32

CHAPTER III

MATERIALS AND METHODS

3.1 Preamble

To achieve the set objective of the study that involves the analysis of sago

effluent, microbial diversity analysis, isolation of thiocyanate tolerant microbes and

optimisation studies are carried out. The procedures followed during the sampling,

physico-chemical analysis of sago effluent, analysis of total microbes and microbial

diversity by Shannon-weiner diversity index and Simpsons’ index, biochemical and

molecular method of screening thiocyanate tolerant microbes, Minimum Inhibitory

Concentration (MIC) and Scanning Electron Microscopy (SEM) analysis methods are

described in this chapter.

3.2 Microbial Diversity Analysis

3.2.1 Sampling

Sago industry effluent and soil samples were collected from the study area

situated near Attur, Salem District of Tamil Nadu (Figure 4). Triplicate samples were

collected from three different sago factories – sampling sites located at Manjini (SF1),

Thalaivasal (SF2) and Kattukottai (SF3) during the period of January – March 2007.

The sampling sites are located within a radius of about 10 km from Kattukottai. Soil

from the top 5 - 10 cm layer of effluent contaminated site was collected for the study.

The soil samples were transported to the lab, air dried and kept at room temperature

until further analysis. Effluent samples were collected in sterile bottles and maintained

at 4 °C until further analysis. The Latitude and Longitude of the study area are 11° 36'

N and 78° 39' E respectively. The average maximum and minimum temperature of the

study area is about 32.40 °C and 24.20 °C respectively. The average rainfall over the

past five years has been around 850 mm and the area mainly depends on North-East

monsoon period for its rainfall.

33

Salem District

Figure 4. Location Map of the Study Area

The image of the sampling sites situated in Attur taluk are as shown in the

figure 5 given below.

Figure 5. Image of Sampling Sites Located in Attur Taluk of Salem District

SF1SF2

SF3

34

3.2.2 Preservation of Samples

Sample preservation and preparation is of prime importance to quantify

sensitive parameters and to eliminate the unwarranted constituents that interferes in the

estimation process. The collected effluent samples were preserved by storing the

samples at 4 °C. The soil samples were dried and preserved in sterile polythene bags at

room temperature until further analysis. The preservatives used for fixing the samples

should not interfere with the analysis. Samples collected for the estimation of COD

needs to be preserved by using concentrated sulphuric acid and thereby adjusting the

pH to less than 2. Samples for the estimation of cyanide need to be maintained at

pH 12 by using NaOH (Murugesan et al, 2006).

3.2.3 Chemicals Used

Chemicals used for the purpose of physio-chemical estimation and Sodium

thiocyanate were obtained from Merck Ltd, Germany. All microbiological media were

procured from HiMedia Laboratory, Mumbai. Other chemicals used were of Analytical

Grade from Qualigens Ltd., Mumbai. Primers used for the amplification purpose were

purchased from Biotools Ltd, Spain and Protein standard used was from Fermentas Life

Sciences, Canada.

3.2.4 Analysis of Effluent Characteristics

In addition to the analysis of major Physicochemical parameters, the present

investigation also included the estimation of Thiocyanate and Cyanide compounds: The

following environmental parameters were analysed:

1. Physical Parameters – Colour, Turbidity, Odour and Temperature.

2. Chemical Parameters – pH, Acidity, Alkalinity, Total Solids,

Suspended Solids, Dissolved Solids,

Thiocyanate, Cyanide.

3. Organic Parameters – BOD, COD, Total Nitrogen.

4. Inorganic Parameters – Chlorides, Sulphate.

35

Estimation of the physico-chemical parameters was done according to the

standard procedures of APHA (2005). A brief note on the various procedures involved

in the analysis of the above mentioned physico-chemical parameters are as follows:

3.2.4.1 Odour

The Odour of the sample gives an indication about the nature of the effluent.

3.2.4.2 Colour

Natural Colour is usually due to the presence of negatively charged colloidal

particles. The colour of the effluent sample can be noted by using a Nessler’s tube

(with colour standards).

3.2.4.3 Temperature

Temperature of the effluent sample can be analysed by the use of a research

purpose Thermometer. The thermometer was placed in the sample for 2 minutes and

the observations were recorded.

3.2.4.4 Turbidity

The suspended particles are the prime contributing factor for the presence of

turbidity. Suspended particles may be either colloidal or coarse dispersions with

varying sizes that determines the degree of turbidity. Turbidity can be determined by

Nephelometry and the results are expressed as Nephelometric Turbidity Units (NTU).

3.2.4.5 pH

pH can be measured more accurately and conveniently with a combination of

pH meter and glass electrode. Water sample was taken in a clean beaker and dipped the

electrode of the pH meter into it and observed the reading directly. The meter should be

calibrated routinely at pH 7.0 using appropriate buffer solution and then the accuracy

verified by testing a pH 9.2 buffer.

