SEM) is particularly useful for illustrating ex-ternal characters. During recent years, several SEM-based papers appeared, dealing with larval morpholo-gy of calyptrate flies of veterinary and medical impor-tance (Aspoas 1991, Awad et al. 2003, Sukontason etal. 2003, Pérez-Moreno et al. 2006 and others).

Recently, a new approach has been introduced forspecies identification – DNA barcoding. DNA barcodinghas been proposed as a standardized approach to thecharacterization of life forms in numerous groups ofliving organisms (Hajibabaei et al. 2007). In animals,the selected region is the 5’-terminus of the mitochon-drial cytochrome c oxidase subunit I (COI) gene (He-bert et al. 2003). Moreover, DNA barcoding can be usedin species identification of all life stages and when onlytissue fragments are available for analysis.

The main aim of this study is to provide a thoroughmorphological documentation of the adult and theimmature stages of this flesh fly, and to estimate theCOI gene sequence.

Due to its being a culturophile and a synanthrope,the species occurs in all the zoogeographical regionsexcept Australia and New Zealand. In northern lati-tudes, it is closely associated with human habitations(Povolný and Verves 1997).

In this paper many SEM photographs of all theimmature stages of Sarcophaga (Liopygia) argyro-stoma (R.-D.) are presented for the first time.

MATERIAL AND METHODS

The larval material was obtained from femalescaught in the wild and kept in the laboratory. Thefemales were collected in Warsaw, central Poland, andidentified using Rohdendorf’s (1937, 1970) keys and the reference collection of the Museum and Institute of Zoology, Polish Academy of Sciences, Warsaw. Inorder to obtain larvae, freshly caught females werekept individually in 750 ml glass jars with poultry liver,with finely perforated lids. For a few days, the gravidfemales spontaneously and repeatedly larviposited.Some of the first instar larvae were killed in hot water(ca. 95°C) to extend the pseudocephalon and to avoidsubsequent deformation during storage in 75% alcohol.

When offspring were numerous, some larvae were given food in an attempt to rear them to older instars,which were then killed and preserved in the same way as the first instars. Poultry liver or meat were usedas food. Apart from second and third instar larvae,pupae and imagines of S. (L.) argyrostoma (R.-D.)were reared.

Preserved larvae were slide-mounted in pure glyc-erine for light microscopy. Concave slides were usedfor the first and second instars and the cephaloskele-ton of the third instar. Preparation for SEM includeddehydration in 80, 90 and 99.5% ethanol and critical-point drying in CO2. The first instar larvae and some ofthe second and third instars larvae were sputter-coated with platinum and SEM photos were taken byKrzysztof Szpila with the use of a HITACHI S-4700scanning electron microscope (Figs 16–28, 55–57, 61,62, 64–67, 83–93).

The light microscope illustrations (Figs 70–73) wereproduced by Krzysztof Szpila from photographs takenwith the use of a digital Nikon 8400 camera mounted ona Nikon Eclipse E200 microscope.

The remaining photographs of the second and thirdinstar larvae and pupae were coated with a gold-palla-dium mixture and examined in HITACHI S-3400N SEMat an accelerating voltage of 25 kV. Photographs (Figs53, 54, 78–82, 94–96, 101–120) were taken by Magdale-na Kowalewska-Groszkowska and (Figs 58–60, 63, 75–77, 97, 98) by Malwina Roszkowska. The remainingphotographs (Figs 1–15, 29–52, 68, 69, 74, 99, 100) weretaken with a LEICA IC3D by Piotr Ślipiński.

TTeerrmmiinnoollooggyy. Adult terminology follows Merz andHaenni (2000), except that term bristle is used todenote a particularly strong seta. Larval terminologyfollows Courtney et al. (2000) with a few modificationsproposed by Szpila and Pape (2005, 2007).

Wild adult specimens were collected in Warsaw,Poland. Flies were immediately killed and placed in96% ethanol and frozen at – 20°C until DNA extraction.

DDNNAA eexxttrraaccttiioonn.. Genomic DNA from entire thoraxof three individuals was extracted using a GenEluteMammalian Genomic DNA Purification Kit (Sigma-Aldrich, Inc., Milwaukee, WI) following the manufactur-er’s instructions. DNA was eluted in 100 µl H2O andtheir amount quantified on Spectronic Helios Betaspectrophotometer (Thermo Fisher Scientific, Inc.,Waltham, MA). Purified DNA was stored at -20°C inNational Plant, Fungi and Animal DNA Bank in Polandwww.bankdna.pl.

AAmmpplliiffiiccaattiioonn aanndd sseeqquueenncciinngg. The Folmer re-gion of cytochrome c oxidase 1 gene (COI) was ampli-fied using primers described by Simon et al. (1994) TY-J-1460 (5’-TACAATTTATCGCCTAAACTTCAGCC-3’)and C1-N-1840 (5’-AGGAGGATAAACAGTTCAYCC-3’) orC1-J-1751 (5’-GGATCACCTGATATAGCATTCCC-3’) andC1-N-2293 (5’-AGTAAACCAATTGCTAGTATAGC-3’).

466 A. DRABER-MOŃKO, T. MALEWSKI, J. POMORSKI, M. ŁOŚ and P. ŚLIPIŃSKI

PCR primers were purchased from IBB Oligo (Warsaw,Poland). Other PCR reagents were purchased from(Sigma-Aldrich, Inc., Milwaukee, WI). Each 50 µl PCRreaction mix was prepared using 25 µl 2x RedTaqReady Mix, 4 µl of 10 mM each primer, 4 µl DNAextract, and H2O to complete total 50 µl volume.

The thermal cycler (DNA Engine Dyad, Bio-RadLaboratories, Inc. Hercules, CA) program consisted ofan initial denaturation step of 95°C for 3 min, followedby 35 cycles of 94°C for 60 s, 45°C for 60 s and 72°C for90 s. The final cycle was the same as the previous oneexcept for an elongation step of 5 min duration.

Excess of dNTPs and unincorporated primers wereremoved from the PCR product was cleaned usingClean-Up Purification Kit (A & A Biotechnology, Gdy-nia, Poland). DNA was eluted in 40 µl H2O

The sequencing reactions consisted of 30 cycles of96°C for 20 s, 50°C for 20 s and 60°C for 4 min. Each 20µl reaction mix was prepared using 3 µl GenomeLabDTCS Start Mix (Beckman Coulter, Fullerton, CA), 2 µlof 1.6 mM primer, 10 µl of PCR product, and H2O tocomplete total 20 µl volume. All samples weresequenced with TY-J-1460, C1-N-1840, C1-J-1751, andC1-N-2293 primers in a forward direction. For sequenc-ing products cleaning to the reaction mix were added 2µl 3 M sodium acetate pH 4.8, 2 µl 0.1 M EDTA, 1 µlglycogen (Beckman Coulter, Fullerton, CA) and 60 µlfrozen 96% ethanol. Samples were centrifuged 15 minat 12 000 g at 4°C on centrifuge 5804R (Eppendorf AG,Hamburg Germany). Supernatant was carefully re-moved and DNA pellet washed with 150 µl of frozen70% ethanol. Samples were centrifuged 5 min at 12 000g at 4°C, supernatant removed and samples dried atroom temperature for 5 min. Dried samples were dis-solved in 36 µl of Sample Loading Solution (BeckmanCoulter, Fullerton, CA) Automated sequencing andsequence data analysis was conducted with CEQ 8000Beckman Coulter DNA sequencer (Fullerton, CA).Sequences were assembled with CAP3 program http:// pbil.univ-lyon1.fr/cap3.php [Huang and Madan1999]. DNA barcode was grafically depicted with FINGERPRINT program http://evol.mcmaster.ca/fingerprint/index.php [Lou and Golding 2007].

TAXONOMY

Genus SSaarrccoopphhaaggaa Meigen, 1826: 14

TTyyppee ssppeecciieess.. Musca carnaria Linnaeus, 1758,designated by Partington (1837: 697).

Subgenus Liopygia Enderlein, 1928: 41

TTyyppee ssppeecciieess.. Musca ruficornis Fabricius, 1794,by original designation.

SSaarrccoopphhaaggaa (LLiiooppyyggiiaa) aarrggyyrroossttoommaa(Robineau-Desvoidy, 1830)

Myophora argyrostoma Robineau-Desvoidy, 1830: 340, South Africa,Cape Province, Cape of Good Hope (Pape 1996: 346).

