lock and key authorized replication system
DESCRIPTION
Lock and Key Authorized Replication System. Research Talk 3 / 11 /1 4 Long Chen. Today’s Biotechnology. More than 200 new therapies and vaccines . 400 drug products and vaccines in clinical trials. - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/1.jpg)
Lock and Key Authorized Replication System
• Research Talk • 3/11/14• Long Chen
![Page 2: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/2.jpg)
Today’s Biotechnology
• More than 200 new therapies and vaccines.• 400 drug products and vaccines in clinical trials.• Biotechnology innovations are increasing food supplies, reducing
damage to the environment, conserving natural resources of land, water and nutrients, and increasing farm income in economies worldwide.• Biotech innovation is cleaning our environment and fighting global
climate change by reducing our dependence on petroleum and fossil fuels.
![Page 3: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/3.jpg)
Biotech Companies: IP dependent
• Heavily dependent on scientific discoveries, bio-technologies and innovative tools.• Cost of innovation is high, protection of intellectual property is
required for profitability.• Failure rate is high.
A successful drug : ~$1-5 billion + 10-15 years
![Page 4: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/4.jpg)
Bio-espionage • In 1997, two U.S. citizens were arrested by the FBI and charged with
attempting to steal the process for culturing Taxol from plant cells.• In 2002, a pair of medical researchers were arrested in San Diego for
allegedly stealing genetic material and laboratory equipment from Harvard Medical School.• In December 2013, a corporate agriculture espionage case happened
in Iowa. A Chinese man is accused of stealing highly valuable inbred corn seeds.
![Page 5: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/5.jpg)
Deficiencies of DNA Protection
![Page 6: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/6.jpg)
“GeneGuard”
Prevents DNA replication in an unauthorized host.Enables DNA replication in an authorized host.No addition of chemical inducer needed.Many specific, orthogonal Lock and Key variants
Protect high-value plasmid from being illegally reproduced and unexpected spread.
![Page 7: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/7.jpg)
How does Lock and Key system work?
“R-Loop” “G-Cluster”
Wild Type
Synthetic
Cis-acting
Trans-acting
![Page 8: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/8.jpg)
Stages of L&K development
I. Proof of principleII. Engineer multiple Lock and Key variantsIII. Directed-evolution of L&K variantsIV. Create Authorized Host V. Application of Lock and Key System
![Page 9: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/9.jpg)
Experimental set-up
The R6K origin does not function in E. coli DH10B, allowing us to characterize synthetic origin.
In E.coli pir116, the R6K origin is supposed to have a
copy number up to 250.http://www.frankwu.com/R6K.html
![Page 10: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/10.jpg)
Proof of Principle
• Removed the RNAII, leaving a truncated ColE1 origin only.
E. coli DH10B E. coli pir116
The RNA II primer is essential for plasmid replication.
![Page 11: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/11.jpg)
Proof of Principle
• Removed truncated ColE1 origin, leaving a relocated wt-RNAII only.
![Page 12: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/12.jpg)
Proof of Principle
• We inserted 4 to 42 polyadenylation at 3’ end of wt-RNAII to deplete its self-sufficiency.
http://mcb.asm.org/content/29/11/3124.full
![Page 13: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/13.jpg)
Proof of Principle
• When Lock#X and Key#X are both present, the plasmid get replicated.
![Page 14: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/14.jpg)
A. Minimize cis-acting replication (truncation and poly A insertion)
B. Maximize trans-acting replication
Design Synthetic RNAII and Origin of Replication
http://www.sciencedirect.com/science/article/pii/0092867486904915
![Page 15: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/15.jpg)
A. Minimize cis-acting replication (truncation and Poly A insertion)
B. Maximize trans-acting replication
Synthetic RNA II and Synthetic Origin of Replication
Module of Designing LOCK and KEY Variants
![Page 16: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/16.jpg)
Design 37 Variants
![Page 17: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/17.jpg)
Clone and Evaluate 37 Lock and Key Variants
Sequence GC contentΔGHybrid
[Kcal/mol] Length ntGAGGGCCGC
0.89 -17.239
GGAAATTTGAAT
0.25 -15.4012
CCATGGGCCCCG
0.83 -17.5412
CCGAATGCTATCGAA
0.47 -16.5015
LOCK# Only version LOCK#X + KEY#X version
![Page 18: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/18.jpg)
Study on TOP Four Lock and Key VariantsConstruct a dual-plasmid testing system
The rest part?
![Page 19: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/19.jpg)
Directed-evolution on Lock and Key Complete process of Lock and Key directed-evolution
![Page 20: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/20.jpg)
Outputs of directed-evolution on Lock and Key
![Page 21: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/21.jpg)
Upgrading RNAII
Upgraded RNA II primer
Top Four Rescue SequenceGAGGGCCGCGGAAATTTGAATCCATGGGCCCCGCCGAATGCTATCGAA
After identifying all the mutations from third round of directed-evolution, we get a new version of RNA II primer with known beneficial point mutations.Then we cloned back the other three Top Four rescue sequence and got a series of upgraded Top Four variants.
The poly A section has dropped to 34 As.No mutations in rescue sequence.
![Page 22: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/22.jpg)
Efficacy of directed-evolution on Lock and Key
Before Directed-evolution After Directed-evolution
![Page 23: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/23.jpg)
Creating Authorized Hosts: Three VersionsIntegration of upgraded RNA II primers to the genome of E. coli.
KanR
RNA II primerH1 H2
H1 H2RNA II primer
KanR
yciL tonB
H1 H2
yciL tonBKanRRNA II primer
![Page 24: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/24.jpg)
Characterization and Comparison of Authorized Strains
![Page 25: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/25.jpg)
Application of Lock and Key System
http://www.sciencedirect.com/science/article/pii/S1074552103001030
![Page 26: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/26.jpg)
Quantitative Analysis
? ?
? ?
RNA―cDNARt-qPCR
Total DNARt-qPCR
![Page 27: Lock and Key Authorized Replication System](https://reader036.vdocument.in/reader036/viewer/2022062411/568168f1550346895ddff620/html5/thumbnails/27.jpg)