36

3.2.4.6 Total Solids

Total solids is the measure of all kinds of solids (i.e) suspended , dissolved and

volatile solids. The term suspended solids applies to dry weight of the materials

removed from a measured volume of water sample by filtration through a filter paper.

The term dissolved solids applies to dry weight of the material from which the

suspended solids are removed through filtration.

Suspended Solids

5 ml of sample was filtered through a pre weighed filter paper (pre dried at

103 - 105 °C for 10 minutes). The filter paper was then placed in hot air oven at

103 - 105 °C for one hour. The final weight of the filter paper was noted.

Dissolved Solids

5 ml of sample was filtered through a filter paper and the filtrates were taken in

a pre weighed beaker (pre dried at 103 – 105 °C for one hour and weighted). The

beakers with the filtrates were placed in the hot air oven at 103 - 105 °C for one hour.

The final weight of the beaker was noted after it was cooled.

Total Solids

Total solids can be calculated by adding Total Suspended Solids and Total

Dissolved Solids.

(Wf – Wi ) X 1000 TSS (mg/l) = –––––––––––––––––– Volume of sample Where, Wf = weight of the filter paper after filtrations and drying.

Wi = weight of the filter paper before filtrations

(Wf – Wi ) X 1000 TDS (mg/l) = ––––––––––––––––– Volume of sample Where, Wf = weight of the beaker with dried sample.

Wi = weight of the beaker prior to sample addition.

The Total Solids (TS) can be calculated as, TS = TSS + TDS

37

3.2.4.7 Biological Oxygen Demand (BOD)

Biological oxygen demand is the measure of the degradable organic material

present in the sample and can be defined as the amount of the oxygen required by the

microorganisms to stabilise biologically degradable organic matter under aerobic

condition. The principle of the method involves measuring the difference of the oxygen

concentration between the sample before and after incubating it for 5 days at 60 °C.

The sample is filled in the air tight BOD bottles without any air bubbles. The

sample is taken in a pair of BOD bottle, one for the determination of initial BOD value

and other for the final BOD value. About 1 ml of manganous sulphate and 1 ml of

alkaline Iodide solution is added to the sample, resulting in the formation of brown

precipitate. This solution is incubated in dark for half an hour. After incubation, 1 ml of

concentrated sulphuric acid is added to dissolve the brown precipitate. 10 ml of this

solution is taken in a conical flask and titrated against sodium thiosulphate till the

solution turns straw yellow in colour. To this few drops of starch indicator is added.

Titration is continued till the disappearance of blue colour. Thus the initial value is

calculated and the final value after 5 days of incubation was noted by following the

same procedure. The difference between the initial and final value gives the biological

oxygen demand of the sample.

Calculation

C.D X N X E X 1000 X 0.698 X VT DO (mg/l) = ––––––––––––––––––––––––––––––––

Volume of sample used in titration BOD = Initial – after incubation.

Where,

C.D (Correction for displacement of sample when reagents added)

= Volume of bottle – volume of sample.

N = Normality of Na2S2O3 (0.025 N)

E = Equivalent weight of CO2 (8).

1000 = To express per litre.

0.698 = To convert ppm to mg of CO2.

VT = Titre value.

38

3.2.4.8 Chemical Oxygen Demand (COD)

The organic matter and oxidisable inorganic substances present in effluents gets

oxidized completely by standard potassium dichromate in presence of sulphuric acid to

produce carbondioxide and water. The excess potassium dichromate remaining after the

reaction is titrated with ferrous ammonium sulphate. The dichromate consumed gives

the oxygen required for oxidation of the organic matter.

20 ml of the sample was taken in a reflux flask. 30 ml of concentrated sulphuric

acid was added to the sample. It was cooled while addition to the flask to prevent any

loss of volatile matter. To this 10 ml of 0.25 N potassium dichromate was added and

mixed well. A pinch of mercuric sulphate crystals were added to avoid chloride

interference and the contents were refluxed for 2 hours. After cooling, the contents of

the flask were transferred to a 500 ml conical flask and diluted to 50 ml with distilled

water. Then 2-3 drops of ferroin indicator was added to it and titrated against 0.1N

ferrous ammonium sulphate (FAS) solution. The end point was the sharp change in

colour from blue green to reddish brown.

Calculation

(Blank titrate value – Sample titrate value) X Normality of FAS X 8 X 1000 COD (mg/l) = ––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––

Volume of sample

3.2.4.9 Total Nitrogen

Total Nitrogen is estimated by using Kjeldahl method. Nitrogen exists in

several oxidation states and in this method, sulphuric acid is used as an oxidising agent

and the reagents, mercuric ions and potassium sulphate catalyses the oxidation of the

organic nitrogen to ammonium persulphate.