Adults

DDeessccrriippttiioonn. Body length 7–17 mm. Male (Figs 1–6).Body densely silvery grey or yellowish-white dusted(Figs 1–2). Head silvery white (Figs 5–6). Occiput, post-gena and partly gena with white hairs (Figs 1, 2, 5, 6).Gena with some black hairs on upper anterior part.Frontal vitta, antenna and palpus black. Frontal vittavelvet black with lateral margins light grey dusted. Pal-pus sometimes reddish brown distally. Pedicel distallyand base of 1st flagellomere brownish red. 1st flagellom-ere light grey dusted (Fig. 5). Thorax with grey pru-inescence and black or black brown longitudinalstripes (Fig. 1). Legs black with grey pruinescence,wing hyaline, with open cell R5 and basicosta light yel-low white (Fig. 1). Lower calyptra white.

Abdominal pattern chequered. Segment VII+VIIIblack or brownish red, lustrous, with grey pollinosity,epandrium shining red (Figs 2–4).

Frons at narrowest part 0.25 head width (Figs 1, 5).Frontal vitta moderately wider frontoventrally.1st fla-gellomere about twice as long as pedicel, and some-times 2.5 times longer than pedicel (Fig. 5). Parafacialat level of antennal base 0.2–0.3 and gena 0.22–0.34 ofeye height. Palpus long, distinctly widening apically. fr8–14, medium-length. 1–2 rows of postorbital setae. vtepoorly developed or indistinct, parafacial bristles weakand short, arranged in two vertical rows, the longestreach 0.4–0.5 of parafacial width. Facial ridge withnumerous short, black setae at lower 0.4–0.6. ac 0+1,long and weak; scutellum with short, crossed ap andstrong, long bas, subap, and discals setae. All fe-mora and hind tibiae on ventral side with long, densehairs; f1 often with hairy pv, f2 with rows of short av and pv (ctenidium), f3 with a row of strong av; t3 with numerous long av and pv. Costal spine small or absent, m-cu vein more or less sigmoid (Fig. 1); ratio of 3rd and 5th costal sections 1:0.5–0.8. Abdominaltergite III without medial marginal setae. Sternite Vwith numerous short marginal hair-like bristles andwith a large “window” (Fig. 4). Segment VII+VIII moderately elongate, with several hairy marginals(Figs 2, 3). Cerci angular at dorsal subapical marginand apically spinose. Surstyli distinctly thickenedalong basal margin. Aedeagus with a large distiphallus(Figs 2–4).

Female. (Figs 7–15). Lighter coloured (Figs 7–10).Frons equal to or slightly narrower than eye width (Fig.10). Frons narrowest part 1/3 of head width (Figs 7, 9,11). Orbital plates wide. Frontal stripe only 1.25–1.5

ON THE MORPHOLOGY AND MITOCHONDRIAL DNA BARCODING OF THE SARCOPHAGA (LIOPYGIA) ARGYROSTOMA 467

times wider than orbital plate. Palps at base brown-yellow, somewhat distended apically (Fig. 10).

Legs. Fore femur often with pv bristles hair-like.Fore femoral organ distinct and with a few cross-stria-tions. Mid femur with complete row of av and an apicalrow of short stout pv bristles. Mid-femur organ (Fig. 15)in the form of an elongate ovate patch, blackish greycoloured with diametrical lines, situated on posteriorsurface of mid femur. Mid femoral organ large withmany cross-striations. Hind trochanter with short stout setae ventromedially. Hind tibia with long pv andv hairs.

Abdominal tergite VI brown to reddish, grey dusted,complete, with long and short marginal bristles andhairs (Figs 7, 8,12). Sternite VII with marginal tuberclenear anterior margin and 1–2 pairs of short lateromar-ginals (Figs 12, 13). Female terminalia very short, darkred or brownish red, formed by undivided tergites VI–VIII with corresponding sternites, a pair of cerci, an epi-proct, and a hypoproct (Figs 12, 13). Three almost uni-form segmented spermathecae (receptacula seminis)pyriform (Fig. 14). S. (L.) argyrostoma is larviparus.

EEccoollooggyy. The flies visit decomposing substrates – faeces and carcasses – and feed also on flowers. The larvae develop in decaying meat or prey on flymaggots in faeces (Aldrich 1916, Rohdendorf 1937,Zakharova 1961, 1965, Leclercq 1976) and on liver(personal observation). In Belgium, Leclercq (1976)reported this species from a corpse in an advancedstate of putrefaction. In Great Britain (Smith 1986),Switzerland (Wyss 1997), Germany (Benecke 1998),Austria (Grassberger and Reiter 2002), Spain (Castillo2002) and Poland (Kaczorowska and Draber-Mońko2009) the species was reported as carrion fly; it is oneof the most im-portant species in forensic entomology.Larvae of S. (L.) argyrostoma were repeatedlyreported as agents of human cutaneous (wound) myia-sis (Tölg 1913, Sacca 1945, James 1947, Burgess 1966,Wenger and Hinaidy 1979, Zohdy and Morsy 1982,Burgess and Spraggs 1992) and of genitourinal (vagi-nal) myiasis (Aspöck and Leodolter 1970), as well as ofsecondary myiasis of sheep (Baranov and Ježič 1928,Trofimov 1957) and as vectors for pathogenes (Green-berg 1971). These flies were reared from the following:dead snails (Groth and Reismüller 1973), fish (Arta-manov 1987, and personal observation), cat faeces(Kühlhorn 1987), bird droppings (Yates 1967) and birdnests [Troglodytes aegon (McAtee 1927)], and nestsof Passer montanus (Draber-Mońko 1997), a deadpigeon (Woodroffe 1953); the larvae are predators oflarvae of Calliphora vicina (Draber-Mońko 2004),and predators and parasitoids of the following: snails(Lundbeck 1927), acridoid oothecae – Schistocercagregaria, S. paranensis, Dociostaurus maroc-canus (Séguy 1941), adults of Locusta migratoria(Rohdendorf 1937), scarabeid beetles (Melolontha

hippocastani – Rohdendorf 1937), Lachnosterna(Aldrich 1916), cerambycid beetles (Aelostes sorta –Povolný and Verves 1997), and pupae of Lymantriamonacha (Baer 1921, Slamečková 1961).

The pupal parasites are the following: Chalcididae –Brachymeris minuta; Eucoliidae – Eucolia trichop-sila (Sychevskaya 1964), Braconidae – Alysia man-ducator, Aphaereta minuta (Vinogradova and Zino-vyeva 1972, Zinovyeva and Vinogradova 1972, Povolnýand Verves 1997).

First instar larva

The general morphology of S. (L.) argyrostoma(R.-D.) was described on several occasions (see Intro-duction). The present description deals only with thestructures that were insufficiently described earlier.The first instar larvae of S. (L.) argyrostoma (R.-D.)are typical of Calyptratae (Figs 29–30) in having a dis-tinct pseudocephalon, three thoracic segments (termedTI–TIII below), seven abdominal segments (AI–AVII)and an anal division (AD) carrying the posterior spira-cles. Each abdominal segment (AI–AVII) has lateralcreeping welts (Figs 23, 25). The abdominal segmentshave one transverse ventral creeping welt each (Figs25). Body length 3.0–7.0 mm.

Pseudocephalon. Each lobe of the bilobed pseudo-cephalon bears on its antero-dorsal surface an anten-nal dome on a basal ring (Fig. 20) and a maxillary pal-pus (Figs 16–18). The length of the antenna is shorterthan the diameter of the maxillary palpus. The maxil-lary palpus is located on the anterior surface of thepseudocephalic lobe and has the form of concentricallyarranged rings clearly distinguished from the ambientcuticular surface (Figs 16–18). The maxillary palpushas a cluster of several sensilla in the center (Fig. 18),including three sensilla coeloconica placed on distinctsockets (SC1-3), three sensilla basiconica (SB1-3), andat least one elongated sensillum close to SC1 and SC2.In the vicinity of this cluster there are additional sensil-la coeloconica (AS1-2). The ventral surface of the pseu-docephalon bears some cirri and oral ridges that to-gether form a facial mask (Figs 16, 17, 21). Cirri closeto the functional mouth orifice are irregular (Fig. 21).Two oral ridges are situated just ventral (or posterior)to the cirri (Figs 17, 21). The oral ridges are character-istic of saprophagous flies. The labial lobe is small andwithout sensilla (Fig. 21). The ventral organ is small(Figs 17, 19) and situated level with the surface of thepseudocephalon (Fig. 35), laterally to the functionalmouth and above the oral ridges (Figs 17, 21). Thecephaloskeleton (Fig. 36) differs greatly from that ofthe next instars. It is much more slender and less chi-tinised. The cephaloskeleton consists of paired mouth-hooks, an unpaired intermediate sclerite and paired


dental sclerites, parastomal bars, paired vertical plateseach with ventral and dorsal cornua and dorsal bridge(Fig. 36). The mouth-hooks are equal in size andsharply pointed. Their tips are curved downwards. Thedental sclerites are very small, weakly sclerotised andlying on the outer side of each mouth hook. The inter-mediate sclerite is rather large and more or less wellsclerotised, located between and ventral to the paras-tomal bars (Fig. 36). The dorsal cornua are larger thanthe ventral ones and the vertical plate is wide. The dor-sal bridge is narrow and weakly sclerotised, but com-plete (Fig. 36).

