1

LS3-2, F2015 Chentao Lin,

Life Science 3 (LS3-2)

Introduction to Molecular Biology Fall 2015 (9/26/2013-12/09/2013)

Instructor: Chentao Lin, Ph.D. Professor of Molecular, Cell & Developmental Biology

Office: 4014 Terasaki Life Science Building (TLSB) Phone: 310-206-9576 (Cell phone # available upon request) email: clin@mcdb.ucla.edu (preferred method of communication)

Homepage: http://www.mcdb.ucla.edu/Research/Lin/ Lectures Tueday, Thursday 2:00 pm 3:15 pm, LaKretz 110 Office Hours: Tuesday, Thursday 3:30 pm 5:30 pm, 4014 TLSB Textbook: Molecular Biology (5th Edition, 2012) by R.F. Weaver Course Web site: https://ccle.ucla.edu/course/view/. The pdf files of notes and Bruincast Video

of lectures (http://www.bruincast.ucla.edu) will be posted online. Hornor Section (LS89 & HRNS85): 4-4:50pm Thursday, Math Sci Bidg. Rm5273,

Enroll online or by email to Jen Weill (jweill@lifesci.ucla.ed) Exams & Grading: Midterm I (5-6:60pm, Thursday 10/15/15, lectures 1-6) 100pts 20% Midterm II (5-6:50pm, Thursday 11/5/15, lectures 7-14) 100pts 20% Final Exam* (11:30am-2:30pm, Thursday,12/10/15) 300pts 60% * The 60% portion of the Final Exam includes 20% for lectures 15-20, and 40% for lectures1-20. Discussion Sections: There will be Discussion sections each week in MS (room 3915H). The schedule of those sections have been posted online. TAs will address questions regarding lectures in the discussion sections. Teaching Assistants (TAs): Adam Gomez, adagomez@ucla.edu, Yazan Alhadid, yalhadid@ucla.edu, David Nusbaum, dn27800m@gmail.com, Mia Lim, mialim1992@gmail.com Course Administration: For all administrative questions of this class, please contact Jen Weill (jweill@lifesci.ucla.edu, phone; 310-825-6614) of the Life Science Core Curriculum Office (Room 222, Hershey Hall). Michelle Veintimilla (email: mveintimilla@lifesci.ucla.edu), Lily Yanez (email: lscore@lifesci.ucla.edu) will provide additional help if needed. Peer Learning Program: You can sign up for peer learning program through MyUCLA beginning on Thursday, October 1st at 8:00pm by clicking the "Academics" tab on the top menu and selecting "Peer Learning," or by https://www.lscore.ucla.edu/lsplf.php. Contact Dr. Gaston Pfluegl (gaston@lifesci.ucla.edu) for more information.

Week Lecture Date Topics Reading0 1 Thursday, 9-24 Genes and genomes Chapter 21 2 Tuesday, 9-29 RNA and Proteins Chapter 3

3 Thursday, 10-1 Methods in Molecular Biology I Chapter 4-52 4 Tuesday, 10-6 Methods in Molecular Biology II Chapter 4-5

5 Thursday, 10-8 Methods in Molecular Biology III Chapter 4-53 6 Tuesday, 10-13 Methods in Molecular Biology IV Chapter 4-5

Midterm I Thursday 10-15 Exam covering lectures 1-6 5:00-6:50pm7 Thursday, 10-15 Prokaryotic Transcription I Chapter 6-9

4 8 Tuesday 10-20 Prokaryotic Transcription II Chapter 6-99 Thursday 10-22 Prokaryotic Transcription III Chapter 6-9

5 10 Tuesday 10-27 Eukaryotic Transcription I Chapter 10-1311 Thursday 10-29 Eukaryotic Transcription II Chapter 10-13

6 12 Tuesday 11-3 Eukaryotic Transcription III Chapter 10-13Midterm II Thursday 11-5 Exam covering lectures 7-12 5:00-6:50pm

13 Thursday 11-5 RNA processing I Chapter 14-167 14 Tuesday 11-10 RNA processing II Chapter 14-16

15 Thursday 11-12 Translation I Chapter 17-198 16 Tuesday 11-17 Translation II Chapter 17-19

17 Thursday 11-19 DNA Replication I Chapter 17-199 18 Tuesday, 11-24 DNA Replication II Chapter 17-19

Thursday, 11-26 Thanksgiving holiday10 19 Tuesday, 12-1 Genome structure Chapter 20-21