3.2.4.10 Sulphates

The source of sulphate, the major anion in aquatic system formed due to the

biological oxidation of sulphur compounds. It is determined gravimetrically by using

Barium chloride and the subsequent addition of formaldehyde to eliminate the

interferences caused by ions like SO32- .

39

3.2.4.11 Chlorides

Direct discharge of untreated industrial wastes may cause an increase in

chloride content. Chloride content may vary with different samples and chloride

content can be evaluated by titrating the sample against silver nitrate using potassium

chromate as an indicator.

3.2.5 Estimation of Cyanide

Concentration of cyanide present in the samples was determined by a

modification of the Picric acid method of Fisher and Brown (1952). Free and weakly

complexed - cyanide reacts with a picric acid reagent to produce orange colour that

can be measured colorimetrically. The dissolved alkali metal picrate is converted by

cyanide into the coloured salt of isopurpuric acid and its concentration is measured. A

linear calibration curve was obtained with the standard cyanide solution as follows: an

aliquot (0.05 ml) of cyanide-containing solutions (after centrifugation at 15,000 g for

10 minutes at 4 °C) were added to 0.1 ml aliquots of a solution containing 0.5% (w/v)

picric acid and 0.25 M Na2CO3. The resulting solution were placed in a water bath for

5 minutes, diluted to 1ml with 0.85 ml distilled water and cooled in tap water for

30 minutes. The absorbance was read at 520 nm against a blank of distilled water and

picric acid reagent. All experiments and colorimetric readings were performed in

triplicate in accordance with standard methods. (Akcil and Mudder, 2003).

3.2.6 Estimation of Thiocyanate

A modified method of Kim and Katayama (2000) was used for the estimation of

Thiocyanate. It was determined by measuring the absorbance at 420 nm after adding

0.2 ml of 10% (w/v) Fe(NO3)3, 0.2 ml of 5 M HNO3, and 3.9 ml of deionized water to

0.1 ml of the sample. Blank values were taken without adding the samples.

40

3.2.7 Microbial Plating

The enumeration of the total microbes present in the sample can be assessed by

the microbial plating technique. 10 grams of soil were diluted in 90 ml of sterile saline

solution (0.9% NaCl, w/v), mixed thoroughly on a magnetic stirrer at 120 rpm for 120

minutes and then allowed to rest for 60 minutes to allow settling of the soil. Standard

serial dilutions were followed and aliquots of each dilution were spread on nutrient agar

plates. The total bacteria and fungi grown were estimated for enumeration of diversity

of the population.

3.2.8 Microbial Count

The plate count method was used to monitor the number of culturable

heterotrophic bacteria present in the sample. The bacterial count was done by the use of

Neubers’ counting chamber. A drop of the bacterial suspension made from the liquid

culture was placed between the coverslip and the grid and observed under the counting

chamber. In order to group colonies according to time of appearance, visible colonies

grown on non-selective plates were enumerated daily during the incubation period. The

number of bacteria in each class was expressed as a proportion (%) of the total colony

number found after the experimental period.

3.2.9 Influence of Time on Microbial Growth

The impact of time on microbial count can be assessed by observing the colony

counts over a period of time. The concentration of Thiocyanate, Temperature and pH

was kept as constant. Periodic observation of colony forming units (CFUs) was

undertaken.

3.2.10 Influence of Thiocyanate Concentration on Microbial Growth

The impact of Thiocyanate concentration on microbial count can be assessed by

observing the colony counts over a period of time. The concentration of Thiocyanate

was varied from 5 – 20 mM while the factors like Temperature and pH was kept as

constant. Periodic observation of colony forming units (CFUs) were undertaken.

41

3.2.11 Diversity Index

3.2.11.1 Shannon - Weiner Diversity Index

The Shannon - Weiner Diversity index (Shannon and Weaver, 1949) is the

negative sum of each OTU’s proportional abundance multiplied by the log of its

proportional abundance. It also represents the amount of information (entropy) in the

system. The Shannon – Weiner diversity index (Magurran, 1988) was calculated as

follows:

H’ = - ∑ (PilnPi) – [(S-1) / 2N]

where, p represents the proportion of a phylotype relative to the sum of all phylotypes.

Evenness (E) was calculated as: E = H/Hmax where Hmax = log2 (S).

Richness (S): Total number of species in the community, which are equal to the number

of OTUs calculated above (Schloss and Handelsman, 2005).

3.2.11.2 Simpson’s Index

Simpson’s index (D) gives a strong weighting to the dominants. It is also easily

understood: D gives the probability that two clones chosen at random will be from the

same OTU. The formula for the calculation of Simpson’s Index is as follows:

∑ n(n-1) D = –––––––––– N (N-1)

Where, n = total number of organisms of a particular species

N = total number of organisms of all species

The D value usually ranges from 0 – 1. Greater the value of D, lower is its diversity.