Thoracic segments. Only the anterior margin of allthoracic segments has complete spinose bands (Fig.29). The anterior spinose bands of the first thoracicsegment are broad, with many rows of spines, especial-ly on the ventral and lateral surfaces (Figs 16, 17). Ventrally on TI–TIII there are paired Keilin’s organsconsisting of three trichoid sensilla situated in one pit(Fig. 22).

Abdominal segments. The anterior margin of seg-ments AI–AVI is armed with complete spinose bands(Figs 23, 26), narrowed dorsally on segment AVI (Fig.29). The anterior bands bear several rows of spines onall abdominal segments, with the number of rowsdecreasing toward the posterior end of the body, espe-cially dorsally and laterally. The posterior margin ofsegments AII–AVII is completely encircled with spines.The posterior bands have a single row (sometimes dou-bled) of spines on the lateral and ventral surfaces of AI.On segment AI some ventral and dorsal spines arepresent, but spines are absent from the lateral surfaceabove the lateral creeping welt (Fig. 29) (LCV). On seg-ment AII ventral spines and two or three dorsal rowsare present; such structures are absent from the later-al surface above the lateral creeping welt. On segmentAIII a lateral papilla is present (Fig. 24). Between thesegments there are lateral and ventral creeping weltscovered by spines (Fig. 25). A transverse crevice ispresent in the middle of each of segments AI–AVII (Fig.25). In each inter-segmental region there is a completering of black spines which are arranged in severalmore or less transverse rows. The spines at the anteri-or border are recurved posteriorly, while those at theposterior border are recurved anteriorly. The anal divi-sion has seven pairs of papillae (Figs 27, 28). The ante-rior-ventral surface of the anal division presents sever-al rows of spines (Figs 29, 31). The spiracular cavity issurrounded by a ring of hair-like spines (Figs 27, 28,31). The posterior spiracles (PS) (Figs 31–34) are situ-ated in a cavity and each consists of two relativelywide, nearly straight slits situated close together andmore or less vertical, surrounded by a very slightlysclerotized area (Fig. 28). The anal pad is situateddirectly posterior and ventral to the spiracular cavity.The anal papillae are large and oval. The tip of each

papilla is convex and equipped with a small sensillum(Figs 27, 28). The anal orifice (AO) is situated betweenthe anal papillae and slightly anterior to them (Fig. 27).

Forms intermediate between LI and LII

Body length 5.0 mm, width 0.8 mm. At the cephalo-skeleton of 1st instar larva there is a partly developedmouth hook of 2nd instar larva, not connected with any-thing yet (Fig. 37). The anterior spiracula are stillundeveloped. The arrangement of the setae, the struc-ture of the posterior spiracula and the posterior bodypart is like that in 1st instar larvae (Figs 29, 31).

Body length 7.0 mm, width 1.0 mm. Partly developedmouth hooks of 2nd instar larva are connected with thecephaloskeleton of 1st instar larva (Figs 38, 39). Theanterior spiracula are developed (Figs 38–40). Thearrangement of the setae, the structure of the posteri-or spiracula and the posterior body part is like that in1st instar larva (Fig. 41).

Body length 7.0 mm, width 1.0 mm. Completelydeveloped mouth hooks of 2nd instar larva are con-nected with the intermediate sclerite (Figs 42–45). Theanterior spiracula are well developed (Figs 44–45). Thearrangement of the setae, the structure of the posteri-or spiracula and the posterior body part is like that in1st instar larva (Figs 42, 46).

Yates (1967: 435–437, Fig. 2) described this develop-mental stage as 2nd instar larva. He regarded the pres-ence of four mouth hooks as a characteristic feature of2nd instar larva of S. (L.) argyrostoma (R.-D.): ”Thesecond instar occurs from approximately 20–60 hoursafter deposition and is easily distinguished by the pres-ence of 4 mouth hooks (2 pairs, Fig. 2).”

Second instar larva

Body length 7.0–13.0 mm, width ca. 1.5–2.0 mm. Theintegument is covered by various processes and spines(Fig. 47). In shape, 2nd instar generally resembles the1st instar larva (Figs 29–30) but there are some differ-ences in the following: the structure of the pseudo-cephalon and the cephaloskeleton, the presence of theanterior spiracula (Figs 49, 49a), the stronger andmore numerous spines (Figs 61–63), the structure ofthe posterior spiracula (Figs 51, 52, 67) and moredevelopped papillae on the last abdominal segment(anal division), as well as the size and shape of the analpad (Figs 47, 64–66).

Pseudocephalon. The head of this instar is very sim-ilar to that of the third instar larva. Each of the pseudo-cephalic lobes is provided with an antennal dome onthe basal ring and a maxillary palpus (Figs 55, 60). Thediameter of the basal ring of the antennal complex is


similar to that of the maxillary palpus. The maxillarypalpus is like that in the first instar. The ventral organsin the 2nd instar are similar to those seen in the 1st

instar (Fig. 56). The ventral organ situated above andlaterally to the functional mouth opening, appears as a globular structure with one strong spine (Fig. 57).The pseudocephalon lobes are large and located closeto each other (Fig. 55). The antennae are massive. Thefacial mask occupies a considerable anterior part ofthe pseudocephalon (Fig. 55). The mouth hooks are themost anterior sclerites of the cephaloskeleton (Fig. 49).The anterior part of each mouthhook has a downward-curved pointed tip. The basal part of the mouth hookbears lateral extensions. The postero-dorsal angle andthe antero-ventral angles of the mouth hook are drawnout into distinct processes. The dental sclerites beloweach mouth hook are weakly sclerotised. Behind theintermediate sclerite, the basal sclerite consists ofpaired parastomal bars, a complete dorsal bridge, ver-tical plates, and ventral and dorsal cornua. The paras-tomal bars extend far anteriorly above the intermedi-ate sclerite. Posteriorly the dorsal cornua are deeplyincised, the ventral cornua have a developed window(Fig. 49).

Thoracic segments. The anterior spiracle has a longfore chamber (Figs 48, 49, 49a, 58). Each anterior spir-acle contains a single row of branches consisting of 11or 12 oval and short branches (papillae, lobe) (Figs49a, 58, 59). Each lobe is composed of concentricallyarranged rings, covered by a flap which bears a nar-row, elongate slit (Fig. 59). The anterior spiracles aresimilar to the corresponding structure in the thirdinstar in their shape and number of lobes, but the forechambers are longer than in the 3rd instar. SegmentsTI–TIII have spine bands only anteriorly (Figs 47, 48,53, 54). The anterior spine bands of the first thoracicsegment are broad, with many rows of spines, especial-ly on the ventral and lateral surfaces (Figs 49, 55).