20 Thursday, 12-3 Genome analyses Chapter 23-24Final Exam 1 to 20 Thursday,12-10 20%(I)+20%(II)+40%(III) 11:30am-2:30pm

w

LS3-2 (F2015) Syllabus 2:00 - 3:15pm, Tuesday and Thursday, LaKretz 110

Textbook: Molecular Biology (5th Edition, 2012) by R.F. Weaver

All course materials are online Discussion sections

A review of what you should have learned in the pre-required courses

Basics of biology Basics of Cells Basic chemistry

#0 Introduction-Review An area of science that addresses questions

concerning the physical and chemical basis of life

What are genes and gene products?

how do proteins work? How are genes expressed? How are genes regulated? ......

What is molecular biology?

DNA, RNA, Proteins

2

1. What are genes and genomes? 2. How are genes and genomes studied? 3. What are the molecular processes and regulatory mechanisms of RNA transcription, protein translation, and DNA replication? 4. How do those processes affect life?

What are you expected to learn by Dec 10, 2015?

#1 Genes and Genomes

1.The nature of genetic material 2.DNA structure 3.Physicochemical properties of DNA 4.The size of DNA, genes, and genome

Two dilemmas in designing a gene in evolution

1. Size vs stability Genes need to be small enough to fit into a tiny cell, but

genes also need to be very accurately copied from generation to generation: e.g. with the estimated mutation frequency of less than one aa (amino acid) per 200,000 years for a 400 aa protein. The dilemma is that the smaller the molecule the easier it is to undergo change or mutation. 2. Complexity vs simplicity

Genetic materials need to be complex enough to specify all aspects of complex features and functions of a living organism (e.g. to study LS3), yet they need to be simple enough to be copied rapidly (e.g.

3

a) virulent S strain bacteria infected and killed the host b) avirulent R strain did not infect the host c) Heat-killed S strain was no longer infectious or virulent d) When the avirulent R strain was mixed with heat-killed S strain,

some R were transformed to become the virulent S strain!

Griffiths hypothesis: there was a S substance or transformation principle of the S strain. The S substance can be released by the dead S cells, which was taken up by R cell (avirulent) and transformed the R cell to the S cell (virulent). It was shown later that bacteria can indeed take up foreign DNA from the environment and incorporate the foreign DNA into its own genome - a process also called transformation as discussed later in our course.

Transformation

(2). The Avery experiment (Oswald Avery, Colin Macleod, and Maclyn McCarty, 1944)

What was the S substance? Griffith thought it might be protein as most scientists thought at the time.

Experiment: fractionated cellular extract from S bacteria,tested each fraction for its transformation activity, and identified the S substance, which: (1) exhibited all the chemical properties of DNA (2) no other material (e.g. protein, lipid, sugar. etc) was found in the active extract, (3) only the DNA-digesting enzyme (DNase) could inactivate it.

Therefore, DNA was hypothesized to be the S substance

(3) The Hershey experiment (Alfred Hershey and Martha Chase, 1952)

Experiments: take 32P labeled phage or 35S labeled phage to infect bacterial cell, separately, isolated phage progenies to test which one had the radioactivity. Results: 35S labeled proteins were mostly found in the empty coat called phage ghost, only 32P labeled DNAs were abundantly detected in the phage progenies in the next generation. Conclusion: DNA was the genetic material of T2 phage,

Was Averys hypothesis correct?

Bacterialphage (phage)is bacterial virus, its genetic material can be passed on from one generation to the next, so it serves as a good model system for Hershey and Chase The T2 phage used by Hershey and Chase contains only DNA and protein, so phages could be labeled in only proteins (with 35S) or in only DNA (with 32P).

DNA (deoxyribonucleic acid) is polydeoxyribonucleotide composed of many deoxyribonucleotide covalently linked by phosphodiester bonds Two puzzling observations in early days: 1. The base composition of DNA is different in different organism, but they all obey the following rules: [A]=[T], [G]=[C], [A+T][C+G] why? 2. DNA is longer and more stable than RNA. For example, DNA is stable in alkaline, but RNA is hydrolyzed in alkaline. Why?