The Simpsons index of diversity is 1 – D and is thus a reciprocal of the value of D.

3.3 Isolation and Identification of Bacterial Species

3.3.1 Isolation of Bacteria

Well mixed soil sample (5 gm) was taken in a conical flask containing 45 ml of

0.9% saline solution. An aliquot (2 ml) of soil suspension was inoculated into 50 ml of

enrichment medium. They were incubated at 30 °C and 120 rpm for 24 - 48 hours.

Approximately 2 ml of well grown turbid cultures were taken for subculturing at 5 day

42

intervals. After two successive subculturing, well grown culture was serially diluted

and plated onto nutrient agar. They were then incubated for 24 – 48 hours at 27 °C.

Distinct colonies that were developed were streaked on nutrient agar plates till a pure

culture was obtained. Pure cultures were maintained in nutrient agar slants at 4 °C.

3.3.2 Enrichment Media and Culture Conditions

The enrichment medium composed of the following mineral salts (per litre) of

deionised water: K2HPO4 – 1 g, KH2PO4 – 3.4 g, NaCl – 0.45 g, KCl – 0.5 g,

MgSO4.7H2O – 0.5 g and FeSO4.7H2O – 0.01g. The pH was adjusted to 9.0 with

10M KOH. MgSO4 and FeSO4 were autoclaved separately and added to the medium.

Filter-sterilised (0.2 um pore size) solutions of 10 mM KSCN and Glucose (10 mg/l)

was added to the mineral salts medium.

3.3.3 Identification of Cultures

The isolated pure cultures were identified by means of physiological

characteristics, biochemical tests and molecular analysis. The physiological analysis

includes shape, appearance, motility, Grams’ staining, Capsule staining, Negative

staining and Acid-fast staining. Biochemical analysis includes Catalase test, IMVIC

test, Carbohydrate fermentation, Triple Sugar Iron (TSI) test, Litmus milk test and H2S

test. Amplified region of 16S rDNA followed by sequencing would be done for

molecular identification of the species.

3.3.3.1 Simple Staining

Bacterial smear of the organisms were prepared and the slides were placed on

the staining tray. The organism were heat fixed on the slide and the smear is stained

using the appropriate exposure time for each stains (Carbol fuschin - 15 to 30 seconds,

Crystal violet - 20 to 60 seconds, Methylene blue - 1 to 2 minute). Excessive stains

were removed by washing the smear with tap water and the slides were then air dried.

Finally all the stained slides were examined under oil immersion.

43

3.3.3.2 Negative Staining

Placed a small drop of nigrosin close to one end of the clean slide and by using

sterile technique, a loop full of inoculum from culture is placed in a drop of nigrosin

and mixed well. By placing the edge of second slide at 30° angle in front of the bacterial

suspension, the mixture was pushed to form a thin smear and then air dried. Finally

they were examined under oil immersion.

3.3.3.3 Grams’ Staining

Prepared a thin smear of the each organisms in sterile glass slides. The smear

was then allowed to air dry and heat fixed them. It was then flooded with crystal violet

for one minute and washed with tap water, then flooded with the Gram’s iodine

mordant and allowed it to stand for one minute. Washed the excessive stains with tap

water and decolourized with 95% ethyl alcohol for 30 seconds. Then added

counterstain - Safranin for 30 seconds, washed the excessive stain with tap water and

observed under oil immersion.

3.3.3.4 Acid-fast Stain (Ziehl-Nelson Method)

A bacterial smear of each organism was prepared, air dried and heat fixed. Then

the smears were flooded with carbon fuschin and placed on a warm hot plate and

allowed the preparation to steam for 5min and then washed with tap water. It was then

decolourized with acid-alcohol and added the reagent drop by drop until carbol fuschin

fails to be removed from the smear and then washed with tap water. Subsequently a

counterstain, methylene blue was added and after 2 minutes the excess stain was

removed with tap water, air dried and examined under oil immersion.

3.3.3.5 Spore Stain (Schaeffer-Fulton Method)

After making the smears of isolates, they were flooded with malachite green

and placed on a warm hot plate. Allowed the preparation to steam for 2-3 minutes,

removed the slides from the hot plate, cooled and were washed under running tap

water. Then a counterstain, safranin was added for 30 seconds, washed with tap water,

air dried and examined.

44

3.3.3.6 Capsule Stain

A heavy smear of each organism was prepared and allowed to air dry. The

smear was then flooded with crystal violet. It was left to stand for 5 - 7 minutes and

then washed with 20 % copper sulphate solution. They were observed under oil

immersion after air drying.

3.3.3.7 Motility Test

Under sterile conditions a heavy smear of each organism was developed. After

placing the coverslip upside down on the cavity slide, the slides were inverted carefully

to prepare hanging drop. This hanging drop was then examined under oil immersion

method for detecting any motility.

