live attenuated salmonella vaccines against …iai.asm.org/content/80/2/798.full.pdflive attenuated...

Live Attenuated Salmonella Vaccines against Mycobacteriumtuberculosis with Antigen Delivery via the Type III Secretion System

María Dolores Juárez-Rodríguez,a Lourdes T. Arteaga-Cortés,a Rebin Kader,a Roy Curtiss III,a,b and Josephine E. Clark-Curtissa,b

Center for Infectious Diseases and Vaccinology at Biodesign Institute,a and School of Life Sciences,b Arizona State University, Tempe, Arizona, USA

Tuberculosis remains a global health threat, and there is dire need to develop a vaccine that is safe and efficacious and conferslong-lasting protection. In this study, we constructed recombinant attenuated Salmonella vaccine (RASV) strains with plasmidsexpressing fusion proteins consisting of the 80 amino-terminal amino acids of the type 3 secretion system effector SopE of Sal-monella and the Mycobacterium tuberculosis antigens early secreted antigenic target 6-kDa (ESAT-6) protein and culture filtrateprotein 10 (CFP-10). We demonstrated that the SopE-mycobacterial antigen fusion proteins were translocated into thecytoplasm of INT-407 cells in cell culture assays. Oral immunization of mice with RASV strains synthesizing SopE–ESAT-6 –CFP-10 fusion proteins resulted in significant protection of the mice against aerosol challenge with M. tuberculosis H37Rv thatwas similar to the protection afforded by immunization with Mycobacterium bovis bacillus Calmette-Guérin (BCG) adminis-tered subcutaneously. In addition, oral immunization with the RASV strains specifying these mycobacterial antigens elicitedproduction of significant antibody titers to ESAT-6 and production of ESAT-6- or CFP-10-specific gamma interferon (IFN-�)-secreting and tumor necrosis factor alpha (TNF-�)-secreting splenocytes.

The World Health Organization reported that there were 9.4million new cases of tuberculosis (TB) in 2009. This infectious

disease causes more deaths worldwide than any other infectioncaused by a single bacterial pathogen, mostly in developing coun-tries (80). Mycobacterium tuberculosis, the causative agent of TB,may cause acute infection or the bacteria may persist in infectedindividuals for years by switching to a nonreplicating (dormant)state. Reactivation of the dormant bacteria to active growth de-pends on epidemiological, host, and bacterial factors (11). Al-though there are effective antibiotics for treating TB, the lengthytreatment of the infection frequently results in compliance fail-ures. Strains of M. tuberculosis that are resistant to multiple drugshave arisen and continue to increase in incidence due to insuffi-cient control measures (1). The live attenuated M. bovis bacillusCalmette-Guérin (BCG) vaccine has been in use for over 80 years.BCG has displayed efficacy in protecting newborns and youngchildren against serious complications of the disease, e.g., menin-gitis, but does not confer long-lasting protection against infection.However, the efficacy of BCG against pulmonary TB is variable inadults, ranging from 0 to 80% in different trials (2, 29, 76). There-fore, new approaches to controlling TB are essential and will resultfrom understanding the biology of M. tuberculosis and its interac-tions with its host. Such understanding is required both for thedevelopment of new drugs to extend the range of TB treatmentsand for the development of a new generation of vaccines.

Attenuated Salmonella enterica has been used both as a homol-ogous vaccine and as a delivery system for recombinant heterolo-gous antigens to induce protective immunity against several infec-tious diseases and tumor sources in animal models (10, 19, 24, 27,35, 48, 53, 65, 68, 70). Oral administration of Salmonella allowsinfection of Peyer’s patches via M cells, as well as phagocytosis bydendritic cells sampling the gut mucosa and colonization of themesenteric lymph nodes, liver, and spleen, generating mucosal,humoral, and cellular immune responses against Salmonella andits heterologous antigens (10, 19, 24, 49, 77, 81). We have reportedthe advantages of using new-generation recombinant attenuatedSalmonella vaccine (RASV) strains that are phenotypically similar

to the wild-type strain at the time of oral vaccination as an alter-native for vaccination (23, 24, 52, 79). These RASV strains are ableto colonize and persist in the lymphoid tissue without causingdisease symptoms when carrying heterologous antigens, therebyinducing higher protective mucosal and systemic immune re-sponses against a number of infectious diseases (27, 45, 47, 48, 68,74, 83). Additionally, several approaches have been employed toimprove the ability of Salmonella to survive in the gastrointestinaltract and to reach the lymphoid tissues. The deletion of Salmonellagenes that encode enzymes involved in the biosynthesis of thepeptidoglycan layer of the bacterial cell wall (e.g., aspartate�-semialdehyde dehydrogenase [Asd]) allows the use of plasmidsystems harboring the gene encoding this enzyme to be main-tained without the use of antibiotic resistance markers (60). Ad-ditionally, use of plasmids with different copy numbers is used toattain a better balance between plasmid replication and the syn-thesis of heterologous protective antigens (45, 60, 74). A series ofexpression vectors harboring chimeric fusions between the an-tigen to be analyzed and different types of secretion signal se-quences (e.g., a �-lactamase signal sequence to allow proteinsecretion into the periplasm or extracellular compartment) wasconstructed to enhance the immune responses to the antigens(45, 81).

S. enterica employs different mechanisms to colonize, repli-cate, and survive within the eukaryotic host cells, such as the spe-

Received 17 June 2011 Returned for modification 30 July 2011Accepted 19 November 2011

Published ahead of print 5 December 2011

Editor: A. Camilli

Address correspondence to Josephine E. Clark-Curtiss, [email protected].

Supplemental material for this article may be found at http://iai.asm.org/.

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/IAI.05525-11

798 iai.asm.org 0019-9567/12/$12.00 Infection and Immunity p. 798–814

on June 18, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

http://dx.doi.org/10.1128/IAI.05525-11

http://iai.asm.org

http://iai.asm.org/

cialized type 3 secretion system (T3SS) encoded in Salmonellapathogenicity island 1 (SPI-1). The T3SS forms a multiproteinneedle-like apparatus that injects proteins (effectors) into hostcells to modulate a variety of cellular functions (34). One of theseeffector proteins is SopE, encoded within the genome of a crypticbacteriophage located at centisome 61 of the S. enterica serovarTyphimurium chromosome (40). SopE is a Rho GTPase activatorthat interacts with Cdc42 and Rac1, resulting in membrane ruf-fling and actin cytoskeletal reorganization, thereby promoting theinternalization of Salmonella into host cells (39, 46, 49, 50). More-over, SopE has been shown to be rapidly ubiquitinated and pro-cessed by the eukaryotic proteasome degradation pathway (49).The signals for secretion and translocation of SopE by the T3SS arelocated within the amino-terminal region (between residues 1 and78) of the protein (46, 50). The SopE secretion and translocationdomain is a tool to explore the use of the Salmonella T3SS as ameans for delivery of M. tuberculosis antigens into the eukaryoticcell cytosol. Antigens delivered into the cell cytosol become acces-sible to the major histocompatibility complex (MHC) classI-restricted antigen pathway, which is a prerequisite for efficientstimulation of CD8� T-cell responses required to confer completeprotection against intracellular pathogens, such as M. tuberculosis(13). Several groups of investigators have used the SPI-1 T3SSeffector protein SopE or SptP fused to viral (simian immunodefi-ciency virus [SIV] and lymphocytic choriomeningitis virus[LCMV]) or protozoan (Eimeria acervulina and E. tenella) anti-gens to deliver these antigens to the host cell cytosol (27, 48, 68).These investigators demonstrated that delivery of antigens by theT3SS stimulated antigen-specific cytotoxic T-cell responses,antigen-specific CD8� memory T cells, and protection againstchallenge with viral or Eimeria pathogens (27, 48, 68).

In the present study, we designed a TB vaccine based on anRASV harboring an Asd-positive (Asd�) vector that contains thegene sequence encoding SopE amino-terminal region residues 1to 80 (SopENt80) to stimulate a T-cell immune response by em-ploying the SPI-1 T3SS as a delivery system to secrete and trans-locate M. tuberculosis major T-cell antigens into the eukaryoticcytosol. The antigens included are the early secreted antigenic tar-get 6-kDa (ESAT-6) protein and the culture filtrate protein 10(CFP-10) (5, 72), which are encoded by genes in region of differ-ence 1 (RD-1) of the M. tuberculosis chromosome (3, 54) and havebeen shown to be useful vaccine candidates against TB (9, 69).

MATERIALS AND METHODSBacterial strains, plasmids, and media. The bacterial strains and plas-mids used in this study are listed in Table 1. Lennox broth (51) supple-mented with 0.3 M NaCl was used to stimulate the expression of thecomponents associated with T3SS (32). Luria-Bertani (LB) broth (4) orLB broth supplemented with 0.05% arabinose was used to grow the Sal-monella strains for the immunizations. LB broth and LB agar (1.5% agar)or MacConkey agar (Difco) were used for propagation and plating ofSalmonella. For the growth of noncomplemented �asdA strains and plas-mid stability tests, 50 �g/ml diaminopimelic acid (DAP) was added to thegrowth medium (60). Middlebrook 7H9 broth and Middlebrook 7H11agar (Difco), each supplemented with 10% oleic acid-albumin-dextrose-catalase enrichment (Difco), were used to grow M. tuberculosis and M.bovis BCG.

DNA procedures. DNA manipulations were carried out using stan-dard procedures (66). Plasmid DNA was isolated using a QIAprep Spinminiprep kit (Qiagen, Valencia, CA). Restriction enzymes were used asrecommended by the manufacturer (New England BioLabs, Inc., Ipswich,

MA). Plasmid constructs were verified by DNA sequencing (Arizona StateUniversity facilities).

Construction of Asd� SopE80 plasmid vaccine vectors pYA3869 andpYA3870. The Asd� vectors pYA3869 and pYA3870, which contained thepSC101 (14) and p15A (17) replication origins, respectively, were con-structed for delivery of heterologous antigens by the Salmonella T3SS.Both plasmids pYA3869 and pYA3870 were briefly described earlier (43)and have been evaluated by other members of our group for deliveringEimeria antigens (48). Plasmid pYA3869 was constructed from pYA3337(20) by excising a 1-kb HpaI-NcoI fragment and replacing it with a 600-bpHpaI-NcoI fragment containing the carboxy-terminal region of the asdgene. The S. Typhimurium sopE promoter (PsopE), the Shine-Dalgarnosequence, and the nucleotides encoding the first 80 amino acids of SopEwere then cloned into intermediate plasmids to finally generate pYA3869(Table 1; see Fig. S1 in the supplemental material). The 80 N-terminalamino acids of SopE are essential for secretion and translocation of SopEby the T3SS (46, 50) and are designated SopENt80 in the plasmids used inthis study.

The pYA3870 Asd� vector was generated from pYA3332 (22) by ex-cising a 1,004-bp HpaI-PstI fragment containing the carboxy-terminalregion of the asd gene and the Ptrc promoter and replacing this sequencewith a 1,096-bp HpaI-PstI fragment encoding the carboxy-terminal re-gion of the asd gene, the S. Typhimurium sopE promoter (PsopE), and theSopENt80 secretion and translocation signal, which were excised frompYA3869, to generate pYA3870 (Table 1; see Fig. S1 in the supplementalmaterial).

Codon substitution of M. tuberculosis esxA and esxB with the mostfrequently used codons found in Salmonella. The DNA fragment con-taining the esxA and esxB genes, which encode the ESAT-6 and CFP-10proteins, respectively, was PCR amplified from the M. tuberculosis H37Rvchromosome using the primer set CFP10-F1 (GGTAAAGAGAGAAGGTACCCCAGCATGGCAGAG) and ESAT6-R1 (GCTATTCTACGCGAACTAAGCTTTGCCCTATGCG).

The resulting 530-bp PCR product was digested with KpnI-HindIIIand cloned into the pBK-CMV (Stratagene) plasmid digested with thesame enzymes to obtain pYA3933. Plasmid pYA3933 was used for codonsubstitution of the M. tuberculosis esxA and esxB genes with the mostfrequently found codons in Salmonella. The esxB codons 20 (AGG toCGT) and 85 (CGG to CGT) and the esxA codons 20 (GGA to GGT) and74 (CGG to CGT) were substituted by using a QuikChange site-directedmutagenesis kit (Stratagene). The resulting recombinant plasmid con-taining all of the optimized sequences from esxA and esxB was namedpYA3934 (Table 1).

Construction of plasmids harboring the M. tuberculosis esxA genefused in tandem three times. Two plasmids, pYA4221 and pYA4222,harboring two copies of esxA or with three copies of esxA fused in tandem,respectively, were constructed. The DNA fragment encoding three copiesof esxA fused in tandem (E3) was excised from pYA4222 by digestion withEcoRI-HindIII and subcloned into pYA3869 or pYA3870 digested withthe same enzymes to generate pYA4248 and pYA4251 (Table 1; see Fig. S1in the supplemental material), respectively. Plasmids pYA4248 andpYA4251, containing sopENt80-esxA-esxA-esxA, were used to express thechimeric protein referred to as SopENt80-E3 (with E3 designating threecopies of ESAT-6) in this study.