2. DNA structure

Bases Pentose

(in RNA) (in DNA)

Nucleosides

In (RNA) (in DNA)

DNA RNA

Nucleotide: nucleoside

+ phosphate

Nucleoside: pentose

+ base

KKSticky Notehe took S by boiling it in hot water and mix it w R bacteria...kill S one that does cause it and then w R one mix...transformation

even tho denatured, S substance can be taken by R bacteria....by incorporate into genome and thus R different aka virulent. what is this S substance?

KKSticky Noteavery isolated S strand of S bacteria which got kiled...then grind it and see it has mixture of everythig all maromolecules...treat w 3 different things

1. dnase - cute dnarnase - cut rna-protease - cut proeins

all 3 dif enzymes to digest hem

then mix w R strain...and then infet mice....rnase and protease can still be transformed but via dnase it cannot!!!

def tels u that dna is genetic material...u cut it but it cannot transofrm R bacteria into S bacteria....cuz DNA digested

KKSticky Noteradioactive strain 27-29 mins

purify phage easily by getting rid of bactiera...take phage to infect bacteria again and see which bacteria prodegny has radioactive label...turns out S35 is not passed into next generation of bacteria ONLY p 32 passed. thus DNA can pas along into dif generations aka dna is genetic material

KKSticky Note4 molecules constitute dna..atgc

a nucleutide = tbut [a+t} does not equal [c+g]

KKSticky Note5 carbon sugar in ribosedeoxyribose is pentose sugar found in DNA

dif between RNA and DNA is hydrox group

pentose is labelled w direction (5 carbons) always in that way

pentose=sugar

base =2 types

purine 2 ring and pyrimidine =1 ring

agcu in RNAagct in DNA

KKSticky Notenucleosides= pentose and base

add a phosphate to nucleoside = nucleotide

add nucleotides together then u have either RNA or DNA....how? via condensation rxn

phosphodiester bonds = covalent bonds both in RNA and DNA...from phosphate to hydroxy group.....lots of them connected then DNA/RNA

4

Nucleotides are connected by the phosphodiester bonds via condensation reactions, in which H2O is removed

C

A

H

H

H2O

H

H

enzymes

Nucleic acids (DNA, RNA) are polynucleotides

(A)

DNA has polarity (5 vs 3) because each nucleotide has polarity (Pi at 5' vs OH at 3')

DNA is a polar molecule

Watson-Crick model of DNA structure

1. Rosalind Franklin (1920-1958) and Maurice Wilkins (1916-2004) obtained the x-ray diffraction picture of the DNA 2. James Watson (1928-), Francis Crick (1916-2004), and Wilkins proposed the 3-D structure of DNA molecule in 1953. 3. Watson, Crick, and Wilkins received the Noble Prize for solving the DNA structure in 1962.

By M. H. F. WILKINS, A. R. STOKES, H. R. WILSON

By . J. D. WATSON, F. H. C. CRICK

1. DNA is double-stranded molecule (dsDNA). Each DNA molecule is composed of two strands of polydeoxyribonucleotide (ssDNA). 2. The two strands spiral around each other in antiparallele direction (that means if one strand runs 5 3, the other strand must run 3 5) to form a right-handed helix. Each turn of the helix contains ~10.5 base pairs of deoxyribonucleotides. 3. The double helix is held mainly by H bonds between bases from opposite strands, the H bonds can be broken and reformed. This predicts the semiconservative replication of DNA. A pyrimidine (one-ring bases: T & C) from one strand always form H bons with a purine (two-ring bases: A & G) from the other strand. This explains the base composition rules, and why C:G paring (3 H bonds) is stronger than A:T paring (2 H bonds). This predicts that a DNA with more CG is more stable. 4. Bases are inside the double helix, sugar-phosphates backbones

are outside the helix. DNA is negatively charged.