3.3.4 Biochemical Tests

3.3.4.1 Indole Production Test

By sterile technique, each isolate was inoculated into appropriately labelled

deep agar tube by stab inoculation method. All the tubes were incubated for 24 - 48

hours at 37 °C. A positive result is confirmed when a red coloured ring developed after

the addition of para-dimethyl amino benzaldehyde.

3.3.4.2 Methyl Red Test

A pure culture of the test organism was inoculated in MR-VP medium broth.

After incubation for 24 hours at 37 °C, 5 drops of methyl red reagent was added directly

to the broth. The development of the red colour indicated a positive result.

3.3.4.3 Voges-Proskauer Test

By loop inoculation method, each experimental organism was inoculated into its

appropriately labelled tube containing MR-VP medium. After incubation for 24 - 48

hours at 37oC, Barritt’s reagent was added. Development of rose colour indicated a

positive result.

45

3.3.4.4 Citrate Utilization Test

The isolates were inoculated into tubes containing Simmons citrate agar

medium by means of a stab and streak inoculation. After incubating the tubes for

24 - 48 hours at 37 °C, development of colour was noted. Formation of deep Prussian

blue from green indicated a positive result.

3.3.4.5 Hydrogen Sulphide Test

Each of the isolates was inoculated into its appropriately labelled tube with SIM

agar medium by stab inoculation. All cultures were then incubated for 24-48 hours at

37 °C. The formation of black precipitate along with the stab inoculation indicated a

positive reaction.

3.3.4.6 Litmus Milk Reactions

All the isolates were inoculated into Litmus milk broth by loop inoculation. All

cultures were incubated for 24 - 48 hours at 37 °C. Formation of pink colour throughout

the tube indicated the occurrence of lactose fermentation, the presence of pink band

indicated an acidic reaction followed by reduction. Based on the development of

colour, the results were analysed as either acidification, alkalination, reduction or

proteolysis.

3.3.4.7 Catalase Test

By streak inoculation method, all experimental organisms were inoculated into

its appropriately labelled tubes with trypticase soy agar slants. They were then

incubated for 24 - 48 hours at 37 °C. Finally the presence of catalase was detected by

observing the formation of bubbles after adding 3% hydrogen peroxide reagent.

Presence of bubbling denotes a positive result for catalase.

46

3.3.4.8 Triple Sugar-Iron Test

Each experimental organism was inoculated into appropriately labelled tube

with Triple sugar-iron agar slant medium by means of streak inoculation. All cultures

were then incubated for 24 - 48 hours at 37 °C. A positive result is indicated by the

change from red to deep pink colour.

3.3.4.9 Oxidase Test

A loopful of culture were placed on the oxidase disks and the colour change

was noted for positive results.

3.3.4.10 Carbohydrate Fermentation

The experimental organisms were inoculated into its appropriately labelled tube

with phenol red lactose, dextrose (glucose) and sucrose broths by loop inoculation

method. The fermentation tube should not be disturbed during this process and all the

tubes were incubated for 24 - 48 hours at 37 °C. During this process, a positive result is

indicated by the change in colour of phenol red into yellow or formation of bubbles in

the inverted Durham tube present inside the tubes.

3.3.5 Antimicrobial Sensitivity Test

Each experimental organism was inoculated into its appropriately labelled

conical flasks with 0.8 % of saline solution by means of loop inoculation. A sterile cotton

swab was dipped into a well mixed test culture and the saturated swab was pressed

against the inner wall of the culture before spreading it uniformly in nutrient agar plates.

The antibiotic disks of Chlortetracycline, Erythromycin, Chloramphenicol and Ampicilin

were placed in equal distance in the petriplates. They were incubated for 24 hours and the

zones of inhibition for the respective antibiotic disks were measured (as mm).

3.3.6 FAME Analysis by Gas Liquid Chromatography

The fatty acid composition of the bacterial isolates were analysed after converting

them into the form of methyl esters. Fatty Acid Methyl Esters (FAME) were separated as

per the method of Kates (1972). It was further used for analysis by Gas liquid

chromatography.

47

3.3.6.1 Sample preparation for Fatty Acid Analysis

As an initial step, the bacterial culture was saponified by the addition of

saponification reagent (45 g of NaOH, 150 ml of CH3OH and 150 ml of distilled water).