Abdominal segments. The abdominal segments arearmed with both anterior and posterior spine bands(Figs 47–50, 53, 61, 62). The spines of the inter-segmen-tal rings are more developed and more numerous. Seg-ment AI has its posterior spine bands equipped withonly few spines, the posterior spine bands of segmentsAII–AVII are equipped with several rows of spines. Theanterior spine bands bear several rows of spines on allabdominal segments, the number of rows decreasingtoward the end of the body, especially laterally and dor-sally. The distinct lateral creeping welts are covered byspines between the abdominal segments (Figs 61, 62).Ventrally, each of AI–AVII is equipped with a trans-verse furrow. Seven pairs of papillae (P1–P7) are pres-ent on the anal division. The antero-ventral surface ofthe anal division presents several rows of spines. Theanal pad is very big, laterally with triangular process-es and anal papillae (Figs 64–66). The spiracular cavity

is surrounded by a ring of black, small spines (Figs 64,65, 67). The anal papillae are developed as sphericalstructures (Figs 64–67). The posterior spiracles aremore developed, the peritreme is wide and the twospiracular slits are larger than in the first instar larva.Each spiracular plate bears two long, linear slits setalmost vertically, surrounded by an incomplete per-itreme. The inner slit is nearly straight and directedoutwards, while the outer slit is slightly curved med-ially and dorso-ventral. The outer slit is slightly long-er than the inner one (Figs 51, 52). The posterior spiracles are set in a pit deeper than in the first instar,but the fore chambers are shorter than in the firstinstar (Fig. 52). The posterior spiracular hairs (PSH)emanate from the margin of each slit near the middle(Fig. 67). In many places, the larval integument of thisinstar bears various processes and warts (Figs 61–63,66, 67).

Third instar larva

Body length 12–25 mm, width ca. 2.9–6.1 mm. Thecolour is dirty white to yellowish (Fig. 68). The larva isthe widest at the eighth body segment. The integumentis covered by various processes and spines (Figs 72,85–98), more strongly developed than in 2nd instar larvae. In shape the third instar generally resemblesthe second instar (Figs 47), but there are some differ-ences in the following: the structure of the pseudo-cephalon and the cephaloskeleton (Figs 69, 70), thestructure of the anterior spiracula (Figs 71, 84),stronger and more numerous spines (Figs 85–88), thestructure of the posterior spiracula (Figs 73, 74) andmore developed of papillae on the last abdominal seg-ment (anal division), as well as size of the anal pad(Figs 89, 90, 92, 94).

Pseudocephalon. The head of this instar is very sim-ilar to that of the previous one (Figs 75–80). The twopseudocephalic lobes are markedly separated by a deepgroove (Fig. 76). Each bears an antennal dome on thebasal ring and a maxillary palpus (Figs 75–77, 83)which is composed of several sensilla. The maxillarypalpus is like that in the first instar. Numerous cirricover the ventral sides of both pseudocephalic lobes(Figs 75, 76, 80). The cephaloskeleton is more robustthan in the second instar, but has the same generalshape; it is strongly chitinised and all the sclerites arenearly black in colour (Figs 69, 70). The apical part ofeach mouth hook has the form of a down-curved, point-ed hook. The posterior part of each hook is consider-ably thicker than the anterior part. The dental scleritesare located below the massive basal part of the mouthhooks, each lies on the ventral and lateral side of eachhook. Behind the mouth hooks there is the intermedi-ate sclerite, with very thick and simple-edged lateral


portions. Behind the intermediate sclerite, the basalsclerite consists of paired parastomal bars, a completedorsal bridge, vertical plates, and ventral and dorsalcornua. The dorsal cornua are longer than the ventralones (Figs 69, 70). The parastomal bars extend faranteriorly above the intermediate sclerite. The ventralcornua have a developed window (Fig. 70); the dorsalcornua are deeply incised posteriorly, the incisionoccupying more than half of their total length.

Thoracic segments. The anterior spiracle is fan-shaped (Figs 70, 71, 84, 115, 116), with a short forechamber, consisting of 11 or 12 oval and short branch-es (Figs 71, 116). Segments TI–TIII are equipped withspine bands only anteriorly (Figs 68, 70, 76, 78–81).The anterior spine bands of the first thoracic segmentare broader than in the previous instars, and thespines are arranged alternately in over a dozen or sev-eral dozen rows (Figs 68, 80). In living larvae, they areall black in colour, in prepared slides, most of themappear pale yellow. On the dorsal side of TI, just poste-rior to the spine row, a rectangular elevation is pres-ent, in older larvae to a considerable extent covered inspines (Figs 78, 79). On the dorsal side of TIII, a fewsmall papillae are present (Fig 97).

Abdominal segments. The dorsal side of segmentsA1–AVII bears from a few to about a dozen papillae(Figs 68, 85, 87, 97, 98). The cuticle on most of the lar-va body is covered in processes of various shapes andtypes (Figs 86–90). Ventrally each of segments A1–AVIIare equipped with transverse ventral creeping welts(Figs 81, 82). Laterally, each of segments A1–AVII havedistinct creeping welts covered by rows of spinesbetween the abdominal segments (Figs 68, 81, 82). Thelast abdominal segment (Figs 68, 82) differs in shapeand structure from the other segments. It slightlytapers posteriorly and most of its posterior surface is adeep cavity in which the posterior spiracles lie. Theedge of the cavity bears 7 pairs of conical papillae (P1-P7) (Figs 91–94), the middle pair of which is the largest.The spiracular cavity is surrounded by a ring of black,small spines. The anal pad is very big, laterally with tri-angular processes and anal papillae. The anal papillae(P7) are developed as spherical structures (Figs 89, 90,92–96), situated postero-laterally to the anal orifice(Figs 82, 89, 90, 92, 94). The posterior spiracles are welldeveloped. They are located slightly dorsally to themidline on the anal division, within a deep cavity. Eachspiracle has 3 linear slits, one straight and two slight-ly curved (Figs 73, 74, 93). The peritreme is dark brownin colour and not uniform in thickness. Around the slits the peritreme is incomplete, with spaces at about5 and 7 o’clock respectively on the left and right spiracles. The peritreme has dorsal extensions thatprotrude between the tops of the slits (Fig. 74), andthere is no button. The spiracular distance factor is0.38.

Puparium

Length ca. 10–15 mm. The puparium is typical of thepupae coarctatae, with a tapering posterior end and a nearly rounded anterior end (Figs 99–102). Thecolour of the pupa barrel immediately after pupation ispale yellowish, then it changes to bright orange andgradually darkens until finally becomes dark reddish-brown or nearly blackish in colour. The anterior spira-cles of the 3rd instar larva appear as minute processessituated anteriorly (Figs 103,104). When the pupaopens, the anterior spiracula remain ouside the upperflap (Figs 114–116). On the lower flap, the place of theretraction of nearly two anterior segments of the 3rd

instar larva is visible (Figs 117, 118), and the cepha-loskeleton of the last instar larva remains attached toits internal wall (Fig. 119). The larval spines remainvisible (Figs 103, 104, 112) and the larval tubercles onthe posterior segment (Figs 105–114, 120). The larvalposterior spiracles also remain visible within thespiracular cavity (Figs 109, 120). The posterior spira-cles form two flat button-like structures situated at the bottom of a deep groove, corresponding to those of the larva, in the last body segment. The larval posterior spiracles may be sometimes hard to see. The small fleshy processes of this segment in the larvaare very small and contracted (Figs 106, 107, 110, 111,120).

The borders between the segments appear as con-tinuous lines which are more distinct in the middleregion of the puparium (Figs 101–103, 105–108). Alongthese lines there are broad transverse bands of minuteblack spines (Fig. 101, 106). Each band lies in an inter-segmental position and appears to be composed of anupper, middle and lower narrower bands (Figs105–107). Besides theses bands, numerous transversewrinkles, papillae, sensilla and processes are presenton the puparium surface (Figs 106, 112, 113).

