machine learning for 21 st century biology and medicine robert f. murphy lane professor of...
TRANSCRIPT
Machine Learning for 21st Century Biology and Medicine
Robert F. MurphyLane Professor of Computational Biology and Professor of Biological Sciences, Biomedical Engineering and Machine Learning
Outline• Digital Pathology and Location Biomarkers• Active Learning for Drug Development• Personal genome analysis: plans and
challenges• Challenges of automated systems for
biomedicine
Motivation
• Protein function is modulated by changing its subcellular abundance, activity or location
• Differential protein abundance is routinely studied for biomarker discovery
Motivation
• Protein function is modulated by changing its subcellular abundance, activity or location
• Differential protein abundance is routinely used for biomarker discovery
• Less work has been done on using subcellular location differences for biomarker discovery
Motivation• Protein function is modulated by affecting its
subcellular abundance or location • Differential protein abundance is routinely used for
biomarker discovery• Less work has been done on using subcellular
location differences for biomarker discovery• Ultimately, both abundance and location
biomarkers are important for the systematic study of disease processes as well as the development of clinical therapeutics
Example Location Biomarker• Cytoplasmic phospho-β-catenin inversely correlated with
tumor size and stage (breast, skin cancer) .
healthy
cancer
nucleus
nucleus
cytoplasmnucleusnucleus
cytoplasm
phospho- β-catenin
nucleusnucleus
cytoplasm
Nakopoulou, Mod Path. 2006Chung, Clinical Cancer Res., 2001
Digital Pathology• Dynamic, image-based
environment that enables the acquisition, management and interpretation of pathology information generated from a digitized glass slide. [Source: Digital Pathology Association] Year
Opportunity for Automated Analysis
• Increasing availability of tissue images in digital form opens opportunity for automating tasks performed by pathologists
Opportunity for New Analyses• Potentially more important opportunity for
performing analyses that are difficult for pathologists to perform visually
• Example: detecting location biomarkers
Human Protein Atlas: a compendium of protein subcellular staining patterns in IHC images
http://www.proteinatlas.org (Uhlén, Pontén et al)
HPA: Protein patterns visualized with immunohistochemistry
• Hematoxylin stains nuclei purple• Diaminobenzidine detects a mono-specific
antibody against a particular protein with brown product
Brightfield image, ~1 mm in width Brightfield image, ~0.1 mm in width
10um
Framework for Automated Determination of Subcellular Location
INPUTprotein channel
DNA channel
Unmixing and ThresholdingUnmixing and Thresholding Feature ExtractionFeature Extraction
preprocessing
Query Classifier to assign subcellular location based on
image features
Query Classifier to assign subcellular location based on
image features
QUERY IMAGE
[0.4,0.2, 1.6,2.8,….0.6].
This is a ER pattern
Cytoplasm Endoplasmic Reticulum Golgi Intermediate Filament Lysosome Membrane Microtubule Mitochondria Nucleus Peroxisome Secreted
The classifier is trained to distinguish 11 subcellular location classes
Finding location biomarkers• Compare
subcellular location for normal tissues with that for tumor derived from same tissue (for six tissues)
Protein
Tissue
Red=different
Some markers are tissue-specific, some more general
Next steps• Patent pending on biomarker detection• Clinical collaborations to verify that these
proteins are location biomarkers and to determine whether they have diagnostic/prognostic/theranostic value
• Incorporation of analysis technology into digital pathology platforms
Molecular Complexity of Organisms~104-105 proteins
~102 cell typesCell Biology: We want to know where all the proteins are in all the cell types
Molecular Complexity of Perturbagens~1060 potential small, soluble molecules
~1012 potential RNA inhibitors
Drug development: We want to know how a subset of proteins and cell types
are affected by these perturbagens
Two problems:(1) We don’t know effects on other targets
Comprehensive screening for one target does not reveal side effects!
Negative Positive Intermediate
Two problems:(1) We don’t know effects on other targets(2) We have learned nothing for the next target
Negative Positive Intermediate
X
X
X
X
X
We cannot afford to exhaustively perform every experimentSolution: just do some …predict the rest
Negative Positive Intermediate
Negative Positive Intermediate
We cannot afford to exhaustively perform every experimentSolution: just do some and predict the rest
Two versions of problem• When information is available not only about
the readout from experiments but about the similarity of compounds to each other and targets to each other (“internal and external data”)
• When information is only available about readout of experiments (“internal only”)
Two versions of readout• Scalar (e.g., percentage of maximum hit)• Vector (e.g., percentage of probe in different
compartments)
X
X
X
Negative Positive Intermediate
1.9, 2.9, 365.4,…
2.1, -34.9, 5.4,…
NB: Similar to QSAR (Hansch et. al. 1972)
PubChem Data Preparation• Assays: 177
– 108 in vitro– 69 in vivo– Sign of score reflects type of assay (inhibition or activation)
• Unique Protein Targets: 133• Compounds: 20,000• Experiments: ~1,000,000 (30% coverage)
• Goal: discover hits - drug-target pairs whose |rank score| > 80• Very few hits (0.096%)
38
Active LearningOptimized -QSARRandomized Search
With only 2.5% of the matrix covered, we can identify 57% of the active compounds!