Construction of plasmids with the esxA gene fused in tandem twotimes with the esxB gene. The 350-bp fragment containing M. tuberculosisesxB was PCR amplified from pYA3934 and cloned into XhoI-HindIII-digested pYA4221 to obtain pYA4224. The 891-bp fragment containingesxA-esxA-esxB was excised from pYA4224, digested with EcoRI and Hin-dIII, and cloned into pYA3869 and pYA3870 digested with the same en-zymes to generate pYA4254 and pYA4257, respectively (Table 1; see Fig.S1 in the supplemental material). Both the pYA4254 and pYA4257 plas-mids contained sopE80Nt80-esxA-esxA-esxB and were used to express thechimeric protein referred to as SopENt80-E2C (with E2C designating twocopies of ESAT-6 and one copy of CFP-10) in this study.

Immune Response to M. tuberculosis ESAT-6 and CFP-10

February 2012 Volume 80 Number 2 iai.asm.org 799


.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

TABLE 1 Strains and plasmids used in this work

Strain or plasmid Derived, relevant genotype, or characteristicsa Source or reference

Escherichia coliBL21(DE3) F� ompT lon hsdSB(rB

� mB�) gal dcm (DE3) Novagen

�6212 �asdA4 45�7213 F� supE42 �� T3r thi-1 thr-1 leuB6 supE44 tonA21 fhuA21 lacY1

recA1 RP4 2-Tc::Mu (�pir) �asdA4 �(zhf-2::Tn10)23

Salmonella enterica serovar Typhimurium�8768 �phoP233 7�8916 �phoP233 �asdA16 Laboratory stock�9879 �asdA33 �PphoPQ176::TT araC PBAD phoPQ �Pcrp527::TT araC PBAD

crp �araBAD23This study

�9930 �phoP233 �asd16 artB13::MudJ This study�11406 �phoP233 �asd16 �invAC This study

MycobacteriumM. tuberculosis H37Rv ATCC 25618M. bovis BCG (Pasteur) ATCC 35734

PlasmidspBAD-HA Ampr; pBR322 ori, expression vector InvitrogenpBK-CMV Kmr; pUC ori, cloning vector StratagenepET28a� Kmr; pBR322 ori, expression vector NovagenepUC18 Ampr; pUC ori, cloning vector 82Plasmids derived from pBK-CMV

pYA3933 pBK-CMV esxB-esxA This studypYA3934 pBK-CMV esxB (codon optimized)-esxA (codon optimized) This studypYA4226 pBK-CMV AU1E tag (formed by the AU1 epitope tag-Elk tag fusion) This study

Plasmids derived from pUC18pYA4221 pUC18 esxA-esxA (codon optimized) This studypYA4222 pUC18 esxA-esxA-esxA (codon optimized) This studypYA4224 pUC18 esxA-esxA-esxB (codon optimized) This study

Plasmids with pSC101 oripYA3337 asdA� pSC101 ori vaccine vector 20pYA3869 pYA3337 PsopE sopENt80 vaccine vector This studypYA4248 pYA3869 PsopE sopENt80-esxA-esxA-esxA This studypYA4249 pYA3869 PsopE sopENt80-esxA-esxA-esxA-(AU1E tag) This studypYA4250 pYA3869 PsopE sopENt80-esxA-esxA-esxA-(AU1 epitope tag) This studypYA4254 pYA3869 PsopE sopENt80-esxA-esxA-esxB This studypYA4255 pYA3869 PsopE sopENt80-esxA-esxA-esxB -(AU1E tag) This studypYA4256 pYA3869 PsopE sopENt80-esxA-esxA-esxB -(AU1 epitope tag) This study

Plasmids with p15A oripYA3332 asdA� p15A ori vaccine vector 22pYA3870 pYA3332 PsopE sopENt80 vaccine vector This studypYA3950 pYA3870 PsopE sopENt80-esxB-esxA This studypYA4251 pYA3870 PsopE sopENt80-esxA-esxA-esxA This studypYA4252 pYA3870 PsopE sopENt80-esxA-esxA-esxA-(AU1E tag) This studypYA4253 pYA3870 PsopE sopENt80-esxA-esxA-esxA-(AU1 epitope tag) This studypYA4257 pYA3870 PsopE sopENt80-esxA-esxA-esxB This studypYA4258 pYA3870 PsopE sopENt80-esxA-esxA-esxB -(AU1E tag) This studypYA4259 pYA3870 PsopE sopENt80-esxA-esxA-esxB -(AU1 epitope tag) This study

Plasmids encoding entire sopE genepYA4260 pYA3869 PsopE sopE This studypYA4261 pYA3869 PsopE sopE-(AU1E tag) This studypYA4262 pYA3869 PsopE sopE-(AU1 epitope tag) This studypYA4263 pYA3870 PsopE sopE This studypYA4264 pYA3870 PsopE sopE-(AU1E tag) This studypYA4265 pYA3870 PsopE sopE-(AU1 epitope tag) This study

Plasmids expressing 6�His-taggedrecombinant proteins

pMRLB7 pET23� ESAT-6–6�His NIH-TB Vaccine Testing andResearch Materials Contract

pYA3815 pET28a� 6�His–CFP-10 This studySuicide vectors

pRE112 Cmr; R6K ori mobRP4 sacB 26pYA4141 pRE112 �invAC This study

a In the description of the genotype, TT is transcription terminator, P stands for promoter, and the subscripted number refers to a composite deletion and insertion of the indicatedgene. Ampr, ampicillin resistance; Cmr, chloramphenicol resistance; Kmr, kanamycin resistance.

800 iai.asm.org Infection and Immunity


.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

In-frame fusion of the AU1 epitope and an Elk tag to chimericSopE8Nt80-E3 and SopENt80-E2C proteins. To detect chimeric proteinSopENt80-E3 or SopENt80-E2C, both proteins were tagged independentlywith a sequence encoding the AU1 epitope tag (42). Additionally, to allowthe specific identification of the chimeric proteins that were translocatedinto the eukaryotic cytoplasm, these chimeric proteins were tagged withan Elk tag that consists of the simian virus 40 large tumor antigen nuclearlocalization signal (NLS) (64) fused to amino acid residues 375 to 392 ofthe eukaryotic transcription factor Elk-1 (25), which are recognized andphosphorylated at serine 383 by eukaryotic protein kinases. The AU1epitope fused to the Elk tag is referred to as the AU1E tag in this study. TheDNA fragment containing the nucleotide sequence esxA-esxA-esxA-AU1E was subcloned into pYA3869 and pYA3870 to generate pYA4249and pYA4252, respectively (see Fig. S1 in the supplemental material). TheDNA fragment containing esxA-esxA-esxB-AU1E was subcloned intopYA3869 and pYA3870 to generate pYA4255 and pYA4258, respectively.

Construction of plasmids harboring sopENt80-esxA-esxA-esxA-AU1or sopENt80-esxA-esxA-esxB-AU1. The plasmids pYA4249, pYA4252,pYA4255, and pYA4258 were digested with PvuII to remove the DNAfragment encoding the Elk tag. Each plasmid was self-ligated indepen-dently to obtain pYA4250, pYA4253, pYA4256, and pYA4259, respec-tively (Table).

Construction of plasmids containing the S. Typhimurium sopE pro-moter and the structural sopE gene fused in frame with the AU1 epitopetag or the sequence encoding the AU1E tag. The DNA fragment contain-ing the promoter region and the nucleotide sequence encoding the entireS. Typhimurium sopE gene was PCR amplified from S. TyphimuriumSL1344 and cloned into pYA3869 and pYA3870 to generate pYA4260 andpYA4263, respectively, to express SopE. A DNA fragment containing theAU1E nucleotide sequences was PCR amplified from pYA4226 and sub-cloned into pYA4260 and pYA4263 to obtain pYA4261 and pYA4264,respectively, encoding SopE-AU1E. pYA4261 and pYA4264 were digestedwith PvuII to remove the DNA fragment encoding the Elk tag. Each plas-mid was self-ligated independently to obtain pYA4262 and pYA4265, re-spectively, to express SopE-AU1.

Construction of pYA3950 harboring sopENt80-esxB-esxA. The esxBgene was PCR amplified from M. tuberculosis H37Rv, digested with EcoRIand BamHI, and cloned into the pYA3870 vector digested with the sameenzymes. The resulting plasmid was digested with BamHI-HindIII, and a294-bp BamHI-HindIII fragment containing the esxA gene, which wasPCR amplified from M. tuberculosis H37Rv, was cloned into the plasmidto generate pYA3950, expressing SopENt80–CFP-10 –ESAT-6, referred toin this work as SopENt80-C-E.

Construction of expression vector pYA3815. The plasmid encodingrecombinant 6�His-tagged CFP-10 was constructed as follows: the nu-cleotide sequence encoding CFP-10 was PCR amplified from M. tubercu-losis H37Rv chromosomal DNA, digested with KpnI and HindIII, andcloned into the pBAD-HA vector (Invitrogen). The resulting plasmid wasdigested with NcoI and HindIII to release a 300-bp DNA fragment, whichwas subcloned into the pET28a� vector (Novagen, EMD4 Biosciences,San Diego, CA) digested with the same enzymes to generate pYA3815.

Construction of suicide vector pYA4141 for invAC deletion muta-tion (�invAC) in Salmonella. The �8916 strain harboring an invA dele-tion mutation was generated by using the suicide vector constructed asfollows: a nucleotide sequence encoding 250 amino acid (aa) residues ofthe invE carboxy-terminal region and 15 aa of the invA amino terminuswas PCR amplified from S. Typhimurium chromosomal DNA, digestedwith KpnI-BamHI, and cloned into the suicide vector pRE112 (26). Theresulting plasmid was digested with BamHI-SacI and was cloned with a700-bp DNA fragment, PCR amplified, and digested with the same en-zymes encoding the last 22 aa of invA and the first 79 aa of invC to obtainpYA4141.

Recombinant attenuated Salmonella strain construction. Thedeletion-insertion mutations �asdA33, �PphoPQ176::TT araC PBAD

phoPQ, �Pcrp527::TT araC PBAD crp, and �araBAD23 (where TT is tran-

scription terminator, P stands for promoter, and the subscripted numberrefers to a composite deletion and insertion of the indicated gene) (23, 52)were introduced into the S. Typhimurium �3761 wild-type strain by al-lelic exchange using suicide vectors and/or by transduction using bacte-riophage P22HTint to yield �9879 using standard protocols (44, 45). TheartB13::MudJ allele (31), which directs constitutive expression of�-galactosidase, was introduced into S. enterica serovar Typhimurium�8916 by transduction using a bacteriophage P22HTint lysate from Sal-monella �4574 harboring this allele, resulting in strain �9930. Transduc-tants with kanamycin-resistant and �-galactosidase phenotypes were se-lected and grown on Evans blue uridine agar plates to confirm that thetransductants were phage free and not P22 lysogens (6). The invAC geneswere deleted in S. Typhimurium �8916 by allelic exchange using the sui-cide vector pYA4141 to generate �11406. The �invAC deletion mutationimpairs the ability of Salmonella to invade cells of the intestinal epithelium(33).

Plasmid stability. Stability of the recombinant plasmids expressingthe SopENt80 fusion proteins was determined for approximately 50 gen-erations of growth under selective and nonselective conditions (presenceof DAP), as described previously (74).

Evaluation of synthesis and secretion of chimeric proteins from Sal-monella harboring Asd� SopENt80 plasmid derivatives. S. Typhimu-rium strains �8916, �9930, and �11406 were transformed independentlyby electroporation with each Asd� SopENt80 plasmid derivative and weregrown under conditions to stimulate the expression of the T3SS and chi-meric proteins (32). Briefly, a single colony of each transformed Salmo-nella strain was inoculated in Lennox broth (3 ml in a 13- by 100-mmtube) and grown at 37°C on an Orbit 1000 shaker (Labnet International,Edison, NJ) at 30 rpm overnight. On the next day, aliquots were takenfrom each overnight culture to inoculate fresh Lennox broth (5 ml in a 16-by 150-mm tube) at an optical density at 600 nm (OD600) of 0.17. Thecultures were grown with shaking at 100 rpm (on the same shaker de-scribed above) for 3 h at 37°C. The cultures were centrifuged at 12,500 �g for 2 min. The bacterial pellets were washed with phosphate-bufferedsaline (PBS), resuspended and lysed with 150 �l of lithium dodecyl sulfate(LDS) sample buffer (Invitrogen), and then stored at �70°C. The super-natants were filtered using a 0.22-�m-pore-size filter (Corning Gilbert,Inc., Glendale, AZ) and precipitated with 10% trichloroacetic acid (TCA),and the pellet was resuspended in 100 �l of LDS sample buffer. Then, 37�l of the pellet sample and 25 �l of the supernatant sample were boiled for5 to 10 min and analyzed by sodium dodecyl sulfate-polyacrylamide gelelectrophoresis (SDS-PAGE) on 4 to 20% gels (Bio-Rad) and immuno-blotted.