The sequence of mitochondrial cytochrome coxidase subunit I (COI)

Over 700 bp of the COI mtDNA gene were obtainedfor three individuals with primers C1-J-1751, TY-J-1460and C1-N-1840 and are presented below:

MIIZ-TM-3TATTGGAACTTTATATTTTATTTTCGGAGCTTGAGC

AGGAATAGTAGGAACTTCACTAAGAATCCTAATTCAGACAGAACTAGGTCACCCTGGTGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATCATAATTGGAGGATTTGGAAACTGACTAGTTCCAATTATACTAGGAGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCTGCATTAACATTACTACTAGTAAGTAGTAT


AGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCTCCTTTATCATCTAATATTGCTCATGGATGAGCTTCTGTTGATCTAGCTATTTTTTCTCTTCACTTAGCTGGAATTTCTTCAATTTTAGGAGCAGTAAATTTTATTACTACAGTAATTAATATACGATCTACAGGTATTACTTTTGATCGAATACCCCTTTTTGTTTGATCAGTAGTAATTACCGCTTTACTTCTCCTTCTATCCCTACCCGTACTTGCAGGAGCAATTACTATATTATTAACTGACCGAAATATTAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTCTATATCAACACTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACC

MIIZ-TM-5ATATTGGAACTTTATATTTTATTTTCGGAGCCTGAG

CAGGAATAGTAGGAACTTCACTAAGAATTCTAATTCGAGCAGAACTAGGTCACCCTGGTGCATAAATGGGAGATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATCATAATGGGAGGATTGGGAAACTGACTAGTTCCAATTATACTAGGAGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCTGCATAAACATTACTACTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCTCCTTTATCATCTAATATAGCTCATGGAGGAGCTTCTGTTGATCTAGCTATGTTTTCTCTTCACTTAGCTGGAATTTCTTCAATTTTAGGAGCAGTAAATATTATTACTACAGTAATTAATATACGATCTACAGGTATTACTTTTGATCGAATACCCCTTTTTGTTTGATCAGTATAAATTACCGCTTTACTTCTCCTTCTATCCCTACCCGTACTTGCAGGAGCAATTACTATATTATTAACTGACCGAAATATTAATACTTCATTTTTTGATCCATCACGAGGAGGAGATCCAATTCTATATCAACACTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTT

MIIZ-TM-18GATATTGGAACTTTATATTTTATTTTCGGAGCTTGA

GCAGGAATAGTAGGAACTTCACTAAGAATCCTAATTCGAGCAGAACTAGGTCACCCTGGTGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATCATAATTGGAGGATTTGGAAACTGACTAGTTCCAATTATACTAGGAGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCTGCATTAACATTACTACTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCTCCTTTATCATCTAATATTGCTCATGGAGGAGCTTCTGTTGATCTAGCTATTTTTTCTCTTCACTTAGCTGGAATTTCTTCAATTTTAGGAGCAGTAAATTTTATTACTACAGTAATTAATATACGATCTACAGGTATTACTTTTGATCGAATACCCCTTTTTGTTTGATCAGTAGTAATTACCGCTTTACTTCTCCTTCTATCCCTACCCGTACTTGCAGGAGCAATTACTATATTATTAACTGACCGAAATATTAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTCTATATCAACACTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACC

Sequenced fragments fulfill barcode standards(Hanner 2005). Low intraspecies variability of COI

allows limit number to three specimens for barcodeestablishment. Specimens MIIZ-TM-3 and MIIZ-TM-18show 4 nucleotide sequence differences, MIIZ-TM-5and MIIZ-TM-18: 14, and MIIZ-TM-3 and MIIZ-TM-5:18, accordingly. Nucleotide sequence differences be-tween specimens varied between 0.6–2.6%. Graphicaldepiction of barcodes is presented in Fig. 121.

DISCUSSION

In our climatic zone, S. (L.) argyrostoma (R.-D)stays mainly near human habitations. It often visitsflats, attracted by the smell of decomposing animal pro-tein. Its larvae were found on the 9th of June 1997, ona corpse of a clothed and blanket-covered man in a flatin Lublin (forensic expertise by Dr Maria Grochowska,UMCS). Seven 3rd instars larvae of Calliphora vi-cina R.-D. and two 3rd instars larvae of Sarcophaga(L.) argyrostoma (R.-D.) were studied. The man diedduring a heat wave in a south-facing flat. The estimat-ed period of the development of the larvae studied was8–9 days.

The length of the development of S. (L.) argyro-stoma (R.-D.) in Vienna was reported by Grassbergerand Reiter (2002), that in St. Petersburg – by Mar-chenko (1980). In Warsaw, in the dark and at a con-stant temperature of 23°C, the development to thepupal stage lasted 10 or 11 days, the pupal stage – from16 to 23 days. The larvae were reared on poultry liver.In St. Petersburg, at a constant temperature of 23°C,the development from the 1st instar larva to imago last-ed 22.5 days, in Vienna, at a constant temperature of25°C, the larval development to the pupal stage lasted 8 days, and of 20°C – 12.3 days. The data on larvaldevelopment at the same and at different temperaturesvary. The reasons may be due to various factors, suchas the geographical position, the season, the lightingregime, or the kind and availability of food.

Sequence of MIIZ-TM-18 specimen has 100% identi-ty to the previously reported sequence AF259512 froma single specimen (Wells et al. 2001), MIIZ-TM-3 99%and MII-TM-5 98%, accordingly. Short fragment fromdistal part of COI (GenBank AY315643) was sequencedby Zehner et al. (2004), but it is located outside stan-dard barcode region and sequence deposited inAF259512 file. The consensus sequence derived fromthree specimens in this study fulfills the DNA barcod-ing standards and can be used for species identifica-tion by molecular methods.

ACKNOWLEDGEMENTS

We especially thank Dr. Krzysztof Szpila forpreparing and taking many SEM photographs. We are


also very grateful to Dr. Magdalena Kowalewska-Groszkowska and Ms Malwina Roszkowska, M.Sc. inBiology, for taking some SEM photographs. We areindebted also to anonymous revivers for their valuablesuggestions.

REFERENCES

Abou-El Ela, R. G. and A. M. El-Gindi. 1999. The larval head ofParasarcophaga argyrostoma (Robineau-Desvoidy)and its musculature (Diptera: Sarcophagidae). Journal ofthe Egyptian/German Society of Zoology, 30(E): 133–141.

Aldrich, J. M. 1916. Sarcophaga and allies in North Amer-ica. The Thomas Say Foundation., La Fayette. 1. 1–301 +[1 (postscript)] + [3 (index)].

Artamanov, S. D. 1987. Grey flesh flies (Fam. Sarcophagidae).In: R. G. Soboleva. The insects and mites of Far East,which have medical and veterinary importance. Lenin-grad: 102–119 (in Russian).

Aspoas, B. R. 1991. Comparative micromorphology of third in-star larvae and the breeding biology of some AfrotropicalSarcophaga (Diptera: Sarcophagidae). Medical and Vete-rinary Entomology, 5: 437–445.

Aspöck, H. and I. Leodolter.1970. Vaginale Myiasis durch Sar-cophaga argyrostoma. Wiener Klinische Wochenschrift,82: 518–520.

Awad, A., Abdel-Salam, S., Abou-El Ela, R. G., Abdel-Aal, A.and D. Mohamed. 2003. Ultrastructure comparison of thesensory morphology of the first- and third-instar larvae ofParasarcophaga argyrostoma (Robineau-Desvoidy)(Diptera: Sarcophagidae). Egyptian Journal of Biology, 5:148–154.

Baer, N. 1921. Die Tachiniden als Schmarotzer der schäd-lichen Insekten. Zeitschrift für angewandte Entomologie,7: 349–423.

Baranov, N. and J. Ježič. 1928. Fliegenmaden als Wund-schmarotzer bei den Haustieren in Südserbien. Zeitschriftfür Parasitenkunde, 1: 416–422.

Benecke, M. 1998. Six forensic entomology cases: descriptionand commentary. Journal of Forensic Sciences, 43:797–805.

Burgess, N. R. 1966. A case of human myiasis in London.Transactions of the Royal Society Tropical Medicine andHygiene, 60: 432–433.

Burgess, I. and P. D. R. Spraggs. 1992. Myiasis due to Para-sarcophaga argyrostoma – first recorded case in Bri-tain. Clinical and Experimental Dermatology, 17: 261–263.

Castillo Miralbes, M. 2002. Estudio de la entomofauna asocia-da a cadavers en el Alto Aragón (Espańa). MonografiasS.E.A. Sociedad Entomológica Aragonesa, 6: 1–8, 9–94.

Courtney, G. W., Sinclair, B. J. and R. Meier. 2000. 1.4. Mor-phology and terminology of Diptera larvae. In: Papp, L.and B. Darvas (eds): Contributions to a Manual of Pa-laearctic Diptera (with special reference to flies economicimportance). General and Applied Dipterology. 1: 85–161.Science Herald, Budapest.

Draber-Mońko, A. 1973. Przegląd krajowych gatunków z ro-dziny Sarcophagidae (Diptera). Fragmenta Faunistica,19: 157–225.

Draber-Mońko, A. 1982. Sarcophagidae and Rhinophoridae

of Warsaw and Mazovia. Memorabilia Zoologica, 35:131–140.

Draber-Mońko, A. 1991. Muchówki z rodziny Sarcophagidae(Diptera) Krainy Świętokrzyskiej. (Fauna Gór Święto-krzyskich IX). Fragmenta Faunistica, 35: 89–121.