Watson-Crick model of DNA structure (cont.)

starting from the 5' of one strand of a dsDNA, it goes with a right-hand twist to the 3' The DNA double helix is stabilized by H bonds between bases, as well as the hydrophobic and van der Waals interactions between adjacently stacked base pairs

DNA is a right-handed double helix

KKSticky NoteY carbon molecules labelled?? 3 prime end location always hydroxy group wheresae 5' is phosphate group

a lot of net charge in DNA cuz phosphate

3 dif ways to present DNA molecule

KKSticky Notestructure of DNA model

used xray crystallography to learn structure of dna

KKSticky Note2 strands: one from 5' to 3' and then another is op direction

both comected by hyudrogen bonds between the bases...CG has 3 hydrogen bonds, AG has 2 bonds!!

base phosphate always inside so always negatively charged

KKSticky Notesummary

5

B DNA is the normal form of dsDNA found

in the genome

A form is found in RNA:RNA or

RNA:DNA helices

The function of Z structure remains

unknown

DNA helix may have different structures, but most cellular DNA has the B structure

5-TGCCAGTTCAGCTAAACTCTG-3 3-ACGGTCAAGTCGATTTGAGAC-5

The base-pairing rules of DNA: A pairs with T, G pairs with C

1. Base-pairing (or complementary) rules: in dsDNA, A always pairs with T, and C always pairs with G. This is why in a normal dsDNA strand, A=T, G=C, but [A+T] = [G+C]

2. The two strands of DNA hold together by hydrogen bonds. A-T has 2 H bonds, G-C has 3H bonds. This is why a dsDNA strand with higher G/C content is more stable and less likely to be denatured.

3. If you know the sequence of one strand, you can easily deduce the sequence of the opposite (or complementary) strand.

(1). A DNA sequence - the linear order of nucleotides of a DNA strand, is usually presented as: 5 (left) to 3 (right) of the top strand and 3 (left) to 5 (right) for the bottom strand. Usually only the top strand is presented. If not specified, it must be the top strand with the left end being the 5 end

5 ATGCATGCATGCATGCATGCATGC 3 3 TACGTACGTACGTACGTACGTACG 5

(2). DNA sequence homology similarity between the sequences of two DNA molecules

DNA sequence and homology 3. physicochemical properties of DNA 1). soluble in water, precipitated in ethanol 2). DNA can be hydrolyzed by DNase (deoxyribonuclease), which degrades DNA by breaking the phosphodiester bonds (H bonds are also broken in degraded DNA). 3). DNA can be denatured (H bond broken but phosphodiester bond intact) by heat, extreme pH, organic solvent, etc 4). DNA absorb ultraviolet light of 260nm (UV260), ssDNA (single strand) absorbs more UV260 than dsDNA (double strand), a phenomenon called hyperchromic shift

1 A260 = 50 g/ml dsDNA, or 33 g/ml ssDNA e.g. a DNA solution that absorbs 0.5 unit of 260 nm UV light (A260= 0.5) should contain 25 mg/ml dsDNA or 16.5 mg/ml ssDNA 5). dsDNA can be reversibly denatured into ssDNA 6). dsDNA can form supercoils

Denature (melt): -double strand (ds DNA) single strand (ssDNA) -occur at high stringency conditions: higher temperature, lower salt concentration, extreme pH, or in organic solvent. High stringency conditions favor the break of the H bonds between complementary bases Renature (anneal) -single strand (ss DNA) double strand (dsDNA) -occur at low stringency conditions: lower temperature, higher salt concentration, neutral pH that favor H bond formation

DNA denature and renature

1. DNA denature occurs at a relatively narrow range of temperature 2. Tm is defined as the temperature at which 50% of the DNA is denatured, or when half of the increase in absorption at 260nm is reached.

Tm = 85oC

Me Tm: melting temperature

KKSticky Noteb form is normal. a form is hybrid. z form is found in laboratory in in vetro

KKSticky Note5 to 3 strand on topag not stable thats why

KKSticky Notezero percent homlogy cuz both runing same strand

KKSticky Notedna sequence similarity = homology

rat to human is 90human to human is 99

complementary srand = homology strand

KKSticky Notedna precipate in organic solvent like ethanol

dna can be hydroluzed aka cut aka degraded by dnase

denaturation is not degradation. degradation is break of phosphodiester bods of single strand dna. denatureation is break of hydrogen bond between 2 single dna strands. degradation needs lots of heavy chemicals. denaturation easy. can boil water or change h

denaturatoin= 2 single strands become separated at hydrogen bonds

dna can be renaturesd if have complementary sequence in appropriate conditions

a lot ofuse of denaturation and renaturiaton

for ie dna cana absorb 260 nm ....double strand absorbs less than single strand...when 2 are there they quench out the effect of the other...thus we can know whether its single or double stranded or renatured or dentaured DNA