Immunoblotting. Secreted chimeric proteins were identified by im-munoblotting using rabbit anti-ESAT-6 serum or anti-AU1 epitope tagserum (Bethyl Laboratories, Montgomery, TX), followed by alkalinephosphatase-conjugated goat anti-rabbit IgG (Sigma-Aldrich, St. Louis,MO). All of these antibodies were used at a 1:5,000 dilution. Mouse anti-�-galactosidase monoclonal antibody (1:1,000; clone Gal-40; Sigma-Aldrich) was used for detection of �-galactosidase, followed by alkalinephosphatase-conjugated goat anti-mouse IgM (Sigma-Aldrich). All ex-periments were performed three times.

Assay for chimeric protein translocation to cytosol of intestinal ep-ithelial cells. The translocation assays were conducted according to theprocedures described previously (15). Briefly, INT-407 cells were seededinto 100-mm tissue culture plates containing 12 ml of Dulbecco’s modi-fied Eagle medium (DMEM) with 10% fetal bovine serum (FBS) withoutantibiotics at a density of 2 � 107 cells per plate and allowed to adhere for24 h. Before infection, cell monolayers were washed twice with 5 ml ofHanks’ balanced salt solution (HBSS) at 37°C, and 2.5 ml of DMEMwithout FBS was added. The proteosome inhibitors MG132 (final con-centration, 10 �M) and lactacystin (final concentration, 1 �M) (Calbi-ochem, EMD4 Biosciences, San Diego, CA) were added to the cells 15 minprior to infection. For translocation assays in the presence of cytochalasinD (Sigma-Aldrich), cytochalasin D was added to the cells 30 min before




.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

infection at a final concentration of 5 �g/ml. The cells were infected in-dependently with each RASV strain harboring an Asd� SopENt80 plasmidderivative expressing a chimeric protein (grown under conditions to stim-ulate the expression of the SPI-1 T3SS, centrifuged, and resuspended inHBSS) at a multiplicity of infection (MOI) of 50 CFU/eukaryotic cell for 1h, and an MOI of 100 CFU/eukaryotic cell was used when cytochalasin Dwas previously added to the cells. Subsequently, the culture medium wasremoved, and the cells were washed three times with 10 ml Dulbecco’sphosphate-buffered saline (DPBS) and treated with 10 �g/ml proteinaseK for 15 min at 37°C. Afterwards, 2 mM phenylmethylsulfonyl fluoride(PMSF; Sigma-Aldrich) was added, and the cells were centrifuged at600 � g for 5 min. The cellular pellet was lysed in 1 ml 10 mM Na2HPO4

(pH 7.2) containing 0.1% Triton X-100, 10 �g/ml DNase, 10 �g/mlRNase, 1 mM PMSF, 0.1% (vol/vol) protease inhibitor (P-8340), and0.01% (vol/vol) phosphatase inhibitor (P-2850) cocktails (Sigma-Aldrich) and then incubated for 15 min at 4°C. Finally, the lysates werecentrifuged for 30 min at 12,500 � g and 4°C, and the pellet obtained (P),containing the unbroken cells, membranes, and bacteria that had adheredand had been internalized, was resuspended in 200 �l of LDS samplebuffer. The supernatant of the cytoplasmic fraction (C) containing theeukaryotic cytoplasm and the translocated recombinant proteins was fil-tered as indicated above and then precipitated with 10% TCA and resus-pended in 210 �l of LDS sample buffer. The proteins of each sample wereanalyzed by 10% SDS-PAGE and immunoblotted. The chimeric proteinswere identified using rabbit anti-ESAT-6 or anti-AU1 epitope tag sera,followed by peroxidase-conjugated goat anti-rabbit antibody (Sigma-Aldrich), using a chemiluminescent detection system (ECL; Pierce, Rock-ford, IL).

Antigen preparation. The Escherichia coli BL21(DE3) strain (Nova-gen) was transformed with the expression vector pYA3815 (His-taggedCFP-10) or pMRLB7 (His-tagged ESAT-6), and cells were grown at 37°Cwith aeration in LB broth containing 30 �g/ml kanamycin or 100 �g/mlampicillin, respectively, to 0.5 OD600 unit. Production of the recombinantproteins was induced with 0.5 mM isopropyl-�-D-thiogalactopyranoside(IPTG) for 3 h at 37°C. Each protein was purified by nickel-nitrilotriaceticacid agarose chromatography. Eluted fractions containing purified6�His–CFP-10 or 6�His–ESAT-6 were selected after SDS-PAGE,pooled, dialyzed against PBS, and then concentrated. Protein concentra-tion was determined by the Bradford assay (8) using bovine serum albu-min as a standard. Endotoxins were removed using Detoxi-Gelendotoxin-removing gel (Pierce, Rockford, IL). The amount of endotoxincontamination in the recombinant proteins was measured quantitativelywith the Limulus amebocyte lysate assay (Cambrex Bio Science Walkers-ville, Inc., Walkersville, MD), which was used according to the manufac-turer’s instructions. The amount of endotoxin found was �0.01 endo-toxin unit (EU) per �g of recombinant protein. The purified recombinantproteins were used for production of the antisera in rabbits for enzyme-linked immunosorbent assay (ELISA) and enzyme-linked immunospot(ELISPOT) assay. Salmonella outer membrane proteins (SOMPs) wereobtained using the sonication and Triton X-100 extraction proceduredescribed previously (56).

Immunization of mice. Female C57BL/6 mice that were 6 to 7 weeksold were purchased from Charles River Laboratories (Wilmington, MA).The Arizona State University Animal Care and Use Committee approvedall of the animal procedures. Mice were acclimated for 7 days before start-ing the experiments. Groups of 5 to 6 mice were vaccinated subcutane-ously with a single dose of 5 � 104 CFU of M. bovis BCG at day 0. Forimmunization with RASV strains, mice were deprived of food and waterfor 6 h before oral immunization. The RASV �8916 strains independentlyharboring each of the Asd� SopENt80 plasmid derivatives pYA3870,pYA4252, and pYA4257 were grown statically for 18 h in 5 ml LB broth at37°C. These cultures were used to inoculate 100 ml of LB broth and thengrown at 37°C with aeration to an OD600 of 0.8. The �9879 strains inde-pendently harboring each of the Asd� SopENt80 plasmid derivativespYA3870, pYA4251, pYA4254, and pYA4257 were grown in the same way

as described above, but in LB broth containing 0.05% arabinose. Cellsfrom each culture were pelleted by centrifugation at room temperature(4,000 � g for 15 min), and each pellet was resuspended in 1 ml of buff-ered saline containing 0.01% gelatin (BSG) (18). Dilutions of the vaccinestrains were plated onto LB agar plates or LB agar plates supplementedwith 0.2% arabinose to determine bacterial titers. Four groups of 16 miceeach (for vaccination with �8916 strains independently harboringpYA3870, pYA4252, or pYA4257 or with BSG alone) were orally inocu-lated with 20 �l of the respective RASV strains resuspended in BSG con-taining 1 � 109 CFU or with BSG alone on days 0, 21, and 49. Another fivegroups of 16 mice each were orally inoculated as described above with�9879 strains harboring the respective Asd� SopENt80 plasmid derivativesor with BSG alone on days 0, 7, and 49. Water and food were returned tothe mice 30 min after immunization. Blood samples were obtained bysubmandibular vein puncture 2 days before vaccination for all of thegroups of mice. Blood samples were also collected at days 20 and 48, forthe mice immunized with �8916 harboring the control vector pYA3870 orits derivative pYA4252 or pYA4257 or the BSG-dosed mice, and at days 21and 65, for the mice immunized with �9879 harboring the control vectorpYA3870 or its derivative pYA4254, pYA4257, or pYA4251 or the BSG-dosed mice. The blood was incubated at 37°C for 60 min. Afterwards, theblood was centrifuged at 4,000 � g for 5 min, and the serum was removed.Sera obtained from mice in the same experimental group were pooled andstored at �70°C.

Challenge experiments. To assess the protective effects of the RASVstrains against M. tuberculosis infection in immunized mice, groups of 5 to6 immunized mice or those from the M. bovis BCG and buffered saline(BSG) control groups were infected 4 weeks after the last immunizationwith M. tuberculosis H37Rv delivered as an aerosol by a Glas-Col aerosol-ization chamber (Glas-Col LLC, Terre Haute, IN), programmed to deliverapproximately 100 bacilli per lung. The mice were euthanized 6 weeksafter the challenge, and immediately the lungs and the spleen were asep-tically collected. The numbers of bacteria in the lungs and spleens weredetermined by serial dilution of individual whole-organ homogenates insterile PBS. Serial dilutions of the samples were plated on Middlebrook7H11 agar supplemented with 10% oleic acid-albumin-dextrose-catalaseenrichment in duplicate. The colonies were counted after 4 weeks of in-cubation at 37°C. All experiments involving live M. tuberculosis H37Rvwere conducted under biosafety level 3 laboratory conditions.

ELISA. Total IgG, IgG2b, and IgG1 antibody titers against ESAT-6 andSOMPs and total IgG antibody titers against CFP-10 from vaccinatedmice and controls were determined by ELISA, using standard protocols(75). Briefly, Nunc Immunoplate Maxisorb F96 plates (Nalge Nunc,Rochester, NY) were coated with purified ESAT-6 at 1 �g/well or SOMPsat 0.5 �g/well suspended in 0.05 M carbonate-bicarbonate buffer, pH 9.6.Sera from mice orally immunized with RASV �8916 harboring the Asd�

SopENt80 plasmid pYA3870 or its derivative pYA4252 or pYA4257 werepooled and serially diluted by 2-fold dilutions from an initial dilution of1:100 in PBS. Aliquots of 100 �l were added to duplicate wells and incu-bated overnight at 4°C. Plates were washed as indicated before and treatedwith horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG,IgG1, or IgG2b (1:4,000 dilution; Southern Biotechnology Inc., Birming-ham, AL). Wells were washed and developed with o-phenylenediaminedihydrochloride (OPD) at 0.4 mg/ml in phosphate-citrate buffer withH2O2 (Sigma) at 200 �l/well. Color development was stopped by theaddition of 50 �l of 3 M H2SO4 per 200 �l of reaction solution. Absor-bance was recorded at 492 nm using an automated ELISA plate reader(Labsystems Multiskan MCC/340). Endpoint titers were expressed as thelast sample dilution with an absorbance of 0.1 OD unit above that for thenegative controls after 1 h of incubation.

Evaluation of cytokine-secreting cell numbers in the spleen. TheELISPOT assay was performed to enumerate the gamma interferon (IFN-�), tumor necrosis factor alpha (TNF-�), interleukin-4 (IL-4), and IL-10cytokine-secreting cells (CSCs) in the spleens of immunized and naïvemice to determine the potential cellular immune response to immuniza-

Juárez-Rodríguez et al.



.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

tion. This was performed using the ELISPOT assay kits (mouse IFN-�,TNF-�, IL-4, and IL-10 ELISPOT sets; eBioscience) according to the man-ufacturer’s instructions. Briefly, ELISPOT assays for �8916 harboring theAsd� SopENt80 plasmid derivatives were conducted at 1 week after the lastimmunization with spleens from three mice per group, and the analysiswas conducted on the splenocytes from individual mice in triplicate. Thespleen cells were incubated with the recombinant antigen at 1 �g/well forIFN-�-secreting cells for 48 h at 37°C in a humidified (5% CO2-in-air)incubator. ELISPOT assays for �9879 harboring the Asd� SopE80 plas-mid derivatives were conducted at 3 weeks after the last immunizationwith the pool of spleens from three mice of the same group. The spleencells from all groups of mice were incubated with the recombinant antigenat 1 �g/well for 24 h (for IFN-�- and TNF-�-secreting cells) or 48 h (forIL-4- and IL-10-secreting cells) as described above. The spots werecounted using an automated ELISPOT assay plate reader (CTL analyzers;Cellular Technology Ltd., Cleveland, OH).

Statistical analysis. Differences in antibody responses, cytokine secre-tion levels measured by ELISPOT assay, and bacterial loads in the lungsand spleens between groups were determined by one-way analysis of vari-ance (ANOVA), followed by Tukey’s multiple-comparison test. Differ-ences with P values of �0.05 were considered significant. Statistical anal-ysis was performed using GraphPad Prism software (GraphPad Software,San Diego, CA).

RESULTSConstruction of a balanced-lethal plasmid expression systembased on the Asd� SopENt80 pYA3869 and pYA3870 plasmidvectors to deliver protective heterologous antigens using Sal-monella SPI-1 T3SS. We constructed and evaluated two plasmidvectors to analyze the effect of the antigen amount synthesized anddelivered by the Salmonella vaccine strain on the immune re-sponse. The first plasmid, pYA3869, harbors the very-low-copy-number pSC101 replication origin, and the second plasmid,pYA3870, harbors the low-copy-number p15A replication origin.Both pYA3869 and pYA3870 plasmids contain the asdA gene en-coding an enzyme involved in the biosynthesis of DAP, which is anintegral component of the peptidoglycan layer of the bacterial cellwall. The asdA gene was used as a selectable marker to comple-ment the chromosomal �asdA mutation in the RASV strains (60).To stimulate protective immunity against intracellular pathogenssuch as M. tuberculosis, it is also necessary that the mycobacterialantigens delivered by Salmonella vaccines become accessible to theMHC class I-restricted antigen-processing pathways. Thus, bothplasmid vectors contain the secretion and translocation signals ofthe SPI-1 T3SS effector protein SopE, which are specified by thefirst 80 amino acids in the amino-terminal region of SopE (desig-nated SopENt80), and allow SopE to be specifically transported viathe SPI-1 T3SS. The nucleotide sequences encoding the potentimmunogen ESAT-6 fused in triplicate were cloned downstreamand in frame with sopENt80 into pYA3869 (to generate pYA4248)or pYA3870 (to generate pYA4251) (Table 1; see Fig. S1 in thesupplemental material). The nucleotide sequences encodingESAT-6 and CFP-10, fused in tandem, were also cloned down-stream and in frame with sopENt80 into pYA3869 (to generatepYA4254) and pYA3870 (to generate pYA4257) (Table 1; see Fig.S1 in the supplemental material).