Draber-Mońko, A. 1997. Protocalliphora azurea (Fall.) (Dip-tera, Calliphoridae) and other insects found in nests ofsparrows, Passer domesticus (L.) and Passer monta-nus (L.) in the vicinity of Warsaw. International Studieson Sparrows, 22–23: 3–10.

Draber-Mońko, A. 1998. Muchówki (Diptera) z rodzin Sar-cophagidae i Rhinophoridae oraz uzupełnienie Cal-liphoridae Roztocza. Fragmenta Faunistica, 41: 77–92.

Draber-Mońko, A. 2004. Calliphoridae. Plujki. (Insecta: Dip-tera). Fauna Polski. 23. Fundacja Natura optima dux.Warszawa, 662 pp.

Enderelein, G. 1928. Klassifikation der Sarcophagiden. Sar-cophagiden-Studien I. Archiv für Klassifikatorirische undPhylogenetische Entomologie, Vienna, 1: 1–56.

Fan, Z. and T. Pape. 1996. Checklist of Sarcophagidae (Dipte-ra) recorded from China. Studia dipterologica, 3: 237–258.

Grassberger, M. and C. Frank. 2004. Initial study of arthropodsuccession on pig carrion in a Central European urbanhabitat. Journal of Medical Entomology, 41: 511–523.

Grassberger, M. and C. Reiter. 2002. Effect of Temperature onDevelopment of Liopygia ( = Sarcophaga) argyros-toma (Robineau-Desvoidy) (Diptera: Sarcophagidae) andits Forensic Implications. Journal of Forensic Sciences,47: 1–5.

Greene, C. T. 1925. The puparia and larvae of Sarcophagidflies. Proceedings of the United States National Museum.Washington, 66: 1–26.

Greenberg, B. 1971. Flies and Disease. 1, Priceton UniversityPress. Princeton, New Jersey, 856 pp.

Groth, U. and H. Reismüller. 1973. Beziehungen synanthroperFliegen zu Kleintierleichen. I. Teil: Methodik, Vor- undHauptversuche. Angewandte Parasitologie, 14: 83–100.

Hafez, M. 1940. A study of the morphology and life history ofSarcophaga falculata Pandellé [Diptera: Sarcophagi-dae]. Bulletin de la Societé Fouad 1er d’Entomologie, 24:183–213.

Hajibabaei, M., Singer, G. A., Hebert, P. D. and D. A. Hickey.2007. DNA barcoding: how it complements taxonomy,molecular phylogenetics and population genetics. Trendsin Genetics, 23(4): 167–172.

Hanner, R. 2005. Proposed Standards for BARCODE Recordsin INSDC (BRIs) Database Working Group, Consortium forthe Barcode of Life. http://barcoding.si.edu/PDF/DWG_data_standards-Final.pdf

Hebert, P. D., Cywinska, A., Ball, S. L. and J. R. deWaard.2003. Biological identifications through DNA barcodes.Proceedings of the Royal Society B: Biological Sciences,270(1512): 313–321.

Huang, X. and A. Madan. 1999. CAP3: A DNA sequence assem-bly program. Genome Research, 9: 868–877.

James, M. T. 1947. The flies that cause myiasis in man. Unit-ed States Department of Agriculture. Miscellaneous Publi-cation, 631: 1–175.

Kaczorowska, E. and A. Draber-Mońko. 2009. Wprowadzeniedo entomologii sądowej. Wydawnictwo UniwersytetuGdańskiego, 292 pp.


Knipling, E. F. 1936. A comparative study of the First-instarlarvae of the genus Sarcophaga (Calliphoridae, Diptera),with notes on the biology. Journal of Parasitology, 22:417–454.

Kühlhorn, F. 1987. Über den Dipterenbeflug von Katzenkotund dessen mögliche hygenische Bedeutung. AngewandteParasitologie, 28: 93–101.

Lecqlercq, M. 1976. Entomologie et medicine legale: Sarcopha-ga argyrostoma Rob.-Desv. (Dipt., Sarcophagidae) etPhaenicia sericata Meig. (Dipt. Calliphoridae). Bulletin etAnnales de la Société Royale Belge d’Entomologie, 112:119–126.

Lehrer, A. Z. 2006. Une espèce nouvelle de ParaphrissopodaTownsend et quelques remarques sur la variabilité deP. pexata Auct. (Diptera, Sarcophagidae). FragmentaDipterologica, 3: 1–30.

Lou, M., and G. B. Golding. 2007. FINGERPRINT: Visual depic-tion of variation in multiple sequence alignments. Molecu-lar Ecology Notes, 7(6): 908–914.

Lundbeck, W. 1927. Diptera danica, genera and species of flieshitherto found in Danmark, part 7, Platypezidae, Tachi-nidae. Copenhagen, 571 pp.

Marchenko, M. I. 1980. Classyfying of cadaveric entomofauna.Flies biology: the forensic medical role. Sudebno-Meditsin-skaya Ekspertiza, 23: 17–20. (In Russian).

McAtee, W. 1927. Notes on the insects inhabiting of bird hous-es. Proceedings of the Entomological Society of Washing-ton, 29: 87–90.

Meigen, J. W. 1826. Systematische Beschreibung der bekan-nten europäischen zweiflügeligen Insekten. Fünfter Theil.Schulz, Hamm. xii + 412 pp.

Merz, B. and J. P. Haenni. 2000. 1.1. Morphology and terminol-ogy of adult Diptera (other than terminalia). In: Papp, L.and B. Darvas. (eds): Contributions to a Manual of Palae-arctic Diptera (with special reference to flies economicimportance). General and Applied Dipterology, 1: 21–51.Science Herald, Budapest.

Pape, T. 1996. Catalogue of the Sarcophagidae of the world(Insecta: Diptera). Memoirs on Entomology, International,8, 558 pp.

Parchami-Araghi, M., Peris, S. V. and D. Gonzáles-Mora. 2001.New records of Iranian Calliphoridae and Sarcophagidae,with a guide to the males of Palaearctic Protocalliphora(Diptera, Calyptratae). Boletin de la Real SociedadEspanola de Historia Natural (Seccion Biologica), 96:175–181.

Partington, C. F. 1837. The British cyclopaedia of natural his-tory: combining a scientific classification of animals,plants and minerals; with a popular view of their habits,economy, and structure, by authors eminent in their par-ticular department. Third volume. [Part 37, pp. 577–640.Rosaceae-Seal.] London.

Pérez-Moreno, S., Marcos-García, M.A. and S. Rojo. 2006.Comparative morphology of early stages of two Mediter-ranean Sarcophaga Meigen, 1826 (Diptera: Sarcophagi-dae) and a review of the feeding habits of Palaearcticspecies. Micron, 37: 169–179.

Peris, S.V., Gonzáles-Mora, D. and E. Mingo. 1999. LosParasarcophagina (Diptera, Sarcophagidae) de la Penín-sula Ibérica. Boletin de la Real Sociedad Espanola de His-toria Natural (Seccion Biologica), 95: 115–134.

Povolný, D. and Y. Verves. 1997. The Flesh-Flies of CentralEurope (Insecta, Diptera, Sarcophagidae). Spixiana. Zeit-schrift für Zoologie, Supplement 24: 1–264.

Robineau-Desvoidy, J. B. 1830. Essai sur les Myodaires.Mémoires présentés par divers Savans á l’ Académie Roy-ale des Sciences de l’Institut de France. Science Mathéma-tiques et Physiques, Ser. 2, 2: 1–813.

Rohdendorf, B. B. 1937. Sem. Sarcophagidae. (č.1). Sarcopha-ginae. Fauna SSSR. Nasekomye dvukrylye. T. 19, vyp. 1.Izdatelstvo Akademii Nauk SSSR, Moskva – Leningrad.501 pp. (In Russian with German summary).

Rohdendorf, B. B. 1970. Sem. Sarcophagidae – sarkofagidy.In: Bei-Benko G. Ya. (ed.). The keys to the Insects of theEuropean part of the USSR, 5 (2): 624–670. (In Russian).

Sacca, G. 1945. Miasi da Sarcophaga falculata Pand. Rendi-conti dell’Istituto Superiore di Sanita. Rome, 8: 301–302.

Séguy, E. 1941. Études sur les mouches parasites. 2. Calli-phorides, Calliphorines (suite), Sarcophagines et Rhino-phorines de l’Europe occidentale et méridionale. Recher-ches sur la morphologie et la distribution géographiquedes Diptères à larves parasites. Encyclopédie Entomo-logique. (Série A), 21: 1–436.