KKSticky Noteheat it up, become single strand - hydrogen bond broken

if cool it then renature - will beocme double strand again aka anneal

KKSticky Notewhen dna denatures from double to single stranded by breaking hydrogen, the absorbance of increases....

temperature at which 50% is denatured (half of dna becomes single stranded) = Tm...important in PCRs

6

Denatured DNA has higher UV-light absorption at 260 nm region, because ssDNA absorbs more UV light

Physical and chemical features of DNA denaturation

DNA with higher GC content is less likely to be denatured, so it has the higher melting temperature (Tm).

Hybridization is the annealing of two ssDNA strands derived from different dsDNA molecules -In a mixture of DNAs, only the complementary strands will associate by H bonds, so hybridization only occurs when the two DNA have sequence similarity (homology) -The ability of homologous DNA molecules to form hybrid is the basis of many molecular biology techniques.

DNA Hybridization

High stringency: higher temperature and/or low salt DNAs that have the high sequence homology (e.g. 100%) will hybridize under both low and high stringency Low stringency: lower temperature and/or high salt DNAs with low sequence homology (e.g. 70%) only hybridize under low stringency condition, but not under high stringency condition

DNA can be linear or circular

Most eukaryotic genomes are linear DNA Most plasmid, bacterial genome, mitochondrion genome, chloroplast genome,and some virus DNA are circular DNA Some prokaryotic virus (phages) have linear DNA

(Human sex chromosomes) (E. Coli genome)

4. DNA shapes and Sizes

Plasmid DNA

Circular DNA is difficult to separate,especially if it needs to be replicated. Because a large circular DNA is easily tangled or supercoiled (wrapped or coiled at higher order). How do organelle or virus genomes solve this problem for their replication? (nick it)

Circular DNA

-When a circular plasmid DNA molecule is isolated and analyzed by gel electrophoresis, it often migrates as two forms, one migrates faster than the other. The fast-running form of the circular DNA has the more compact supercoil structure.

Viewed by

ethidium bromide-stained agarose

gel

_

+ (=10 bp/turn) (=10bp/turn)

Viewed by electromicroscopy

nicked

supercoiled

Supercoiled DNA

-Supercoil forms because of simple physics. Both circular DNA and long linear DNA can form supercoil. -The fact that DNA can form supercoils explains how a very long DNA molecule can be packed tightly in the nucleus, so supercoils are part of the structure basis for DNA package in the cell. -How could a tightly packed supercoil DNA be untangled rapidly when the cell undergoes division and DNA needs to be replicated ?

Why supercoil?

KKSticky NoteTm....double stranded has lower absoprotion

single stranded however has no Tm????? idk...it has slight increase ....it absorbs mrore UV light than double ....when u ncrease u also increase absorption....why

dna and rna may have some segments that happen to be complemantary....when u heat it up, those temporary or casual double strands break up, so slight increase....cuz not all complementary...kind of question on midterm occasionaly (difficult question)

different organisms/genomes have dif GC content. if genome has high GC contnt then it is more stable cuz more hydrogen bonds to hold it together hence harder to denature.....what causes the difference in GC content??????? thus higher Tm value cuz higher temp to denature

KKSticky Noteif 2 piece of dna one form mouse on from plant and u denature both....and then u mix both then u will find some dna that will find complementary base to each other and they will hybridize to each other

if different dna, and thappens to be different pairs they may still come back together in dna hybrid...those complemntary base pairs can find each other. its ok if some are not held together - DNA hybrid cuz 2 pieces of dna come from dif sources

obv dna bybrid not as stable as its parent DN because not all have hydrogen bond to hold them thus weaker

KKSticky Notedna is either free roaming like circular in plasmid connected head to head

or linear dna like human....x is big strong, y is weak for male he he he..linear dna!

eukaryotes have linear usuallybacteria have circula as well as plasmid

sometimes virus have linear dna

KKSticky Notehuman genome has 3 biollino base pairs to complement...10 to the 9th!!! u put them together its a mess

small circular dna makes sense. e coli has much smaller genome than humans...if u heat it then single stranded and now a very big mess...hard to go back! very hard to go back. cannot???