Initially, we observed that S. Typhimurium strain �8916 har-boring pYA3950, which contained a single copy of the DNA se-quences encoding CFP-10 and ESAT-6 fused to sopENt80

(sopENt80-esxB-esxA), expressed the chimeric protein SopENt80–CFP-10 –ESAT-6 (SopENt80-C-E) at very low levels. This fusionprotein was barely detectable as a 30.1-kDa product in whole-cell

lysates and supernatants of the cultured cells by immunoblottingusing anti-ESAT-6 serum (data not shown). However, when sev-eral copies of the gene encoding ESAT-6 were cloned in tandemthree times (sopENt80-esxA-esxA-esxA) or were cloned twice alongwith the DNA fragment encoding CFP-10 (sopENt80-esxA-esxA-esxB), the expression and secretion of the chimeric proteins(SopENt80-E3 and SopENt80-E2C, respectively) by the RASVstrains were improved substantially (see expression details below).The AU1 epitope tag was added to the chimeric recombinant pro-teins at their carboxy termini, generating pYA4250 and pYA4253(SopENt80-E3-AU1) or pYA4256 and pYA4259 (SopENt80-E2C-AU1), or the proteins were fused with the AU1E tag (AU1 epitopetag-Elk tag) to generate pYA4249 and pYA4252 (SopENt80-E3-AU1E) or pYA4255 and pYA4258 (SopENt80-E2C-AU1E). Thus,the mycobacterial protective antigens ESAT-6 and CFP-10 ex-pressed by the Salmonella vaccine strains from the Asd� SopENt80

plasmid derivatives are tagged to detect their secretion and trans-location to the host cell cytosol.

The data included in the figures are results of experiments per-formed using some of the plasmids described above to illustratethe points that we will describe throughout the Results section.Results obtained with other plasmids described in Table 1 werenot included in order to reduce the complexity and amount ofdata presented.

Construction of live recombinant attenuated Salmonellavaccine strains. To analyze and verify the secretion and translo-cation of the chimeric proteins to the cytoplasm of eukaryoticcells, the isogenic S. Typhimurium strains �9930 and �11406, de-rived from strain �8916, were constructed as described in Materi-als and Methods. To evaluate the immunogenicity of the RASVstrains synthesizing and delivering the heterologous antigensESAT-6 and CFP-10, we employed S. Typhimurium �8916 and�9879. Strain �8916, derived from �8768 (7), harbors the deletionmutations �asdA16 and �phoP233. The phoP and phoQ genesform a two-component regulatory system that regulates the tran-scription of several operons and genes necessary for virulence(63). Salmonella �phoP mutants have been described to be safeand immunogenic, and they elicit a predominantly cellular im-mune response (13). Strain �9879, which exhibits regulated de-layed attenuation in vivo, was also used in this study. In this strain,the promoter sequence of the phoPQ virulence genes was replacedwith the improved tightly arabinose-regulated araC PBAD activa-tor promoter cassette (37, 47). Strain �9879 harbors the deletion-insertion mutations �PphoPQ176::TT araC PBAD phoP and�Pcrp527::TT araC PBAD crp (where TT is transcription terminator,P stands for promoter, and the subscripted number refers to acomposite deletion and insertion of the indicated gene). The phoPgene is transcribed from the PBAD promoter, which is activated bythe AraC protein in the presence of arabinose. Thus, this strain isphenotypically wild type and able to colonize the host tissues whengrown in the presence of arabinose. However, since arabinose isnot available in the host tissues, this strain becomes attenuated asa result of the dilution of the gene products during cell division(23, 24). To downregulate translational efficiency, the Shine-Dalgarno (SD) and phoP start codons were modified to preventoverexpression, which could result in a hyperattenuation with adecrease in immunogenicity. The crp gene encodes the cyclic AMP(cAMP) receptor protein necessary for virulence (21), and likephoP, its transcription is arabinose regulated from the PBAD pro-moter (23, 24). This strain also harbors the asdA33 deletion mu-




.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

tation. Finally, to delay the onset of attenuation, the �araBAD23deletion mutation was included in �9879 to prevent consumptionof the arabinose available in the bacterial cytoplasm during oralimmunization and to preclude acid formation during growth ofthe culture for oral inoculation (23, 24).

Plasmid stability. All plasmids were 100% stable in �8916 and�9879 throughout 50 generations of growth under both selectiveand nonselective conditions (data not shown).

Secretion of chimeric ESAT-6 recombinant proteins deliv-ered by T3SS in broth-grown RASV strains. To analyze the secre-tion of chimeric ESAT-6 proteins by the SPI-1 T3SS, single colo-nies of �8916 harboring different ESAT-6 expression plasmids,pYA4248 or pYA4251 (SopENt80-E3), pYA4250 or pYA4253(SopENt80-E3-AU1), pYA4249 or pYA4252 (SopENt80-E3-AU1E),pYA4254 or pYA4257 (SopENt80-E2C), pYA4256 or pYA4259(SopENt80-E2C-AU1), and pYA4255 or pYA4258 (SopENt80-E2C-AU1E), or the SopE expression plasmids pYA4262 or pYA4265(SopE-AU1) and pYA4261 or pYA4264 (SopE-AU1E) weregrown under conditions to induce the expression of the T3SS andchimeric proteins, as described in Materials and Methods. Thechimeric proteins SopENt80-E3 (with a molecular mass of 40.3kDa) and SopE-E2C (40.4 kDa), either of which was fused with anAU1 epitope tag, SopENt80-E3-AU1 (41.1 kDa) and SopE-E2C-AU1 (41.4 kDa), or with an AU1E tag, SopENt80-E3-AU1E (44.9kDa) and SopENt80-E2C-AU1E (45.4 kDa), as well as SopE-AU1(27.1 kDa) and sopE-AU1E (30.9kDa) were detected in whole-celllysates (pellet) and supernatants by immunoblotting using rabbit

anti-ESAT-6 serum or anti-AU1 epitope tag serum (Fig. 1A andB). The data in Fig. 1 (and unpublished results) demonstrate thatthe p15A ori plasmids and the pSC101 ori plasmids produce sim-ilar amounts of the recombinant proteins. Moreover, the presenceof the AU1 or AU1E epitope tags on the recombinant proteinsdoes not impair secretion. To determine if the recombinant fusedproteins were effectively secreted via the T3SS rather than be-ing released in the culture supernatant due to cell lysis, singlecolonies of the RASV �9930 strain (with the artB13a::MudJmutation-insertion, which results in constitutive synthesis of�-galactosidase [30]) harboring p15A ori plasmids pYA4251(SopENt80-E3), pYA4252 (SopENt80-E3-AU1E), pYA4257(SopENt80-E2C), pYA4258 (SopENt80-E2C-AU1E), pYA3950(SopENt80-C-E), pYA4264 (SopE-AU1E), and pYA4265 (SopE-AU1) or the control vector (pYA3870) were grown under condi-tions to stimulate expression and secretion by the T3SS.�-Galactosidase was detected in the pellets (as a protein of ap-proximately 116 kDa) and was undetectable in the supernatants(Fig. 2), indicating that the recombinant chimeric proteins inthe supernatants were secreted by the T3SS. To confirm thisresult, single colonies of �11406 (defective in the expression ofthe T3SS due to deletion of invAC) harboring the same plas-mids were grown in broth culture under conditions to stimu-late expression of the T3SS. The recombinant antigens weredetected only in the pellets and were undetectable in the super-natants of the cultures (Fig. 3). These results indicated that theSalmonella �invAC mutant �11406 was unable to secrete the

FIG 1 Synthesis and secretion of chimeric recombinant proteins by RASV strain �8916. The cells were grown under conditions to stimulate the expression of theSPI-1 T3SS and chimeric proteins, as described in Materials and Methods. (A) Cell fraction profiles of �8916 harboring three fused copies of ESAT-6 in expressionplasmids; (B) cell fraction profiles of �8916 harboring two copies of ESAT-6 fused with CFP-10 in expression plasmids. Whole-cell lysates (pellet) and culturesupernatants from the cultures were analyzed by immunoblotting using rabbit serum against ESAT-6 (Ab � ESAT6, where Ab indicates antibody) or AU1 (Ab� AU1). (A) Lanes: 1, pYA4248 (pSC101 ori, SopENt80-E3); 2, pYA4251 (p15A ori, SopENt80-E3); 3, pYA4250 (pSC101 ori, SopENt80-E3-AU1); 4, molecular massmarkers (MM); 5, pYA4253 (p15A ori, SopENt80-E3-AU1); 6, pYA4249 ((pSC101 ori, SopENt80-E3-AU1E); 7, pYA4252 (p15A ori, SopENt80-E3-AU1E); 8,pYA4262 (pSC101 ori, SopE-AU1); 9, pYA4265 (p15A ori, SopE-AU1); 10, pYA4261 (pSC101 ori, SopE-AU1E). (B) Lanes: 1, pYA4254 (pSC101 ori, SopENt80-E2C); 2, pYA4257 (p15A ori, SopENt80-E2C); 3, pYA4256 (pSC101 ori, SopENt80-E2C-AU1); 4, pYA4259 (p15A ori, SopENt80-E2C-AU1); 5, molecular massmarkers; 6, pYA4255 (pSC101 ori, SopENt80-E2C-AU1E); 7, pYA4258 (p15A ori, SopENt80-E2C-AU1E); 8, pYA4262 (pSC101 ori, SopE-AU1); 9, pYA4265 (p15Aori, SopE-AU1); 10, pYA4264 (p15A ori, SopE-AU1E). Molecular masses of the proteins are indicated on the left, with symbols indicating the proteins ( , , , ,[A] and , , , , [B]).




.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

recombinant proteins and confirmed that the chimeric anti-genic proteins expressed from the Asd� SopENt80 plasmid de-rivatives are secreted by the T3SS.

Translocation of recombinant fused proteins by RASV to cy-toplasm of INT-407 epithelial cells. Initially, we used the phos-phospecific antibody against the phosphorylated Elk peptide con-tained in the AUIE tag of some chimeric proteins to detect if thesechimeric proteins were translocated to the eukaryotic cells by theT3SS. The Elk peptide, derived from the eukaryotic transcriptionfactor Elk-1, is recognized and phosphorylated by eukaryotic pro-tein kinases at serine 383 (25). However, due to the high back-ground obtained with this antibody, we examined the translo-cation of the chimeric proteins using anti-ESAT-6 antibody, asdescribed in Materials and Methods. To analyze whether the

RASV strains �9930(pYA4251), �9930(pYA4252), �9930(pYA4257), and �9930(pYA4258) were able to translocate the ex-pressed recombinant chimeric proteins via the T3SS to the cyto-plasm of the eukaryotic cells, assays were conducted in parallelwith the isogenic strain �11406 (�invAC) transformed indepen-dently with each of the same plasmids. The chimeric proteinsSopENt80-E3, SopENt80-E3-AU1E, SopENt80-E2C, and SopENt80-E2C-AU1E, which were synthesized and secreted by �9930, weredetected as proteins of 40.3 kDa, 44.9 kDa, 40.4 kDa, and 45.4 kDa,respectively, in the cellular fraction of the INT-407 cells by immu-noblotting with anti-ESAT-6 polyclonal antibody (Fig. 4, lanes 2,4, 6, and 8). However, proteins of the same size from strain �11406harboring the same plasmids were undetectable in the cytoplasmicfraction of the INT-407 cells (Fig. 4, lanes 3, 5, 7, and 9). Toevaluate the possibility that the internalized bacteria hadmoved to the cytoplasm of the INT-407 cells rather than hadsecreted the chimeric proteins into the cytoplasm of the INT-407 cells, the INT-407 cells were analyzed by immunoblottingcytoplasmic fractions using a mouse monoclonal antibodyagainst �-galactosidase (expressed constitutively in the bacteria).We observed no detectable �-galactosidase in the cytoplasmicfractions of the INT-407 cells (Fig. 4). To validate these results, thetranslocation assay was performed with strain �9930(pYA4252) inthe presence of cytochalasin D, which inhibits the internalizationof S. Typhimurium by RAW264-7 cells (59). As expected, the re-combinant protein SopENt80-E3-AU1E was detected in the cyto-plasmic fraction of the INT-407 cells in the presence of cytocha-lasin D (Fig. 5, lanes 8 and 9). The results depicted in Fig. 4 and 5suggest that recombinant chimeric mycobacterial proteinsESAT-6 and CFP-10 fused with the amino-terminal and secretorydomains of SopENt80 are expressed and translocated by RASVstrains into the cytosol of eukaryotic cells, which should facilitategeneration of a specific T-cell immune response against M. tuber-culosis. Other investigators who have used SopE or SptP fusionswith viral antigens have demonstrated translocation of those fu-sion proteins into the cytosol of INT-407 cells and have subse-quently shown that such fusions generated specific T-cell re-sponses to the viral antigens (27, 65, 68).