Simon, C. F., Frati, F., Becenbach, A., Crespi, B., Liu, H. and P.Flook. 1994. Evolution, weighting, and phylogenetic utilityof mitochondrial gene sequences and a compilation of con-served polymerase chain reactions primers. Annals of theEntomological Society of America, 87(6): 651–701.

Slamečková, M. 1961. Prispevok k rozšreniu mäsiarok (Sar-cophagidae, Diptera) niektorých localít južného a východ-ného Slovenska. Biológia, 16: 586–595.

Smith, K. G. V. 1986. A manual of forensic entomology. BritishMuseum of Natural History, Cornell University Press, Lon-don. 205 pp.

Sukontason, K., Sukontason, K. L, Piangjai, S., Chwaiwong, T.,Boonchu, N., Kurahashi, H. and R. C. Vogtsberger. 2003.Larval ultrastructure of Parasarcophaga dux (Thom-son) (Diptera: Sarcophagidae). Micron, 34: 359–364.

Szpila, K. and T. Pape. 2005. The first instar larva of Apo-dacra pulchra (Diptera: Sarcophagidae, Miltogrammi-nae). Insect Systematics and Evolution. 36: 293–300.

Szpila, K. and T. Pape. 2007. Rediscovery, redescription andreclassification of Beludzhia phylloteliptera (Diptera:Sarcophagidae: Miltogramminae). European Journal ofEntomology. 104: 119–137.

Sychevskaya, V. I. 1964. Hymenopterous parasites of synan-thropic flies in Mid Asia. Entomologicheskoe obozrenie.43: 391–404. (In Russian, English summary).

Thompson, W. R. 1921. Recherches sur les Diptères parasites.I. Les larves des Sarcophagidae. Bulletin Biologique de laFrance et de la Belgique. 54: 313–463.

Tölg, F. 1913. Biologie und Morphologie einiger in Nonnenrau-pen schmarotzender Fliegenlarven. Zentrallblatt (Cen-tralblatt) für Bacteriologie, Parasitenkunde, Infektion-skrankheiten und Hygiene. Jena, Abt. 2, 37: 392–412.

Trofimov, G. K. 1957. A case of myiasis of sheep, produced bylarvae of flies Parasarcophaga parkeri Rohd. and P. se-curifera Vill. In: Transcaucasus. Entomologicheskoe obo-zrenie. 36: 652–654. (In Russian, English summary).

Vinogradova, E. B. and K. B. Zinovyeva. 1972. Regulation ofseasonal development of parasit of flesh-flies. IV. The peculiarities of fotoperiodic reactionin in Alysia



manducator Panz. (Hymenoptera, Braconidae). Host-parasitar. Relationships in insects. Leningrad: 112–117.(In Russian, English summary).

Wells, J. D. and F. A. H. Sperling. 2001. DNA-based identifi-cation of forensically important Chrysomyinae (Diptera:Calliphoridae). Forensic Science International, 120:110–115.

Wenger, R. and H. K. Hinaidy. 1979. Über Wundmyiasis desMenschen in Österreich. Wiener Klinische Wochenschrift.91: 378–380.

Woodroffe, G. E. 1953. An ecological study of the insects andmites in the nests of certain birds in Britain. Bulletin ofEntomological Research. 44: 739–772.

Wyss, C. 1997. Forensic Entomology in Lausanne (Ch).Oistros. A newsletter for Calliphoridae, Oestridae, Rhino-phoridae and Sarcophagidae. 5: 2–5.

Yates, J. R. 1967. Immature Stages of the Flesh Fly, Parasar-cophaga (Thomsonea) argyrostoma (Robineau-Des-voidy). Pocedings of the Hawaiian Entomological Society,19: 433–440.

Zakharova, N. F. 1961. Ecology and epidemiological impor-tance of synanthropic species of the family Sarcophagidae

in Turkmenia. Meditsinskaya Parazitologiya i Parazitar-nye Bolezni. (Medical Parasitology and Parasitic Dise-ases), 30: 208–214. (In Russian).

Zakharova, N. F. 1965. On the ecology of flies of family Sar-cophagidae (Diptera). Meditsinskaya Parazitologiya i Pa-razitarnye Bolezni. (Medical Parasitology and ParasiticDiseases), 34: 533–540. (In Russian).

Zehner, R., Amendt, J., Schütt, S., Sauer, J., Krettek, R. and D.Povolný. 2004. Genetic identification of forensically impor-tant flesh flies (Diptera: Sarcophagidae). InternationalJournal of Legal Medicine 118: 245–247.

Zinovyeva, K. B. and E. B.Vinogradova. 1972. The regulationof seasonal development of the parasites of flesh-flies. III.The peculiarities of photoperiodical reaction in Aphaere-ta minuta Nees (Hymenoptera, Braconidae) – Host-para-site relationships in insects. Leningrad: 100–111. (In Russ-ian).

Zohdy, N. Z. and L. E. Morsy. 1982. On the biology of the greyflesh fly. Parasarcophaga argyrostoma Robineau-Desvoidy). Journal of the Egyptian Society of Parasitology.12: 85–95.

Received: September 9, 2009Accepted: November 31, 2009


Figures 1–6. Sarcophaga (Liopygia) argyrostoma (R.-D.), male (photo by P. Ślipiński). (1) Dorsal view; (2) lateral view; (3) terminalia, left lateral view; (4) terminalia, ventral view, s- male sternite V; (5) head, frontal view; (6) head, dorsal view.

1

2

3

4

5

6


7

8

9

10

11

Figures 7–11. Sarcophaga (Liopygia) argyrostoma (R.-D.), female (photo by P. Ślipiński). (7) Dorsal view; (8) lateral view; (9) head, frontal view; (10) head, right lateral view; (11) head, dorsal view.


Figures 12–15. Sarcophaga (Liopygia) argyrostoma (R.-D.), female (photo by P. Ślipiński). (12) Abdomen, ventral view; (13) terminalia, ventral view; (14) receptacula seminis, A – spermathecal duct; (15) mid femur, o – femoral organ, right lateral view.

A

O

12

13

1415


16

17

18 19

20 21

22

ANMP

MH

LO

LL

VO

OR

CIMO

AS2AS1

SC1

ES

SC2

SC3

SB2

SB3

SB1

MOMHVO

CI

OR

LO

LL

Figures 16–22. Sarcophaga (Liopygia) argyrostoma (R.-D.), first instar larva (photo by K. Szpila). (16) Anterior end of body, antero-lateral view;(17) anterior end of body, ventral view; (18) maxillary palpus; (19) ventral organ; (20) antennal complex; (21) functional mouth orifice; (22) Keilinsorgan on the first thoracic segment. Abbreviations: AN – antennal complex; AS1 – first additional sensillum coeloconicum; AS2 – second additionalsensillum; CI – cirri; ES – elongated sensillum; LL – labial lobe; LO - labial organ; MH – mouthhook; MO – functional mouth orifice; MP – maxillarypalpus; OR – oral ridges; SB1 – first sensillum basiconicum; SB2 – second sensillum basiconicum; SB3 – third sensillum basiconicum; SC1 – first

sensillum coeloconicum; SC2 – second sensillum coeloconicum; SC3 – third sensillum coeloconicum, VO – ventral organ.

Figures 23–28. Sarcophaga (Liopygia) argyrostoma (R.-D.), first instar larva (photo by K. Szpila). (23) Fourth abdominal segment, dorsal view;(24) third abdominal segment, lateral view, lateral papilla; (25) third abdominal segment, ventral view; (26) third abdominal segment, spinulation,anterior spinose band, ventral surface; (27) posterior end of body, ventral view; (28) posterior end of body, posterior view. Abbreviations: AO – analopening; AP – anal papilla; CR – transverse crevice; HLS – hair–like spines; LCV – lateral creeping velt; P1 – dorsal papilla; P2 – subdorsal papilla;P3 – supralateral papilla; P4 – infralateral papilla; P5 – subventral papilla; P6 – ventral papilla; P7 – supraventral papilla; PS – posterior spiracles;

SC – spiracular cavity; VCV – ventral creeping welt.