KKSticky Note2 bands. supercoiled and nicked.

supercoiled

if single strand and put together to double strand......if close at one end and coil and coil and oil until all double stranded....then the tension will create a supercoil structure....all dna exists as supercoiled...this is how it will be packed so that it can be packed into tiny small nuclei for big ggenome

twise for supercoil...compact dna...moves fast light

or cut it in one strand...take string and cut it and fer coiled then it will release and be relazed....nicked is relaxed.

imp cuz in dna replication and transcroption then solve these problems....such a compact dna all messed and twingled together how to deal with them

in a smple only either supercoiled or nicked

7

Size of DNA

2 nm diameter 10.5 bp (3.4 nm)/turn

DNA size is expressed in 3 ways: Length ~34 per helical turn of 10.5 base pairs (bp) Base pairs, bp (base pair), Kb (103bp), Mb (106 bp), Gb (109bp) Molecular weight 660 is the average molecular weight of 1bp of DNA. DNA size can be measured by electron microscopy, gel electrophoresis, but most frequently by DNA sequencing

For a gene encoding a 40,000 Da (40 kD) protein, assuming the average mass of an amino acid is about 110 Da, 40,000 Da / 110 364 amino acids, each amino acid is encoded by a 3-nucleotide codon of DNA, the coding sequence should be 264x3=1092bp, so the gene should be at least 1092bp. A protein can be as small as a dozen amino acid residues (e.g. peptide hormones) to as large as large 27,000 amino acid or 3 MD (Titin, the largest muscle protein known). The titin gene is ~300kb, with only 9kb (3%) coding sequence (rest are introns and regulatory sequences).

Size of a gene

Genome: collection of all genomic DNA of an organism e.g. Phage x174 (one of smallest genome, 5375 bp, ~5 proteins); Human genome: 3.2 x 109 bp (3.3Gb), encoding >23,000 proteins.

Size of genomes

Genome size and the C-Value Paradox C-value is the DNA content per haploid cell (equivalent

to the size of a genome). One might expect that more complex organisms need

more genes than simple organisms, which usually holds true especially (e.g. human vs yeast). Yet frog has 7 times more DNA than human, and the lily genome contains about 200 times more DNA than human.

The observation that more complex organisms do not always have larger genomes than less complex organisms is called the C-value paradox.

One explanation for the paradox why simpler organisms have more genomic DNA may be that they have more repetitive DNA without having more genes.

Gene, genome, and model organisms

Genome

The chemical nature of genes and genomes of different

organisms are the same. Study of model organisms allows a general understanding of

fundamental features of life.

Gene: DNA sequence needed to encode a functional protein or RNA Genome: complete collection of genes and non-gene sequences

Model organisms

E. Coli (Escherichia coli) Free-living single cell prokaryote Double every 20 minutes under optimal conditions Single circular chromosome without nucleus (prokaryote) Genome (complete set of DNA): 4.6 Mb (million base pair) Proteome (complete set of proteins): ~4,300 proteins

Bacteria

Cell wall

Genomic DNA

Yeast (budding yeast)

Saccharomyces cerevisia

Single-cell eukaryote grows in both liquid and agar surface in lab, 16 linear chromosomes, nuclear membrane, organelles such as ER, Golgi, mitochondria, etc. Genome size: 12 Mb Proteome size: ~6000 (

8

C. elegans

97 Mb genome, 959 somatic cells The first animal genome sequenced ~19,000 protein-encoding genes the favorite model organism to study questions such as cell lineage, longevity, etc

- Sequence completed in 2000

Drosophila melanogaster (fruit fly)

~50,000 cells ~160 Mb Genome ~15,000 protein The traditional model to study genetics and development

Arabidopsis thaliana ~10,000 seeds per plant - 5 pairs of chromosomes - Genome size: ~120 Mb - Proteome: ~26,000 proteins - Genome sequencing completed in 2000

Plants Peas (studied by Mendel) Corn (studied by McClintock)

Mouse (Mus Musculus) 1011 Cells 3Gb (3 billion bp) genome ~23,000 proteins Genome Sequence completed in 2001

Homo sapiens 1014 cells 3Gb Genome ~21,000 proteins (2010) Genome Sequence completed in 2001

mammals