FIG 2 Detection of �-galactosidase in whole-cell lysates and culture superna-tants of RASV strain �9930. The cells were grown under conditions to stimu-late the expression of the SPI-1 T3SS and chimeric proteins, as described inMaterials and Methods. Cell fraction profiles of �9930 harboring differentp15A ori plasmids expressing ESAT-6. Whole-cell lysates (pellet) and culturesupernatants from the cultures were analyzed by immunoblotting using amouse monoclonal antibody against �-galactosidase (Ab � �-galactosidase)and rabbit polyclonal antibodies against ESAT-6 (Ab � ESAT-6). Lanes: 1 and10, molecular mass markers; 2, pYA4251 (p15A ori, SopENt80-E3); 3, pYA4252(SopENt80-E3-AU1E); 4, pYA4257 (SopENt80-E2C); 5, pYA4258 (SopENt80-E2C-AU1E); 6, pY3950 (SopEnt80-C-E); 7, pYA4264 (SopE-AU1E); 8,pYA4265 (SopE-AU1); 9, pYA3870 (vector control).

FIG 3 Expression and secretion of chimeric recombinant proteins by RASVisogenic strain �11406. The cells were grown under conditions to stimulate theexpression of the SPI-1 T3SS and chimeric proteins, as described in Materialsand Methods. Cell fraction profile of isogenic �11406 harboring p15A oriplasmids expressing ESAT-6. Whole-cell lysates (pellet) and culture superna-tant from the cultures were analyzed by Western blotting with rabbit poly-clonal antibodies against ESAT-6 (Ab � ESAT-6). Lanes: 1 and 10, molecularmass markers; 2, pYA4251 (p15A ori, SopENt80-E3); 3, pYA4252 (SopENt80-E3-AU1E); 4, pYA4257 (SopENt80-E2C); 5, pYA4258 (SopENt80-E2C-AU1E);6, pYA3950 (SopENt80-C-E); 7, pYA4264 (SopE-AU1E); 8, pYA4265 (SopE-AU1); 9, pYA3870 (vector control).

FIG 4 Translocation of the ESAT-6 chimeric recombinant proteins by RASVinto the INT-407 cytosol. Cytoplasmic fractions of INT-407 cells infected withRASV expressing the chimeric and recombinant proteins were analyzed byWestern blotting with rabbit polyclonal antibodies against ESAT-6 (Ab �ESAT-6) and a mouse monoclonal antibody against �-galactosidase (Ab ��-galactosidase). Lanes: 1, molecular mass markers consisting of cytoplasmicfractions (C) of INT-407 cells infected with �9930 (lanes 2, 4, 6, and 8) or�11406 (lanes 3, 5, 7, and 9), each harboring p15A ori plasmids expressingESAT-6; 2 and 3, pYA4251 (SopENt80-E3); 4 and 5, pYA4252 (SopENt80-E3-AU1E); 6 and 7, pYA4257 (SopENt80-E2C); 8 and 9, pYA4258 (SopENt80-E2C-AU1E); 10, pellet (P) of �9930(pYA4251), used as a positive control for�-galactosidase.




.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

IgG antibody responses to recombinant chimeric mycobac-terial proteins synthesized in RASV �8916 harboring the Asd�

SopENt80 recombinant plasmids. To investigate whether the se-creted SopENt80-E3-AU1E and SopENt80-E2C recombinant pro-teins induced IgG antibody responses, we orally immunizedgroups of C57BL/6 mice on days 0, 21, and 49 with RASV �8916harboring the control Asd� SopENt80 vector (pYA3870) or itspYA4252 or pYA4257 (p15A ori) derivative. Serum IgG responsesto ESAT-6 and Salmonella outer membrane proteins (SOMPs)from immunized mice were measured by ELISA. Total IgG re-sponses to ESAT-6 in the groups of mice vaccinated with RASVstrains �8916(pYA4252) and �8916(pYA4257) had significantlyhigher anti-ESAT-6 antibody titers at days 20 and 48 (P � 0.001)(Fig. 6A). This induced immune response was further examinedby measuring the levels of IgG isotype subclasses IgG1 and IgG2bin preimmune serum at day 20 and at day 48. In mice, IgG1 isassociated with a Th2-like response, while a Th1 response is asso-ciated with the induction of IgG2a and IgG2b (36). Since the genecoding for IgG2a is deleted in C57BL/6 mice (55), the IgG2b iso-type was used as an indicator of a Th1 response in this study. Thesera from mice immunized with RASV strain �8916(pYA4252) or�8916(pYA4257) had anti-ESAT-6 IgG2b titers higher than theanti-ESAT-6 IgG1 titers at days 20 and 48 (Fig. 6B). These dataindicate that �8916 synthesizing ESAT-6 or ESAT-6 –CFP-10 chi-meric proteins induces a Th1-related IgG2b antibody responsebias (36). Total IgG responses to CFP-10 in mice immunized with�8916(pYA4257) had significant anti-CFP-10 antibody titers atdays 20 and 48 (P � 0.001), although the antibody titers werelower than those to ESAT-6 (Fig. 6C). Significant total IgG re-sponses to SOMPs were observed at 21 days after the first immu-nization (P � 0.01), and increased levels were observed at day 48(P � 0.001) (Fig. 6D). Analogous to what has been observed inBALB/c mice immunized with RASV strains (45, 47), the IgG2btiters against the SOMPs were higher than the IgG1 titers (Fig. 6E),suggesting that a Th1 response to these proteins had occurred.

IgG antibody responses to recombinant mycobacterial anti-gens synthesized in RASV �9879 harboring the Asd� SopENt80

plasmid constructs. To assess the effect of the genotype of theRASV strain on stimulation of antibody responses to ESAT-6, we

orally immunized groups of C57BL/6 mice on days 0, 7, and 49with Salmonella �9879 harboring the control Asd� SopENt80 vec-tor (pYA3870, p15A ori) or its pYA4251 (SopENt80-E3) orpYA4257 (SopENt80-E2C) derivative or with �9879 harboring thepSC101 ori plasmid pYA4254 (SopENt80-E2C). As was observed inthe mice immunized with �8916 harboring the Asd� SopENt80

plasmid derivatives, total IgG responses to ESAT-6 were observedin the sera of mice immunized with Salmonella �9879 harboringpYA4254, pYA4257, or pYA4251, which had significantly higheranti-ESAT-6 IgG levels at day 21 than mice dosed with the vectorcontrol strain �9879(pYA3870) or BSG-dosed mice (P � 0.001)(Fig. 7A). A significant anti-ESAT-6 IgG response was still ob-served on day 65, after three immunizations, although the titers oftotal IgG were not as high as those observed in mice after twoimmunizations with RASV �8916 delivering the same antigens(Fig. 6A). The levels of the IgG isotype subclasses IgG1 and IgG2bwere measured in preimmune serum and at days 21 and 65, andhigher anti-ESAT-6 IgG2b titers than anti-ESAT-6 IgG1 titerswere observed in all of the groups vaccinated with the RASVstrains expressing chimeric antigenic proteins (Fig. 7B). Signifi-cant total IgG responses to SOMPs were observed at 21 and 65days (P � 0.001) (Fig. 7C). Moreover, significant anti-CFP-10total IgG responses were observed in mice immunized with�9879(pYA4257) compared with those of preimmune serum andin mice immunized with the pYA3870 vector control (Fig. 7D).

Stimulation of IFN-� production elicited by RASV �8916 de-livering chimeric ESAT-6 and CFP-10 proteins delivered byT3SS. ELISPOT assays were used to compare ESAT-6 or CFP-10stimulation of IFN-� (Th1-associated) production by spleen cellsfrom immunized and control C57BL/6 mice (Fig. 8A and B).Splenic lymphocytes isolated from mice immunized with strain�8916(pYA4252), synthesizing recombinant SopENt80-E3-AUIE,or �8916(pYA4257), synthesizing SopENt80-E2C, and analyzed 1week after the last immunization produced significantly moreIFN-� spot-forming units (SFU) than spleen cells from BSG-dosed mice (P � 0.01 and P � 0.001, respectively) or mice fromthe �8916(pYA3870) control group (P � 0.05) (Fig. 8A). Similarresults were obtained for CFP-10-specific IFN-�-secreting cellsfrom mice immunized with strain �8916(pYA4257) compared tothe BSG-dosed control group (P � 0.05), although the number ofSFU was much lower than the number of ESAT-6-specific IFN-�-secreting cells (Fig. 8B). These results indicate that the Salmonella-vector system designed to deliver ESAT-6 and CFP-10 as fusedproteins by the T3SS was able to stimulate ESAT-6- and CFP-10-specific IFN-�-secreting cells.

Stimulation of cytokine production in the arabinose-regulated delayed attenuation RASV strain �9879 deliveringchimeric ESAT-6 and CFP-10 proteins by the T3SS. For the ex-periments whose results are depicted in Fig. 9, lymphocytes cul-tured from spleens isolated from each group of C57BL/6 mice 3weeks after the last immunization were subjected to ELISPOTassays to compare production of the proinflammatory Th1 cyto-kines IFN-� and TNF-� and the anti-inflammatory Th2 cytokinesIL-4 and IL-10 (67). The splenocytes were restimulated for 24 hwith 1 �g/well of recombinant ESAT-6 or medium for IFN-� andTNF-� and for 48 h for IL-4 and IL-10. The number of ESAT-6-specific IFN-� SFU from the splenocytes of mice immunized withstrain �9879(pYA4257) or �9879(pYA4254), synthesizingSopENt80-E2C, or �9879(pYA4251), synthesizing SopENt80-E3,was significantly higher than that in the BSG-dosed mouse group

FIG 5 Translocation of the ESAT-6 chimeric recombinant proteins by theRASV �9930 strain into INT-407 cytosol in the presence of cytochalasin D.INT-407 cells were infected with �9930(pYA4252), synthesizing SopENt80-E3-AU1E, in the presence of cytochalasin D (CD), as described in Materials andMethods. The pellet (P) contained unbroken cells, membranes, and adheredand internalized bacteria. The supernatant (cytoplasm [C]) contained the eu-karyotic cytoplasm and translocated proteins. Cell fraction profiles were ana-lyzed by immunoblotting with rabbit polyclonal antibodies against ESAT-6(Ab � ESAT-6). Lanes: 1, total extract (TE) from �9930(pYA4252); 2, super-natant (S) from �9930(pYA4252); 3, molecular mass marker; 4 to 6, pellet (P)from lysates of INT-407 cells infected with �9930(pYA4252) without cytocha-lasin D (lane 4) or with cytochalasin D (lanes 5 and 6); 7 to 9, cytoplasm (C)from INT-407 cells infected with �9930(pYA4252) without cytochalasin D(lane 7) or with cytochalasin D (lanes 8 and 9); lane 10, the bacteria noninter-nalized in the culture medium (BNI).




.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

FIG 6 Antibody responses to ESAT-6, CFP-10, and SOMPs in mice immunized with �8916 strains. C57BL/6 mice were orally immunized at days 0, 21, and 49with 1 � 109 CFU of the RASV �8916 harboring pYA3870 (vector control) or its derivative pYA4252 (SopENt80-E3-AU1E) or pYA4257 (SopENt80-E2C). The IgGtiters were measured by ELISA in preimmune serum (PI) and immunized mice at 20 and 48 days (d20 and d48, respectively) after the first immunization. (A)Total serum IgG response to ESAT-6. ��, P � 0.001 compared to mice immunized with the vector control strain �8916(pYA3870), BSG-dosed mice, orpreimmune serum. (B) Subclasses IgG1 and IgG2b in serum in response to ESAT-6. (C) Total serum IgG response to CFP-10. ��, P � 0.001 compared to miceimmunized with the vector control strain �8916(pYA3870) or preimmune serum. (D) Total serum IgG response to SOMPs. ��, P � 0.01, and ��, P � 0.001,compared to BSG-dosed mice and preimmune serum. The data represent endpoints of antibodies in pooled sera from 6 mice immunized at the indicated timeafter immunization. (E) Serum IgG1 and IgG2b responses to SOMPs in a 1:1,000 dilution of pooled sera from 6 mice. Error bars represent variations betweenduplicate wells. The statistical significance was calculated by one-way ANOVA and Tukey’s posttest.