It was vortexed for 5-10 seconds and kept in a boiling water bath. After 5 min, the tubes

were removed from the water bath and vortexed for 5-10 seconds and again kept in a

boiling water bath for 25 min. The tubes were then removed and cooled in tap water at

room temperature. Two millilitres of methylating reagent (325 ml of 6.0 N HCl and

275 ml of CH3OH) were added to all the tubes, then heated in a water bath at 800C for 10

min and cooled quickly to room temperature. The FAME thus formed were removed

from the aqueous phase and transferred to an organic phase by liquid-liquid extraction

procedure. Extraction solvent (Hexane and diethyl ether, 1:1) was added to all the tubes,

mixed well and the aqueous lower phase was discarded. To the upper solvent phase, 3.0

ml of base wash solution (10.8 g NaOH and 900 ml distilled water) were added, mixed

well and subjected to centrifugation. The upper solvent layer was removed and placed in

a GC vial for analysis.

3.3.6.2 FAME Analysis

FAME were analysed by gas chromatography (Shimadzu GC-17A equipped with

flame ionisation detector) using a capillary column BPX70, 30 m length x 0.25 mm

internal diameter x 0.25 um film thickness at a programmed temperature with Nitrogen as

a carrier gas (1.0 ml/min). The oven temperature was maintained at 50 °C for 3 minutes

followed by an increase of 30 °C/minute upto 170 0C and followed by a second increase

of 3 °C/minutes upto 230 °C and finally held for 10 minutes. Individual peaks of FAME

were identified by comparing retention times with that of FAME standards (FAMQ-005)

obtained from Accustandard, USA. The relative content of individual fatty acid was

expressed as % of total fatty acids.

3.3.7 DNA Extraction and Isolation

DNA was obtained by using a modified standard Phenol:Chloroform extraction

method. 1 ml overnight culture of the bacterium grown in Nutrient Broth (HiMedia

Laboratory, Mumbai) was centrifuged and the cell pellet was suspended in 200 µl

48

extraction buffer (100 mM Tris, 100 mM EDTA, 200 mM NaCl,

1% polyvinylpyrrolidone (w/v), 2% CTAB pH 8.0). Then 200 µl SDS buffer consisting

of 2% SDS (w/v), 10 mM Tris, and 200 mM NaCl (pH 8.0) was added. The suspension

was extracted with 400 µl phenol/Tris-HCl, 400 µl phenol and chloroform–isoamyl

alcohol (25:24:1) and 400 µl chloroform/isoamyl alcohol (24:1) with centrifugation at

16,000 rpm for 5 minutes, respectively. Bacterial DNA was precipitated in 400 µl

Isopropanol at 20 °C for 1 hour and centrifuged at 14,000 rpm for 20 minutes. DNA

was vacuum-dried, dissolved in 50 µl sterile distilled water and stored at -20 °C before

further experiment.

3.3.8 Amplification and Sequencing of 16S rDNA

The DNA obtained was used for amplification and sequencing of 16S rDNA genes.

The 16S rDNA genes were amplified by using specific primers :

5’-ATGACGTTAGCGGCGGACGG - (Forward)

5’- CGCAATACGTGTAATGGATA - (Reverse)

The Polymerase Chain Reaction (PCR) was carried out using a thermal cycler

(Eppendorf, USA). The PCR amplification reaction included the following: Bacterial

DNA, 0.5 µM Primers, PCR buffer (10 mM Tris-HCl at pH 8.3, 50 mM KCl, 2 mM

MgCl2), 200 µM Concentration of each dNTP, 1.0 U of Taq Polymerase. The reaction

was carried out with an initial denaturation at 95 °C for 5 minutes, followed by

denaturation for 30 cycles at 95 °C for 1 minute, annealing at 55 °C for 1 minute,

extension at 72 °C for 1 minute and final extension at 72 °C for 10 minutes. The

presence and yield of PCR product was determined on 1% agarose gel electrophoresis

at 50 V for 30 minutes in Tris-acetate-EDTA buffer and stained with ethidium bromide.

3.3.9 Sequence Analysis of 16 S rDNA

The sequences were manually aligned with sequences from database consisting

of small subunit rRNAs collected from EMBL international nucleotide sequencing

library. The sequences were compared by BLAST analysis. Regions not sequenced in

any reference organism were excluded from the analysis. Phylogenetic tree was

49

constructed by neighbourhood joining method. Boot strap analysis (100 replication)

was used to validate the reproducibility of the branching pattern of trees.

3.3.10 Phylogenetic Tree Construction

All the sequences were compared with 16S rRNA gene sequences available in

the GenBank databases by BLASTn search. Multiple sequence alignments of partial

16S rRNA gene sequences (500 to 900 bp) were aligned using CLUSTAL W, version

1.8 (Thompson et al., 1994). Phylogenetic trees were constructed from evolutionary

distances using the Neighbor-Joining method implemented through NEIGHBOR

(DNADIST) from the PHYLIP version 3.61 packages. The robustness of the phylogeny

was tested by bootstrap analysis using 1000 iterations. Trees generated were analyzed

with the TREEVIEW program.