Next steps• Patent pending for active learning methodology• Collaborate with pharmaceutical companies to
demonstrate that methodology would have worked using complete datasets
• Use with robotics to tackle new problems • Extend to combinations of perturbagens• Many problems in biology of similar complexity
Personal genome sequencing arrives• The advent of machines capable of
determining personal genome sequences for $1,000 will user in a new era of personalized medicine
• Danger in possible proliferation of fragmented, proprietary genome analysis software
Operating Principles• Open source, free licensing (GPLv2)• Encourage collaborations/contributions under
that licensing• Frequent releases• Enable compression, assuming resequencing
easy• Never-ending learning (online learning)
1. Clinical Collaborations• Clinical collaborators provide personal genome
sequence, other omics data (optional) and clinical phenotype information (disease, onset, severity, survival time, treatment responsiveness)
• Primary goals: Development and testing of methods AND learning of new associations
• Data typically confidential/proprietary at least until publication
• Typically requires research agreement
2. Software Collaborations• Open source, no license fee software
model
• New releases frequently
• Collaborators and contributors welcome
• No agreements necessary
3. Dissemination Collaborations• Commercial organizations who provide
data storage and computing resources (e.g., cloud)
• Entire analysis pipeline is open source (including DrBox)
• Personnel may make contributions to software development and testing
raw sequence reads
genome features
disease and treatment history
genome feature:disease associations
gene:pathway associations
probabilistic graphical model
pathway:disease associations
protein:disease associations
annotated reference genome
model can predict probability of any missing item
probability estimates continually updated as new data added
Overview
clinical tests
predicted disease susceptibility
identified disease features
Intermediate Phenotype
Genetic Basis of Complex Diseases
Healthy
Cancer
ACTCGTACGTAGACCTAGCATTACGCAATAATGCGA
ACTCGAACCTAGACCTAGCATTACGCAATAATGCGA
TCTCGTACGTAGACGTAGCATTACGCAATTATCCGA
ACTCGAACCTAGACCTAGCATTACGCAATTATCCGA
ACTCGTACGTAGACGTAGCATAACGCAATAATGCGA
TCTCGTACCTAGACGTAGCATAACGCAATAATCCGA
ACTCGAACCTAGACCTAGCATAACGCAATTATCCGA
Causal SNPs
Clinical records
Gene expressionAssociation to intermediate phenotypes
Structured Association
Phenome Structure
Graph-guided fused lasso (Kim & Xing, PLoS Genetics, 2009)
Graph
Tree-guided fused lasso (Kim & Xing, ICML 2010)
Tree
Temporally smoothed lasso (Kim, Howrylak, Xing, Submitted)
Dynamic Trait
Genome Structure
Stochastic block regression (Kim & Xing, UAI, 2008)
Linkage Disequilibrium
Multi-population group lasso (Puniyani, Kim, Xing, ISMB 2010)
Population Structure
EpistasisACGTTTTACTGTACAATT
Group lasso with networks(Lee, Jun, Xing, NIPS 2010)
Structured Association: a New Paradigm
• Significant tests for each loci
• Multivariate linear regression
• Lasso (“sparse” linear regression)
Challenges to society• For all automated systems, as with human systems, errors are
inevitable. For current systems, the consequences of machine error are easily dealt with, whether it is by retrieving misdirected mail, ignoring an uninteresting recommendation, or averaging in some unsuccessful trades with many successful ones. However, as automated decision-making is extended to biomedicine, the consequences of error may be more difficult to address.
• Furthermore, a new question arises: how will people, especially scientists and physicians, react to the existence of systems that understand their fields better than they do?
• Past and Present Students and Postdocs– Justin Newberg (Baylor), Estelle Glory, Arvind Rao (M.D.
Anderson), Armaghan Naik, Josh Kangas
• Funding– NSF, NIH, Commonwealth of Pennsylvania,
Ion Torrent
• Collaborators/Consultants– Mathias Uhlen, Emma Lundberg, Tom Mitchell, Chris Langmead,
Lans Taylor, Jonathan Rothberg, Ziv Bar-Joseph, Seyoung Kim, Kathryn Roeder, Russell Schwartz, Eric Xing
Acknowledgments