.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

(P � 0.001) (Fig. 9A). However, only splenocytes from mice vac-cinated with �9879(pYA4257) showed a significantly higher num-ber of IFN-� SFU than the control group dosed with�9879(pYA3870) (P � 0.05). The number of ESAT-6-specificTNF-� SFU from splenocytes from all of the groups of micevaccinated with �9879(pYA4251), �9879(pYA4254), and�9879(pYA4257) was significantly higher than that in the BSGcontrol group (P � 0.001), and the highest production was de-tected in mice vaccinated with �9879(pYA4257) (Fig. 9B). Thenumber of TNF-� SFU produced by this group was not signifi-cantly different from that of the vector control group dosed with�9879(pYA3870). Very low levels of ESAT-6-specific IL-4 SFUwere detected from splenocytes of mice vaccinated with �9879expressing any of the SopE-M. tuberculosis fusion proteins (datanot shown). Production of IFN-� and TNF-� SFU by the vectorcontrol group in response to ESAT-6 was surprising, and we donot understand the basis for these results, since ESAT-6 is an M.

tuberculosis-specific protein. Production of IL-10 from spleno-cytes was not detected in any of the groups of vaccinated mice(data not shown). These results indirectly suggested a Th1 im-mune response, characterized by the secretion of IFN-� andTNF-� in mice immunized with the strains expressing the recom-binant antigens, which was significantly higher for the strain�9879 harboring pYA4257 (p15A ori) and synthesizing SopENt80-E2C than for �9879 harboring pYA4254 (pSC101 ori) and synthe-sizing the same recombinant protein or for �9879(pYA4251) syn-thesizing SopENt80-E3 (Fig. 9A and B).

Evaluation of protective immunity elicited by �8916 harbor-ing Asd� SopENt80 recombinant plasmids. To examine the pro-tective efficacy of Salmonella RASV–ESAT-6 vaccines against M.tuberculosis infection, the immunized mice were challenged with alow aerosol dose (100 bacteria per lung) of virulent M. tuberculosisH37Rv at 4 weeks after the last immunization. Five mice per groupwere euthanized at 6 weeks postchallenge, and protection was

FIG 7 Antibody responses to ESAT-6, CFP-10, and SOMPs in mice immunized with �9879 strains. C57BL/6 mice were orally immunized at days 0, 7, and 49with 1 � 109 CFU of the RASV �9879 strain harboring pYA3870 (control), pYA4254 (pSC101 ori, SopENt80-E2C), pYA4257 (p15A ori, SopENt80-E2C), orpYA4251 (p15A ori, SopENt80-E3) or BSG. The IgG titers were measured by ELISA in preimmune serum (PI) and immunized mice at 21 and 65 days after the firstimmunization. (A) Total serum IgG response to ESAT-6. �, P � 0.05, and ��, P � 0.001, compared to mice immunized with the vector control strain�9879(pYA3870), BSG-dosed mice, or preimmune serum. (B) Subclasses IgG1 and IgG2a in serum in response to ESAT-6. (C) Total serum IgG response toSOMPs. ��, P � 0.01, and ��, P � 0.001, for comparison with BSG-dosed mice and preimmune serum. (D) Total serum IgG response to CFP-10. ��, P � 0.001compared to mice immunized with the vector control strain �9879(pYA3870) or preimmune serum. The data represent endpoints of antibodies in pooled serafrom 6 mice immunized at the indicated time after immunization. Error bars represent variations between duplicate wells. The statistical significance wascalculated by one-way ANOVA and Tukey’s posttest.




.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

measured by enumeration of M. tuberculosis CFU in the lungs andspleens. The group of mice orally immunized with the�8916(pYA3870) vector control did not show a reduction in thebacterial load in the lungs and spleens compared with the bufferedsaline (BSG)-treated control group (Fig. 10A and B). The group ofmice immunized with �8916(pYA4252), synthesizing SopENt80-E2C-AUIE, showed a modest reduction of the bacterial load in thelungs, but not in the spleen, compared with the �8916(pYA3870)control group. The group of mice vaccinated with �8916(pYA4257), synthesizing SopENt80-E2C, showed a significant re-duction in the bacterial load in the lungs and spleens comparedwith mice immunized with �8916(pYA3870) (P � 0.05), but theload was not reduced to the extent that it was in mice immunizedwith M. bovis BCG (positive vaccine control) (Fig. 10A and B).

Evaluation of protective immunity elicited by �9879 harbor-ing Asd� SopENt80 recombinant plasmids. To examine the pro-tective efficacy of the arabinose-regulated RASV strain against M.tuberculosis infection, groups of C57BL/6 mice immunized with�9879 expressing the SopENt80-mycobacterial antigens were chal-lenged as described above with virulent M. tuberculosis H37Rv. Sixmice per group were euthanized at 6 weeks postchallenge, and theprotection was measured as described above. The group of miceorally immunized with the �9879(pYA3870) vector control or�9879(pYA4254) (pSC101 ori), synthesizing SopENt80-E2C,showed reductions of bacterial loads in the lungs and spleens com-pared with the buffered saline (BSG)-treated control group, butthis difference was not statistically significant (Fig. 11A and B).

The groups of mice immunized with �9879 bearing the p15A oriplasmid pYA4257, which synthesizes SopENt80-E2C, or pYA4251,which synthesizes SopENt80-E3, showed greater reductions in bac-terial loads in the lungs and spleens than the BSG-dosed controlgroups (P � 0.05) but not the M. bovis BCG-immunized groups(Fig. 11A and B).

DISCUSSION

Rüssmann et al. (65) first showed that viral antigen epitopes couldbe delivered by the Salmonella T3SS to elicit protective immuneresponses. Shams et al. (68) demonstrated that antigens of thelymphocytic choriomeningitis virus (LCMV) fused to SptP andthus delivered by the T3SS elicited specific antiviral cyotoxicT-lymphocyte (CTL) responses, as well as induced production ofspecific CD8� memory T cells, following intragastric immuniza-tion of mice with an attenuated S. Typhimurium isolate produc-ing the SptP-LCMV antigen fusions. These investigators alsodemonstrated long-lasting protection of immunized mice againstintracranial infection with live LCMV, indicating successful stim-ulation of cell-mediated immunity as a consequence of antigendelivery by the Salmonella T3SS (68). Konjufca et al. (48) deliveredantigens from two Eimeria species as fusion proteins with theSPI-1 effector proteins SptP and SopE, using S. Typhimurium

FIG 8 Antigen-specific cytokine responses in spleen cells from mice vacci-nated with Salmonella �8916 harboring the p15A ori plasmid pYA4252(SopENt80-E3-AU1E) or pYA4257 (SopENt80-E2C). Antigen-specific IFN-�cytokine-forming T cells were detected by ELISPOT assay. C57BL/6 micewere orally immunized with �8916(pYA4252), �8916(pYA4257), or�8916(pYA3870) (control) or BSG dosed at days 0, 21, and 49. One week afterthe last immunization, spleens were obtained from three mice per group. Anal-ysis was conducted on the cells from individual mice in triplicate. Cells wererestimulated for 48 h with 1 �g/well of recombinant ESAT-6, CFP-10, ormedium for ELISPOT assays (A and B). The results are presented as number ofELISPOTs per million splenocytes minus background number of ELISPOTsfrom unpulsed mock controls. (A) �, P � 0.05 for comparison of the RASV�8916(pYA4257) vaccine group with the �8916(pYA3870) vector control;��, P � 0.001 for comparison with BSG group for ESAT-6-specific IFN-�cytokine-secreting cells; ��, P � 0.01 for comparison of the �8916(pYA4252)vaccine group with BSG group for ESAT-6-specific IFN-� secreting cells. (B) �,P � 0.05 for comparison of the �8916(pYA4257) vaccine group with BSGgroup for CFP-10-specific IFN-� secretion. Error bars represent variationsbetween triplicate wells. The statistical significance was calculated by one-wayANOVA and Tukey’s posttest.

FIG 9 Antigen-specific cytokine responses in spleen cells from mice vacci-nated with Salmonella �9879 harboring pYA4251 (p15A ori, SopENt80-E3),pYA4254 (pSC101 ori, SopENt80-E2C), or pYA4257 (p15A ori, SopENt80-E2C).Antigen-specific IFN-� and TNF-� cytokine-secreting cells were detected byELISPOT assay. C57BL/6 mice were orally immunized with �9879(pYA4251),�9879(pYA4254), �9879(pYA4257), or �9879(pYA3870) (control) or BSGdosed at days 0, 7, and 49. Three weeks after the last immunization, spleenswere obtained from three mice per group. The spleen cells from the micewithin a group were pooled and were restimulated with 1 �g/well of recombi-nant ESAT-6 or medium for 24 h for IFN-� and TNF-� (A and B) and sub-jected to ELISPOT assays. The results are presented as number of ELISPOTsper million splenocytes minus background number of ELISPOTs from un-pulsed mock controls. (A and B) �, P � 0.05 for comparison of the Salmonella�9879(pYA4257) vaccine group with the �9879(pYA3870) vector control;��, P � 0.001 for comparison of the �9879(pYA4257) with the�9879(pYA4254) and all vaccinated groups with the BSG group for ESAT-6-specific IFN-� and TNF-� cytokine-secreting cells. Error bars represent vari-ations between triplicate wells. The statistical significance was calculated byone-way ANOVA and Tukey’s posttest.




.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

RASV strain �8879 to orally immunize chickens. Like M. tubercu-losis, Eimeria is an intracellular pathogen and cell-mediated im-munity is necessary to provide protection to chickens against in-fection. Konjufca et al. demonstrated that immunization ofchickens with RASV �8879 producing the Eimeria antigens, whichwere delivered by the T3SS, induced protection against infectionwith E. acervulina, a significant pathogen causing coccidiosis inchickens (48). SopE has been fused to fragments of the simianimmunodeficiency virus (SIV) Gag antigen and delivered to rhe-sus macaques by attenuated S. Typhimurium strains via the T3SS(27). These investigators demonstrated Gag-specific CTL re-

sponses, which were enhanced when the macaques received abooster immunization with vaccinia virus Ankara producing theSIV Gag protein (27). Gag-specific CD8� T-cell responses weredetected in the peripheral blood and in lymphocytes isolated fromthe colons of the immunized macaques (27). Heterologous anti-gens delivered by the T3SS to secrete and translocate the Gag pro-tein from the human immunodeficiency virus (HIV) have alsobeen described to be a potential vaccine (13). The Gag protein wasfused to the secretion and translocation signals of SopE and waseffectively translocated to the cell cytosol to be presented by MHCclass I (13). Oral immunization of mice with 108 CFU of S. enterica

FIG 10 Protection against M. tuberculosis H37Rv aerosol challenge in mice immunized with RASV �8916 strains. C57BL/6 mice were orally immunized with�8916(pYA4252) (synthesizing SopENt80-E3-AU1E), �8916(pYA4257) (synthesizing SopENt80-E2C), �8916(pYA3870) (vector control), or M. bovis BCG orBSG-dosed at days 0, 21, and 49. Mice were challenged with M. tuberculosis by aerosol 4 weeks after the last immunization and euthanized 6 weeks later, andbacterial loads in the lungs (A) and spleens (B) were measured. �, P � 0.05, and ��, P � 0.01, for significance of vaccinated groups compared with�8916(pYA3870) (control).

FIG 11 Protection against M. tuberculosis H37Rv aerosol challenge in mice immunized with RASV �9879 strains. C57BL/6 mice were orally immunized with�9879(pYA4251) (synthesizing SopENt80-E3), �9879(pYA4254) (pSC101 ori, synthesizing SopENt80-E2C), �9879(pYA4257 (p15A ori, synthesizing SopENt80-E2C), or �8916(pYA3870) (control), or M. bovis BCG or were BSG dosed at days 0, 7, and 49. Mice were challenged with M. tuberculosis by aerosol 4 weeks afterthe last immunization and euthanized 6 weeks later, and bacterial loads in the lungs (A) and spleens (B) were measured. �, P � 0.05, ��, P � 0.01, and ��, P �0.001, for significance of vaccinated groups compared with BSG-dosed mice.




.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

serovar Typhimurium �phoP �phoQ expressing the optimizedHIV Gag protein, followed by an intraperitoneal boost with 104

CFU of an S. Typhimurium �asd strain expressing the same anti-gen 4 weeks later, elicited T-cell responses with significantly largenumbers of Gag-specific CD8� T cells (13). Therefore, we hypoth-esized that the ability to inject effectors of the T3SS could be uti-lized for the cytosolic delivery of M. tuberculosis antigens by atten-uated Salmonella strains. Protection against intracellularpathogens such as M. tuberculosis depends on the induction ofcell-mediated immunity. CD4� T cells play a central role in pro-tection against infections caused by M. tuberculosis (57), andCD8� T cells are also important for protection against this patho-gen (28, 73). In this study, two plasmid vectors were geneticallyengineered to encode the secretion and translocation signals ofSalmonella T3SS effector SopE protein for cytosolic injection ofM. tuberculosis T-cell antigens to induce cellular immunity againstM. tuberculosis in orally immunized mice.