23 24

25

26

27

28

LCV

VCV

CR

HLS

SCP

AP

AO

P1

SC

PS

P3

P5

P7

P6

AP

P2

P4



Figures 29–36. Sarcophaga (Liopygia) argyrostoma (R.-D.), first instar larva (photo by P. Slipiński). (29) Habitus, lateral view; (30) habitus,dorsal view; (31) posterior end of body; (32) posterior spiracles, with long fore chamber; (33) posterior spiracles; (34) posterior spiracles, enlarged;(35) anterior part of body; (36) anterior part of body, cephaloskeleton, lateral view;. Abbreviations: AI–AVII – abdominal segments; AD – analdivision; DC – dorsal cornua; IS – intermediate sclerite; MH – mouthhooks; PB – parastomal bar; Pn – pseudocephalon; TI– TIII – thoracic segments;

VC – ventral cornua; VP – ventral plate.

29

32

33

31

30

34

35 36

AIII III IV V VI

AVIIAD

TI TII TIIIPn

MHPB DC

VCVPIS


Figures 37–46. Sarcophaga (Liopygia) argyrostoma (R.-D.), intermediates between instars I and II (photo by P. Ślipiński). (37) Anterior part ofbody, cephaloskeleton, lateral view; (38) habitus, lateral view; (39) anterior part of body, cephaloskeleton, lateral view; (40) anterior spiracle; (41) posterior spiracles; (42) habitus, lateral view; (43) anterior part of body, lateral view; (44) habitus, dorsal view; (45) anterior part of body, lateral

view; (46) posterior part of body with posterior spiracles. Abbreviations: AS – anterior spiracle; MH1 – mouthhook LI, MH2 – mouthhook LII.

37

38

40 39

41 42

43

44

45

46

MH2

MH1

MH2

MH1AS

AS

MH2

MH1

MH1

MH2

AS

MH1

MH2

AS

MH1

MH2

AS

MH1

MH2

AS


Figures 47–52. Sarcophaga (Liopygia) argyrostoma (R.-D.), second instar larva (photo by P. Ślipiński). (47) Habitus, lateral view; (48) habitus,lateral view, internal organs AS, C, PS visible; (49) anterior part of body, cephaloskeleton, lateral view, with wide collar of spines; (49a) anteriorspiracle; enlarged; (50) posterior part of body, lateral view, with posterior spiracle and anal pad; (51) posterior spiracles, with spiracular cavity;(52) posterior spiracles. Abbreviations: AD – anal division; AS – anterior spiracle, C – cephaloskeleton, DB – dorsal bridge; DC – dorsal cornua; DS – dental sclerite; IS – intermediate sclerite; MH – mouthhooks; PB – parastomal bar; PS - posterior spiracles, VC – ventral cornua; VP – ventral

plate.

47

48

49

50

51

52 49a

AS

C

PS

AD

AS

MH

DC DB

VC

PB

DSISVP


Figures 53–60. Sarcophaga (Liopygia) argyrostoma (R.-D.), second instar larva (photos 53, 54 by M. Kowalewska-Groszkowska, photos 55–57by K. Szpila, the others by M. Roszkowska). (53) Habitus, lateral view; (54) anterior part of body, lateral view; (55) anterior part of body, antero-ventral view; (56) anterior end, functional mouth opening, ventral view; (57) ventral organ, ventral view; (58) anterior spiracles, lateral view;

(59) two branches, enlarged; (60) maxillary palpus, anterior view. Abbreviations: MP – maxillary palpus; VO – ventral organ.

53

54 55

56 57

58

59 60

MP

VO

Figures 61–67. Sarcophaga (Liopygia) argyrostoma (R.-D.), second instar larva (photo by 63 M. Roszkowska, the others by K. Szpila). (61) Fourth abdominal segment, ventral view; (62) ventral spines on fourth abdominal segment; (63) spines and processes on third thoracicsegment; (64) posterior part of body with anal pad, posterior view; (65) posterior part of body with anal pad, postero-lateral view; (66) posteriorpart of body with anal pad, postero-ventral view; (67) posterior spiracles, posterior view. Abbreviations: Ao – anal opening; S – slit; PSH – posterior

spiracular hairs; P1–P6 – papillae; Pa – anal papilla.

61 6362

64 65

66

67

PSHPSH

S

P1P3 P2

P4P6 P5

Ao

Pa



Figures 68–74. Sarcophaga (Liopygia) argyrostoma (R.-D.), third instar larva (photos 68, 69, 74 by P. Ślipiński, the others by K. Szpila). (68) Habitus lateral view; (69) cephaloskeleton, lateral view; (70) anterior part of body, lateral view; (71) anterior spiracle; (72) integumental spines;

(73) posterior spiracles, normal position; (74) posterior spiracles, separation position.

68

69

74

70

71 73

72


Figures 75–82. Sarcophaga (Liopygia) argyrostoma (R.-D.), third instar larva (photos 75–77 by M. Roszkowska and photos 78–82 by M. Kowalewska-Groszkowska). (75) Anterior part of body, antero-lateral view; (76) anterior part of body, antero-ventral view; (77) maxillary palpusand antennal complex; (78) anterior part of body, frontal view; (79) anterior part of body, dorsal view; (80) anterior part of body, ventral view; (81) habitus, anterior part, ventral view; (82) habitus, posterior part, ventral view. Abbreviations: AN – antennal complex, CI – cirri, LL – labial

lobe, MH – mouthhook, MO – functional mouth opening, MP – maxillary palpus.

8079

78

75 76

81

77

82

AN

MP

MH

MO

LL

CI


Figures 83–90. Sarcophaga (Liopygia) argyrostoma (R.-D.), third instar larva (photo by K. Szpila). (83) Maxillary palpus, anterior view; (84) anterior spiracle, lateral view; (85) fourth abdominal segment, dorsal view; (86) dorsal spines on fourth abdominal segment; (87) secondabdominal segment, ventral view; (88) ventral spines on second abdominal segment; (89) posterior part of body with anal pad, posterior view,

P1–P7; (90) posterior part of body with anal pad, postero-lateral view.

89

87

85

83

84

86

88

90


Figures 91–98. Sarcophaga (Liopygia) argyrostoma (R.-D.), third instar larva (photos 91–93 by K. Szpila, photos 94-96 by M. Kowalewska-Groszkowska, photos 97, 98 by M. Roszkowska). (91) Posterior lower papilla, P7, postero-lateral view; (92) posterior end of body with anal pad,ventral view; (93) posterior spiracles, posterior view; (94) anal division with anal pad, posterior view, P1–P7; (95) left anal papilla enlarged; (96) right anal papilla enlarged; (97) papillae, spines and integument perforation on ventral side of TIII; (98) widenings and lateral processes on

abdominal segments I–III.

91

96

92

93

97 98

94

95

Figures 99–106. Sarcophaga (Liopygia) argyrostoma (R.-D.), puparium (photos 99, 100 by P. Ślipiński, the others by M. Kowalewska-Groszkowska). (99) Dorsal view; (100) lateral view; (101) dorsal view; (102) lateral view; (103) anterior part, anterior view; (104) anterior part, withanterior spiracles 3rd instar, anterior view, enlarged; (105) empty puparium, lateral view; (106) part of abdominal segments VI, VII and anal division

LIII, lateral view.

99

101 102

103 104

105 106

100



Figures 107–114. Sarcophaga (Liopygia) argyrostoma (R.-D.), puparium (photo by M. Kowalewska-Groszkowska). (107) Posterior end, dorsalview; (108) posterior end, ventral view; (109) posterior end, posterior view; (110) third papilla, lateral view; (111) second papilla, posterior view;(112) arrangement of spines on anterior and posterior margin of segment, processes, papillae and perforations on VI abdominal segment of L III;

(113) enlarged sensilla from VI abdominal segment, dorsal view; (114) upper flap of puparium with anterior spiracula of LIII, dorsal view.

107

109 110

111 112

113

114

108


Figures 115–120. Sarcophaga (Liopygia) argyrostoma (R.-D.), puparium (photo by M. Kowalewska-Groszkowska). (115) Upper flap of pupariumwith anterior spiracula of LIII, lateral view; (116) anterior spiraculum of LIII, enlarged, round orifices visible, lateral view; (117) lower flap ofpuparium, lateral view; (118) lower flap of puparium, ventral view; (119) lower flap of puparium, internal view, attached cephaloskeleton visible;

(120) posterior end, with posterior spiracles, posterior view.

115

117

118

119 120

116


Figure 121. Graphical representation of Sarcophaga (Liopygia) argyrostoma (R.-D.) DNA barcode.

(liopygia) argyrostoma

Documents