3.4. Microbial Degradation, Kinetic and Enzymatic Studies

3.4.1 Thiocyanate Biodegradation

The effect of various concentrations of thiocyanate, phenol, cyanide, ammonia,

nitrate, and nitrite on thiocyanate degradation was investigated in shake flask cultures.

Concentrated stock solutions of thiocyanate, phenol, and cyanide were used after

sterilization with 0.2 μm pore size filter. About 100 mg (dry cell weight) of fungal

inoculum was seeded into 500 ml Erlenmeyer flask containing 100 ml of the mineral

medium and incubated on a rotary shaker at 250 rpm, 25 °C for 3 - 7 days. During the

thiocyanate degradation, ammonia and sulphate concentrations in the medium were

measured for the identification of final products.

3.4.2 Influence of Various Factors on Thiocyanate Degradation

Factors affecting Thiocyanate biodegradation were investigated using bacterial

consortium in a batch culture medium. The influence of various factors like pH,

Temperature, concentration of glucose, inoculum cell density on Thiocyanate

degradation was taken into consideration. Flasks containing 50 ml of the minimal

medium and initial inoculum of the isolate (1 ml) was analysed for Thiocyanate

degradation at different pH (5.0 – 10.0), temperature (25 – 50 °C), Glucose

50

concentration (5 - 50 mg/l) and cell density (10-4 – 10-9). The experiments were done by

varying one Parameter while keeping the other parameters constant. Bacterial growth was

measured by taking absorbance at 600 nm. Thiocyanate was estimated by the method

described earlier.

3.4.3 Comparison of Pure and Mixed Culture

In the present study, the three strains S2, S6 and S7 have been selected for the

single and mixed culture reactions. The various combinations of mixed cultures were

used for assessing its potential towards thiocyanate degradation.

3.4.4 Ammonium Estimation

Ammonium concentration was measured with Nesslers’ reagent in 0.1 ml

sample diluted 10 times after sulphide precipitation by adding 10 μl of 0.35 M zinc

sulphate. The pellet was centrifuged after 30 minutes. Then the supernatant was

brought to pH 10.5 by addition of 6 M NaOH, 1 drop of 0.13 M of EDTA was added

and finally 80 μl of the Nessler’s reagent. After 5–10 minutes the absorbance at 425 nm

was measured using ammonium chloride as a standard. This procedure allowed

measurements of ammonia concentrations from 0.2 to 10 mM (Adjei and Ohta, 1999).

3.4.5 Immobilisation of Bacterial Cultures

Bacterial isolates were immobilised in Alginate beads. Sodium Alginate was used

for the preparation of beads. Immobilised cultures were tested for their efficiency against

the free cells.

3.4.6 Determination of Minimum Inhibitory Concentration

The MIC was defined as the lowest concentration of inhibitor above which no

growth was observed. The MICs of cyanide and related substrates were determined in a

Tris-buffered minimal medium. The components of the medium were as follows: Tris

buffer (40 mM), glucose (10 mM), MgSO4 (2.2 mM), K2SO4 (5 mM),

FeSO4 (0.04 mM), Sodium glycerophosphate (10 mM)and (NH4)2SO4 (25 mM)

(as the nitrogen source). In all cases, twofold dilutions of the test inhibitor were made

in water and added in equal proportions to the above-described medium. Experiments

51

were conducted in test tubes as described earlier and containing 8 ml of medium.

A 2 % inoculum previously grown on the same medium without inhibitor was added,

and cultures were incubated for 48 hours before being observed for growth by visible

inspection or absorbance measurements. MIC of heavy metals like Cadmium, Nickel

and Zinc was also determined for assessing the tolerance level of the isolates. A series

of increasing concentration of each heavy metal in the range of 10-100 mM was tested

against the growth of organisms. Similar results were recorded after plasmid curing

exercise to determine the role exerted by plasmid in conferring tolerance to the species.

3.4.7 Plasmid Isolation

The plasmid isolation was done by following the method of alkaline lysis

technique. A brief method is as follows: An aliquot (1.5 ml) of the sample was

centrifuged at 14,000 rpm for 1 minute and the supernatant was removed. To the

pellet, added 200 µl of solution I and it was mixed thoroughly. Added 200 µl of

solution II and solution III and inverted it to mix thoroughly. It was then centrifuged at

14,000 rpm for 10 minutes. Transfer the supernatant to a fresh tube and added 900 µl of

100 % ethanol. Centrifuged at 14,000 rpm for 10 minutes; remove the supernatant and

added 100 µl of ice cold ethanol. It was again centrifuged at 14,000 rpm for 30 seconds

and resuspended the pellets in 50 µl distilled water. It was stored at -20 °C and the

bands were visualised by running in an agarose gel electrophoresis.

The procedure involved the use of the following reagents:

Solution I: 50 mM Glucose

25 mM Tris-Cl (pH 8.0)

10 mM EDTA (pH 8.0)

They were prepared from stocks prepared for 100 ml. They were stored at 4°C

and autoclaved before further use.