Live attenuated Salmonella strains have been shown to inducemucosal, humoral, and cell-mediated immune responses to het-erologous antigens (13, 19, 24, 27, 48, 68). Other vaccines againstM. tuberculosis based on attenuated Salmonella strains have showninduction of immune responses to M. tuberculosis antigens, suchas antigen 85B (Ag85B [41]) or fusions of Ag85B and ESAT-6 (38,78). One study using S. Typhimurium SL7207 aroA harboring theplasmid pMO6esat, which expresses and secretes ESAT-6 throughan HlyA secretion system, delivered intravenously reduced thenumbers of M. tuberculosis H37Rv CFU in the lungs of mice chal-lenged intravenously with a single dose of 5 � 105 CFU of H37Rv(58). The secretion of antigens by the Salmonella strain was im-portant to elicit immune responses against M. tuberculosis. How-ever, these studies were conducted using a Salmonella strain with asingle attenuating mutation (12), and both immunization andchallenge were administered by intravenous inoculation, which isnot the normal route of entry of either Salmonella or M. tubercu-losis. Intravenous injection of either of these bacteria has beenshown to elicit different patterns of immune responses than inoc-ulation by normal routes of entry (12, 19, 24, 61). In the presentstudy, we evaluated the potential of RASVs harboring Asd� So-pENt80 vectors with different replication origins, including thosewith low copy numbers (p15A) and very low copy numbers(pSC101), and encoding two mycobacterial protective antigens,ESAT-6 (fused in tandem two or three times) and CFP-10, to bedelivered into the cell cytosol of the immunized host by the Sal-monella T3SS to elicit specific immune responses against M. tu-berculosis. Two schedules were employed for oral immunizationof mice. When the vaccine strain �8916 was used, mice were im-munized at days 0, 21, and 49. For the �9879 strain, mice wereimmunized at days 0, 7, and 49. We reasoned that the secondvaccination given at day 7 could result in a better colonization ofthe host tissues by the vaccine strain than immunization at day 21,when an immune response against the Salmonella vaccine wasincreasing. Interestingly, we did not observe differences in theantibody responses elicited by either Salmonella vaccine strain,even with the variation of the schedule of immunization. How-ever, with the second immunization schedule using �9879, signif-icantly lower levels of IFN-� were produced by splenocytes of miceimmunized with the RASVs expressing the mycobacterial anti-gens. These lower levels of IFN-� could be due to the fact that theELISPOT assay was performed at a different time than it was with�8916 (at week 3 instead of week 1, after the last immunization) or

to the genotype of �9879, which harbors several deletion-insertion mutations and delayed attenuation, or to both condi-tions. We also examined the effect of different copy numbers ofthe plasmid vectors on the immune response. We observed thatthe serum IgG responses to ESAT-6 were similar in �9879 harbor-ing either the Asd� SopENt80 plasmid derivative pYA4254(pSC101 ori) or the derivative pYA4257 (p15A ori) and encodingthe same chimeric protein, SopENt80-E2C. The levels of total IgGin the sera were generally not affected by the vaccine strain or thecopy number of the plasmid vector, although �8916 harboringpYA4257 elicited high levels of anti-ESAT-6 for a longer periodthan the other RASV constructs. The IgG subclass distribution isdependent on several factors, including the cytokine environ-ment, the type of cells that are presenting the antigen, and the doseof antigen (71). The IgG subclass distribution was not affected bythe use of vaccine vectors with low (p15A ori) or very low (pSC101ori) copy numbers. The predominant subclass of anti-ESAT-6 wasIgG2b, which is characteristic of a Th1 response (35). These datasuggest that the lower dose of antigen synthesized and delivered bythe Salmonella vaccine strain harboring pYA4254 (pSC101 ori)also presented a bias toward a Th1 immune response. However,the levels of anti-ESAT-6 IgG2b and IgG1 were lower in the miceimmunized with �9879 harboring the pSC101 ori plasmid than inthe mice immunized with �9879 harboring the p15A ori plasmid(Fig. 7B).

The antigen-specific stimulation of cytokine production wasinfluenced by the copy number of the vaccine plasmids. Our re-sults showed that both strains �8916 and �9879 harboringpYA4257 (p15A ori), synthesizing the chimeric SopENt80-E2Cprotein, induced significantly higher IFN-� in splenocytes fromvaccinated mice than �9879 harboring pYA4254 (pSC101 ori) andsynthesizing the same antigenic protein. The exception was with�9879 harboring pYA4251 (p15A ori), synthesizing SopENt80-E3protein, which induced IFN-� production similar to that for�9879 harboring pYA4254. Low but significant CFP-10-specificIFN-� production was also induced in mice immunized with both�8916 and �9879 harboring pYA4257. Production of IFN-� andTNF-� is crucial to eukaryotic cells for fighting infections causedby intracellular pathogens such as M. tuberculosis and may play arole in the clearance of bacteria from the infected host (16, 30). Wedetected very low numbers of IL-4-secreting cells, but IL-10 secre-tion was not detected in mice vaccinated with any RASV strain.These results (higher levels of IgG2b antibodies and elicitation ofIFN-�) suggest that the RASV-M. tuberculosis vaccines are stimu-lating a Th1 response and are in agreement with observationsfrom previous studies in which oral immunization of mice withSalmonella induced a bias toward a Th1 immune response (62),delivery of viral and parasite antigens via the Salmonella T3SSelicited cell-mediated immune responses to those antigens (13, 27,48, 68), and vaccination with the Salmonella phoP mutant elicitedIFN-�-dependent cellular immunity (13, 65).

In this study, we observed that the protective efficacy conferredby the Salmonella vaccines in orally immunized mice was influ-enced by the dose of antigen expressed and delivered from thevaccine strains harboring plasmids with different copy numberreplication origins. A significant decrease in the number of M.tuberculosis CFU was observed in the lungs and spleens of miceimmunized with �9879(pYA4257) or �9879(pYA4251), contain-ing the p15A replication origin, compared to mice immunizedwith �9879(pYA4254), containing the pSC101 replication origin.




.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

Both of the strains (�8916 and �9879) with pYA4257 were theRASVs that induced the highest stimulation of IFN-� and TNF-�secretion, resulting in significant protection of mice against M.tuberculosis infection, although neither achieved the level of pro-tection observed in the mice immunized with M. bovis BCG by asubcutaneous route (the “gold standard” for TB vaccines). Addi-tionally, strains �8916(pYA4252), synthesizing SopENt80-E3-AU1E, and �9879(pYA4254), synthesizing SopENt80-E2C, showeda modest reduction in the number of M. tuberculosis CFU that wasnot significant compared with the number for the BSG control.Interestingly, strain �9879(pYA4251), synthesizing SopENt80-E3, which induced lower IFN-� and TNF-� production, similarto that observed with �9879(pYA4254), was able to confer thesame level of protection against M. tuberculosis infection as�8916(pYA4257).

Based on the results of other investigators who have used SopEfusions with viral and parasite antigens and demonstrated elicita-tion of protective cell-mediated immune responses (13, 27, 48, 68)and our demonstration that our SopE-M. tuberculosis fusion pro-teins are translocated into the cytoplasm of INT-407 cells, we hy-pothesize that the RASV strains harboring Asd� SopENt80 plasmidderivatives allowed successful secretion and translocation of themycobacterial antigenic chimeric proteins into the host cell cyto-sol to become accessible to the MHC class I-restricted processingpathways to likely stimulate T-cell immune responses. Thus, theRASV strains harboring Asd� SopENt80 vaccine plasmid pYA4257or pYA4251 administered orally to mice produced a significantreduction of the bacterial load in the lungs and spleens of miceorally vaccinated and challenged with aerosol-delivered M. tuber-culosis. The protection conferred by the RASV strains harboringthe Asd� SopENt80 plasmids expressing M. tuberculosis antigenscould be improved by using a heterologous prime-boosting strat-egy with antigens delivered as a subunit vaccine and an adjuvantor combined with M. bovis BCG vaccination. However, since M.bovis BCG lacks the esxA and esxB genes, immunizing first withBCG would necessitate at least two immunizations with RASVsexpressing ESAT-6 and CFP-10 or a combination of RASV immu-nization followed by immunization with a subunit vaccine or in-clusion of genes expressing additional antigens of M. tuberculosisthat are shared with M. bovis BCG in the RASV strains. Takentogether, the data produced here encourage the use of the RASVstrains harboring Asd� SopENt80 vaccine plasmids to deliver pro-tective T-cell antigens by the T3SS to induce the T-cell responsesrequired for protection against M. tuberculosis TB.

ACKNOWLEDGMENTS

We thank Ascencion Torres-Escobar and Praveen Alamuri for their valu-able suggestions and critical reviews of the manuscript.

This research was supported by National Institutes of Health grant AI56289.

REFERENCES1. Bald D, Koul A. 2010. Respiratory ATP synthesis: the new generation of

mycobacterial drug targets? FEMS Microbiol. Lett. 308:1–7.2. Bastos RG, Borsuk S, Seixas FK, Dellagostin OA. 2009. Recombinant

Mycobacterium bovis BCG. Vaccine 27:6495– 6503.3. Behr MA, et al. 1999. Comparative genomics of BCG vaccines by whole-

genome DNA microarray. Science 284:1520 –1523.4. Bertani G. 1951. Studies on lysogenesis. I. The mode of phage liberation

by lysogenic Escherichia coli. J. Bacteriol. 62:293–300.5. Berthet FX, Rasmussen PB, Rosenkrands I, Andersen P, Gicquel B.

1998. A Mycobacterium tuberculosis operon encoding ESAT-6 and a novel

low-molecular-mass culture filtrate protein (CFP-10). Microbiology 144:3195–3203.

6. Bochner BR. 1984. Curing bacterial cells of lysogenic viruses by usingUCB indicator plates. Biotechniques 2:234 –240.

7. Bollen WS, Gunn BM, Mo H, Lay MK, Curtiss R, III. 2008. Presence ofwild-type and attenuated Salmonella enterica strains in brain tissues fol-lowing inoculation of mice by different routes. Infect. Immun. 76:3268 –3272.

8. Bradford MM. 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dyebinding. Anal. Biochem. 72:248 –254.

9. Brandt L, Elhay M, Rosenkrands I, Lindblad EB, Andersen P. 2000.ESAT-6 subunit vaccination against Mycobacterium tuberculosis. Infect.Immun. 68:791–795.

10. Cárdenas L, Clements JD. 1992. Oral immunization using live attenuatedSalmonella spp. as carriers of foreign antigens. Clin. Microbiol. Rev.5:328 –342.

11. Cardona PJ. 2010. Revisiting the natural history of tuberculosis. Theinclusion of constant reinfection, host tolerance, and damage-responseframeworks leads to a better understanding of latent infection and itsevolution towards active disease. Arch. Immunol. Ther. Exp. 58:7–14.

12. Cheminay C, Hensel M. 2008. Rational design of Salmonella recombinantvaccines. Int. J. Med. Microbiol. 298:87–98.

13. Chen LM, Briones G, Donis RO, Galán JE. 2006. Optimization of thedelivery of heterologous proteins by the Salmonella enterica serovar Ty-phimurium type III secretion system for vaccine development. Infect. Im-mun. 74:5826 –5833.

14. Cohen SN, Miller CA. 1970. Non-chromosomal antibiotic resistance inbacteria. II. Molecular nature of R-factors isolated from Proteus mirabilisand Escherichia coli. J. Mol. Biol. 50:671– 687.

15. Collazo CM, Galán JE. 1997. The invasion-associated type III system ofSalmonella Typhimurium directs the translocation of Sip proteins into thehost cell. Mol. Microbiol. 24:747–756.

16. Cooper AM, et al. 1993. Disseminated tuberculosis in interferon gammagene-disrupted mice. J. Exp. Med. 178:2243–2247.

17. Cozzarelli NR, Kelly RB, Kornberg A. 1968. A minute circular DNA fromEscherichia coli 15. Proc. Natl. Acad. Sci. U. S. A. 60:992–999.

18. Curtis R, III. 1965. Chromosomal aberrations associated with mutationsto bacteriophage resistance in Escherichia coli. J. Bacteriol. 89:28 – 40.

19. Curtiss R, III. 2002. Bacterial infectious disease control by vaccine devel-opment. J. Clin. Invest. 110:1061–1066.

20. Curtiss R, III. April 2003. Regulation of attenuation of live vaccines toenhance cross protective immunity. International patent WO 03/096812.

21. Curtiss R, III, Kelly SM. 1987. Salmonella Typhimurium deletion mu-tants lacking adenylate cyclase and cyclic AMP receptor protein are avir-ulent and immunogenic. Infect. Immun. 55:3035–3043.

22. Curtiss R, III, Kong W. June 2006. Regulated bacterial lysis for genevaccine vector delivery and antigen release. US patent 2006/0140975 A1.

23. Curtiss R, III, et al. 2009. Salmonella enterica serovar Typhimuriumstrains with regulated delayed attenuation in vivo. Infect. Immun. 77:1071–1082.

24. Curtiss R, III, et al. 2010. New technologies in using recombinant atten-uated Salmonella vaccine vectors. Crit. Rev. Immunol. 30:255–270.

25. Day JB, Ferracci F, Plano GV. 2003. Translocation of YopE and YopNinto eukaryotic cells by Yersinia pestis yopN, tyeA, sycN, yscB and lcrGdeletion mutants measured using a phosphorylatable peptide tag andphosphospecific antibodies. Mol. Microbiol. 47:807– 823.

26. Edwards RA, Keller LH, Schifferli DM. 1998. Improved allelic exchangevectors and their use to analyze 987P fimbria gene expression. Gene 207:149 –157.

27. Evans DT, et al. 2003. Mucosal priming of simian immunodeficiencyvirus-specific cytotoxic T-lymphocyte responses in rhesus macaques bythe Salmonella type III secretion antigen delivery system. J. Virol. 77:2400 –2409.

28. Feng CG, Bean AGD, Hooi H, Briscoe H, Britton WJ. 1999. Increase ingamma-interferon-secreting CD8�, as well as CD4�, T cells in the lungsfollowing aerosol infection with Mycobacterium tuberculosis. Infect. Im-mun. 67:3242–3247.

29. Fine PE. 1995. Variation in protection by BCG: implications of and forheterologous immunity. Lancet 346:1339 –1345.

30. Flynn JL, et al. 1993. An essential role for interferon gamma in resistanceto Mycobacterium tuberculosis infection. J. Exp. Med. 178:2249 –2254.

31. Foster JW, Bearson B. 1994. Acid-sensitive mutants of Salmonella Typhi-




.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

murium identified through a dinitrophenol lethal screening strategy. J.Bacteriol. 176:2596 –2602.

32. Galán JE, Curtiss R, III. 1990. Expression of Salmonella typhimuriumgenes required for invasion is regulated by changes in DNA supercoiling.Infect. Immun. 58:1879 –1885.

33. Galán JE, Ginocchio C, Costeas P. 1992. Molecular and functionalcharacterization of the Salmonella invasion gene invA: homology of InvAto members of a new protein family. J. Bacteriol. 174:4338 – 4349.

34. Galán JE, Collmer A. 1999. Type III secretion machines: bacterial devicesfor protein delivery into host cells. Science 284:1322–1328.

35. Germanier R, Fürer E. 1971. Immunity in experimental Salmonellosis. II.Basis for the avirulence and protective capacity of galE mutants of Salmo-nella Typhimurium. Infect. Immun. 4:663– 673.

36. Getahun A, Dahlström J, Wernersson S, Heyman B. 2004. IgG2a-mediated enhancement of antibody and T cell responses and its relation toinhibitory and activating Fc gamma receptors. J. Immunol. 172:5269 –5276.

37. Guzman LM, Belin D, Carson MJ, Beckwith J. 1995. Tight regulation,modulation, and high-level expression by vectors containing the arabi-nose PBAD promoter. J. Bacteriol. 177:4121– 4130.

38. Hall LJ, et al. 2009. Characterisation of a live Salmonella vaccine stablyexpressing the Mycobacterium tuberculosis Ag85B-ESAT6 fusion protein.Vaccine 27:6894 – 6904.

39. Hardt WD, Chen LM, Schuebel KE, Bustelo XR, Galán JE. 1998.Salmonella Typhimurium encodes an activator of Rho GTPases thatinduces membrane ruffling and nuclear responses in host cells. Cell 93:815– 826.

40. Hardt WD, Urlaub H, Galán JE. 1998. A substrate of the centisome 63type III protein secretion system of Salmonella Typhimurium is encodedby a cryptic bacteriophage. Proc. Natl. Acad. Sci. U. S. A. 95:2574 –2579.

41. Hess J, et al. 2000. Protection against murine tuberculosis by an attenu-ated recombinant Salmonella Typhimurium vaccine strain that secretesthe 30-kDa antigen of Mycobacterium bovis BCG. FEMS Immunol. Med.Microbiol. 27:283–289.

42. Jenson AB, Jenson MC, Cowsert L, Ghim SJ, Sundberg JP. 1997.Multiplicity of uses of monoclonal antibodies that define papillomaviruslinear immunodominant epitopes. Immunol. Res. 16:115–119.

43. Juárez-Rodríguez MD, Clark-Curtiss J, Torres-Escobar A, Curtiss R,III. 2007. Development of recombinant attenuated Salmonella vaccine(RASV) to deliver Mycobacterium tuberculosis ESAT-6-CFP10 antigens bythe type III secretion system, abstr D-091, p 113. Abstr. 107th Gen. Meet.Am. Soc. Microbiol. American Society for Microbiology, Washing-ton, DC.

44. Kang HY, Dozois CM, Tinge SA, Lee TH, Curtiss R, III. 2002.Transduction-mediated transfer of unmarked deletion and point muta-tions through use of counterselectable suicide vectors. J. Bacteriol. 184:307–312.

45. Kang HY, Srinivasan J, Curtiss R, III. 2002. Immune responses torecombinant pneumococcal PspA antigen delivered by live attenuatedSalmonella enterica serovar Typhimurium vaccine. Infect. Immun. 70:1739 –1749.

46. Karavolos MH, et al. 2005. Type III secretion of the Salmonella effectorprotein SopE is mediated via an N-terminal amino acid signal and not anmRNA sequence. J. Bacteriol. 187:1559 –1567. (Erratum, 187:5505.)

47. Kong W, et al. 2008. Regulated programmed lysis of recombinant Sal-monella in host tissues to release protective antigens and confer biologicalcontainment. Proc. Natl. Acad. Sci. U. S. A. 105:9361–9366.

48. Konjufca V, Jenkins M, Wang S, Juarez-Rodriguez MD, Curtiss R, III.2008. Immunogenicity of recombinant attenuated Salmonella enterica se-rovar Typhimurium vaccine strains carrying a gene that encodes Eimeriatenella antigen SO7. Infect. Immun. 76:5745–5753.

49. Kubori T, Galán JE. 2003. Temporal regulation of Salmonella virulenceeffector function by proteasome-dependent protein degradation. Cell115:333–342.

50. Lee SH, Galán JE. 2003. InvB is a type III secretion-associated chaperonefor the Salmonella enterica effector protein SopE. J. Bacteriol. 185:7279 –7284.

51. Lennox ES. 1955. Transduction of linked genetic characters of the host bybacteriophage P1. Virology 1:190 –206.

52. Li Y, et al. 2009. Evaluation of new generation Salmonella enterica serovarTyphimurium vaccines with regulated delayed attenuation to induce im-mune responses against PspA. Proc. Natl. Acad. Sci. U. S. A. 106:593–598.

53. Liu T, Chopra AK. 2010. An enteric pathogen Salmonella enterica serovar

Typhimurium suppresses tumor growth by downregulating CD44(high)and CD4T regulatory (T(reg)) cell expression in mice: the critical role oflipopolysaccharide and Braun lipoprotein in modulating tumor growth.Cancer Gene Ther. 17:97–108.

54. Mahairas GG, Sabo PJ, Hickey MJ, Singh DC, Stover CK. 1996. Mo-lecular analysis of genetic differences between Mycobacterium bovis BCGand virulent M. bovis. J. Bacteriol. 178:1274 –1282.

55. Martin RM, Lew AM. 1998. Is IgG2a a good Th1 marker in mice? Immu-nol. Today 19:49.

56. Matsuyama S, Inokuchi K, Mizushima S. 1984. Promoter exchangebetween ompF and ompC, genes for osmoregulated major outer mem-brane proteins of Escherichia coli K-12. J. Bacteriol. 158:1041–1047.

57. Mogues T, Goodrich ME, Ryan L, LaCourse R, North RJ. 2001. Therelative importance of T cell subsets in immunity and immunopathologyof airborne Mycobacterium tuberculosis infection in mice. J. Exp. Med.193:271–280.

58. Mollenkopf HJ, Groine-Triebkorn D, Andersen P, Hess J, KaufmannSH. 2001. Protective efficacy against tuberculosis of ESAT-6 secreted by alive Salmonella Typhimurium vaccine carrier strain and expressed by na-ked DNA. Vaccine 19:4028 – 4035.

59. Monach DM, Raupach B, Hromockyj AE, Falkow S. 1996. Salmonellatyphimurium invasion induces apoptosis in infected macrophages. Proc.Natl. Acad. Sci. U. S. A. 93:9833–9838.

60. Nakayama K, Kelly SM, Curtiss R, III. 1988. Construction of an ASD�

expression-cloning vector: stable maintenance and high level expressionof cloned genes in a Salmonella vaccine strain. Biotechnology (NY)6:693– 697.

61. Orme IM. 2006. Preclinical testing of new vaccines for tuberculosis: acomprehensive review. Vaccine 24:2–19.

62. Pathangey L, Kohler JJ, Isoda R, Brown TA. 2009. Effect of expressionlevel on immune responses to recombinant oral Salmonella enterica sero-var Typhimurium vaccines. Vaccine 27:2707–2711.

63. Perez JC, et al. 2009. Evolution of a bacterial regulon controlling viru-lence and Mg(2�) homeostasis. PLoS Genet. 5:e1000428.

64. Rihs HP, Peters R. 1989. Nuclear transport kinetics depend onphosphorylation-site-containing sequences flanking the karyophilic sig-nal of the Simian virus 40 T-antigen. EMBO J. 8:1479 –1484.

65. Rüssmann H, et al. 1998. Delivery of epitopes by the Salmonella type IIIsecretion system for vaccine development. Science 281:565–568.

66. Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual,3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

67. Schmidt-Weber CB, Alexander SI, Henault LE, James L, Lichtman AH.1999. IL-4 enhances IL-10 gene expression in murine Th2 cells in theabsence of TCR engagement. J. Immunol. 162:238 –244.

68. Shams H, Poblete F, Rüssmann H, Galán JE, Donis RO. 2002. Inductionof specific CD8� memory T cells and long lasting protection followingimmunization with Salmonella typhimurium expressing a lymphocyticchoriomeningitis MHC class I-restricted epitope. Vaccine 20:577–585.

69. Skjøt RL, et al. 2000. Comparative evaluation of low-molecular-massproteins from Mycobacterium tuberculosis identifies members of theESAT-6 family as immunodominant T-cell antigens. Infect. Immun. 68:214 –220.

70. Smith HW. 1956. The use of live vaccines in experimental Salmonellagallinarum infection in chickens with observations on their interferenceeffect. J. Hyg. (Lond.) 54:419 – 432.

71. Snapper CM, Marcu KB, Zelazowski P. 1997. The immunoglobulin classswitch: beyond “accessibility.” Immunity 6:217–223.

72. Sørensen AL, Nagai S, Houen G, Andersen P, Andersen AB. 1995.Purification and characterization of a low-molecular-mass T-cell antigensecreted by Mycobacterium tuberculosis. Infect. Immun. 63:1710 –1717.

73. Sousa AO, et al. 1999. Relative contributions of distinct MHC classI-dependent cell populations in protection to tuberculosis infection inmice. Proc. Natl. Acad. Sci. U. S. A. 97:4204 – 4208.

74. Torres-Escobar A, et al. 2010. Fine-tuning synthesis of Yersinia pestisLcrV from runaway-like replication balanced-lethal plasmid in a Salmo-nella enterica serovar Typhimurium vaccine induces protection against alethal Y. pestis challenge in mice. Infect. Immun. 78:2529 –2543.

75. Torres-Escobar A, Juárez-Rodríguez MD, Branger CG, Curtiss R, III.2010. Evaluation of the humoral immune response in mice orally vacci-nated with live recombinant attenuated Salmonella enterica delivering asecreted form of Yersinia pestis PsaA. Vaccine 28:5810 –5816.

76. Trunz BB, Fine P, Dye C. 2006. Effect of BCG vaccination on childhood




.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

tuberculous meningitis and miliary tuberculosis worldwide: a meta-analysis and assessment of cost-effectiveness. Lancet 367:1173–1180.

77. Vazquez-Torres A, et al. 1999. Extraintestinal dissemination of Salmo-nella by CD18-expressing phagocytes. Nature 401:804 – 808.

78. Wang QL, et al. 2009. An attenuated Salmonella-vectored vaccine elicitsprotective immunity against Mycobacterium tuberculosis. Vaccine 27:6712– 6722.

79. Wang S, et al. 2010. Salmonella vaccine vectors displaying delayed antigensynthesis in vivo to enhance immunogenicity. Infect. Immun. 78:3969–3980.

80. World Health Organization. 2010. Global tuberculosis control surveil-lance, planning, financing: WHO report 2010. Document WHO/HTM/TB/2010.104. World Health Organization, Geneva, Switzerland.

81. Xin W, et al. 2008. Analysis of type II secretion of recombinant pneumo-coccal PspA and PspC in a Salmonella enterica serovar Typhimurium vac-cine with regulated delayed antigen synthesis. Infect. Immun. 76:3241–3254.

82. Yanisch-Perron C, Vieira J, Messing J. 1985. Improved M13 phagecloning vectors and host strains: nucleotide sequences of the M13mp18and pUC19 vectors. Gene 33:103–119.

83. Zekarias B, Mo H, Curtiss R, III. 2008. Recombinant attenuated Salmo-nella enterica serovar Typhimurium expressing the carboxy-terminal do-main of alpha toxin from Clostridium perfringens induces protective re-sponses against necrotic enteritis in chickens. Clin. Vaccine Immunol.15:805– 816.




.org/D

ownloaded from

http://iai.asm.org

http://iai.asm.org/

live attenuated salmonella vaccines against …iai.asm.org/content/80/2/798.full.pdflive attenuated...

Documents