Solution II: 0.2 N NaOH (Freshly diluted from 10 N stock)

1 % (w/v) SDS

Prepare fresh. Store at room temperature.

52

Solution III: 5M Potassium Acetate

Glacial Acetic Acid

Dist. H2O

Stored at 4°C.

3.4.8 Plasmid Curing

Plasmid curing was carried out according to a modified method of

Sambrook et al, 1989. It was done to assess the role of plasmids in conferring tolerance

to heavy metal analysis.

3.4.9 Estimation of Protein

Protein concentration in the enzyme fractions was assayed by the Bradford

method (Bradford, 1976). Add equal volume of 1M NaOH and the sample in a tube. To

this added 5 ml of bradford reagent. They were incubated for 5 minutes and then the

absorbance was read at 595 nm.

Bradford reagent:

Dissolve 100 mg Coomassie Brilliant Blue G-250 in 50 ml 95 % ethanol, add

100 ml 85 % (w/v) phosphoric acid. Dilute to 1 liter when the dye has completely

dissolved and filter through Whatman paper just before use.

3.4.10 Agarose Gel Electrophoresis

The DNA and the plasmid isolated were tested by running in an agarose gel.

The Agarose Gel Electrophoresis (AGE) method was carried out by a modification of

the method by Sambrook et al., 1989. The constituents of agarose gel electrophoresis

are:

1. Loading buffer

2. Ethidium Bromide staining solution

3. TAE buffer

53

3.4.11 SDS-PAGE Analysis

The protein analysis was carried out by following the method of Laemmli,

et al., 1970. The important constituents for PAGE are:

1. Staining solution

2. Destaining solution

3. Lower Tris Buffer

4. Upper Tris Buffer

5. Tank Buffer

3.4.12 Enzyme Assay

3.4.12.1 Preparation of Cell-free Extract

To study the enzymes involved in thiocyanate degradation, the strains were

grown in mineral medium containing 150 mg/l thiocyanate (pH 7.0). The cells were

harvested after 48 hours incubation at 37 °C by centrifugation (10,000 × g for 15 min)

and washed thrice with 100 mM Tris–HCl buffer (pH 7.4). The cells were lysed by

sonication and centrifuged. The final cell-free supernatant was used for the enzyme

assays.

3.4.12.2 Thiocyanate Hydrolase Assay

The rate of thiocyanate hydrolysis catalyzed by thiocyanate hydrolase was

determined by measuring the decrease in thiocyanate concentration. The standard assay

mixture contained 100 mM Tris–HCl buffer (pH 7.4) and 5 mM potassium thiocyanate.

The reaction was initiated by addition of crude enzyme. The reaction mixture was

incubated at 37 °C. The aliquot (0.5 ml) was removed from each tube after every 30

minutes and 0.5 ml of trichloroacetic acid (10 %) was added. After centrifugation, the

supernatant was used for measurement of thiocyanate. The control was kept

simultaneously without enzyme.

One unit of thiocyanate hydrolase activity is defined as the amount of enzyme

necessary to convert one micromole of thiocyanate per minute under the appropriate

conditions.

54

3.4.13 Scanning Electron Microscopy Analysis

Scanning electron microscopy (SEM) is an invaluable method to determine the

diversity of micro-organisms on any surface and was used to observe the physical

relationships between the bacteria and other organic/inorganic compounds. The

establishment of the heterogeneous bacteria was determined by observing the

differences between a control and a bacterial culture inoculated with Thiocyanate. Gold

coated bacterial cells that were previously well dried were used for the analysis of both

inoculated and uninoculated cultures.

The bacterial samples were fixed in 5 % gluteraldehyde (5 % v/v 0.1 M

phosphate buffer, pH 7.4) for 3 hours, rinsed twice in 0.1 M phosphate buffer, pH 7.4,

then post-fixed in a 2 % gluteraldehyde – 3 % formaldehyde solution (v/v 0.1 M

phosphate buffer, pH 7.4) for 1 hour. The combination of these aldehydes provided a

good quality of fixation as formaldehyde rapidly penetrates tissues stabilising the

structure of biological material whilst gluteraldheyde permanently fixes the sample.

The samples were then rinsed twice with 0.1 M phosphate buffer, pH 7.4, before being

sequentially dehydrated for 20 minutes in 70 %, 90 % (both v/v 0.1 M phosphate

buffer, pH 7.4) and 100 % acetone. Air drying was used without any effect on the

disruption of cellular structures and maintaining the stability of the fixed structure. The

samples were mounted onto aluminium stubs using carbon tape and sputter coated with

gold. This prevented the build-up of static charges. The samples were viewed on the

scanning electron microscope (Hitachi, Japan).