lable at ScienceDirect

Biomaterials 75 (2016) 260e270

Contents lists avai

Biomaterials

journal homepage: www.elsevier .com/locate/biomateria ls

Matrix metalloproteinase-20 mediates dental enamelbiomineralization by preventing protein occlusion inside apatitecrystals

Saumya Prajapati a, Jinhui Tao b, Qichao Ruan a, James J. De Yoreo b,Janet Moradian-Oldak a, *

a University of Southern California, Herman Ostrow School of Dentistry, Division of Biomedical Sciences, Center for Craniofacial Molecular Biology, LosAngeles, CA 90033, USAb Physical Sciences Division, Pacific Northwest National Laboratory, Richland, WA 99352, USA

a r t i c l e i n f o

Article history:Received 4 August 2015Received in revised form7 October 2015Accepted 14 October 2015Available online 22 October 2015

Keywords:Matrix metalloproteinase-20Protein occlusionEnamel biomineralizationAmelogenin

* Corresponding author.E-mail address: joldak@usc.edu (J. Moradian-Olda

http://dx.doi.org/10.1016/j.biomaterials.2015.10.0310142-9612/© 2015 Elsevier Ltd. All rights reserved.

a b s t r a c t

Reconstruction of enamel-like materials is a central topic of research in dentistry and material sciences.The importance of precise proteolytic mechanisms in amelogenesis to form a hard tissue with more than95% mineral content has already been reported. A mutation in the Matrix Metalloproteinase-20 (MMP-20) gene results in hypomineralized enamel that is thin, disorganized and breaks from the underlyingdentin. We hypothesized that the absence of MMP-20 during amelogenesis results in the occlusion ofamelogenin in the enamel hydroxyapatite crystals. We used spectroscopy and electron microscopytechniques to qualitatively and quantitatively analyze occluded proteins within the isolated enamelcrystals from MMP-20 null and Wild type (WT) mice. Our results showed that the isolated enamelcrystals of MMP-20 null mice had more organic macromolecules occluded inside them than enamelcrystals from the WT. The crystal lattice arrangements of MMP-20 null enamel crystals analyzed by HighResolution Transmission Electron Microscopy (HRTEM) were found to be significantly different fromthose of the WT. Raman studies indicated that the crystallinity of the MMP-20 null enamel crystals waslower than that of the WT. In conclusion, we present a novel functional mechanism of MMP-20, spe-cifically prevention of unwanted organic material entrapped in the forming enamel crystals, which oc-curs as the result of precise amelogenin cleavage. MMP-20 action guides the growth morphology of theforming hydroxyapatite crystals and enhances their crystallinity. Elucidating such molecular mechanismscan be applied in the design of novel biomaterials for future clinical applications in dental restoration orrepair.

© 2015 Elsevier Ltd. All rights reserved.

1. Introduction

Nature provides us with many examples of biominerals,including calcium phosphate crystals in bones and teeth, and cal-cium carbonate crystals in nacre and sea urchins [1]. A veryfundamental part of biomineralization is the complex extracellularmacromolecular framework in which mineralization occurs, suchas the collagen fibrils in bone and dentin, polysaccharides in nacreand extracellular matrix proteins in dental enamel. Macromole-cules such as proteins, glycoproteins and enzymes regulate theprocess of mineral nucleation and growth in various ways to create

k).

biomaterials with outstanding mechanical properties [2]. Thesemacromolecules can interact with ions to stabilize the amorphousphase prior to crystal formation, adsorb on particular crystal facesand stabilize certain polymorphs [3,4]. Moreover, they can beadsorbed on edges and terraces of crystals to promote growth in acertain direction and therefore control crystal morphology [5e8].In the case of the sea urchin, these macromolecules become over-grown following adsorption and are occludedwithin the crystal [9].The occlusion of these molecules can affect the crystal texture andcause morphological changes, consequently affecting the me-chanical properties of the mineral [10e12].

Enamel is the outermost layer of the tooth and is the hardestbioceramic in the vertebrate body. It consists of highly organizedhydroxyapatite (HAP) crystals. Enamel formation (amelogenesis) isa highly orchestrated process that involves precise cell signaling

S. Prajapati et al. / Biomaterials 75 (2016) 260e270 261

mechanisms, secretion, assembly and degradation of enamel ma-trix proteins [13,14]. Although the process of enamel biominerali-zation occurs in an extracellular matrix enriched in proteins,mature enamel crystals have virtually no organic content [15].Mature enamel contains only 1e2% organic material that is mostlyconcentrated at the periphery of the prism bundles [16,17] Twomajor stages of amelogenesis, namely the secretory andmaturationstages, have been defined according to the morphology and func-tion of ameloblasts [18]. Enamel formation begins during thesecretory stage with the ameloblast cells laying down an organicmatrix followed by immediate and simultaneous nucleation ofamorphous calcium phosphate mineral in the form of long, thinribbons adjacent to the secretory faces of ameloblasts [18e20]. Thematrix secreted into the future enamel space consists of severalproteins, including amelogenin, enamelin, ameloblastin and ame-lotin, along with proteases such as Matrix Metalloprotinease-20(MMP-20) and Kallikrein-4 (KLK-4). MMP-20 is secreted duringthe secretory stage and is involved in cleavage of specific domainsin enamel matrix proteins [21e23]. Enamel biomineralization iscompleted at the maturation stage when KLK-4 is secreted tocompletely digest the extracellular matrix, resulting in hardeningof the tissue by allowing the enamel apatite crystallites to growmostly in thickness and fill the space.

MMP-20 is critical for normal enamel formation, as severalmutations in the MMP-20 gene in humans have been reported tocause Amelogenesis Imperfecta (AI), a hereditary disease of enamelmalformation [24,25]. The affected teeth present with a hypo-maturation phenotype showing pigmentation, mottling, rough-ness, brittleness and sometimes fracture of the enamel. The MMP-20 null mouse was created to study the effects of MMP-20 onenamel formation by deleting the majority of exons 4 and 5 of theMMP-20 gene [26]. The resulting phenotype is associated withseveral defects in the enamel: hypoplasia (thin enamel), hypo-mineralization (soft enamel) with an altered enamel rod pattern,enamel that breaks off from the dentin, an absence of the charac-teristic decussating pattern and deteriorating enamel morphology[26]. The MMP-20 null mouse also shows a large number ofenamel-free areas in the maxillary molars when observed underSEM [26,27].

In the present study, we took advantage of the MMP-20 nullmouse as a model to study the effect of this metalloproteinase onthe nucleation and growth morphology of enamel HAP crystals byanalyzing individual isolated apatite crystals from the two majorstages of enamel formation. We hypothesized that in MMP-20 nullmice, amelogenin and other enamel matrix proteins are trappedinside the hydroxyapatite crystals during the secretory stage ofamelogenesis, affecting the growth and maturation of these crys-tals. Our hypothesis was based on our recent finding that the full-length amelogenin protein is occluded inside calcite crystalsgrown in vitro in the absence of MMP-20. The presence of amelo-genin in the crystallization solution resulted in pits and steps on thecalcite crystal surface, but the morphology of the crystals wasrescued following the addition of MMP-20 to the crystallizationsolution. Our in vitro study suggested that, along with its otherproposed functions, MMP-20 may prevent protein occlusion insideapatite crystals during enamel formation [28]. We combined elec-tron microscopy and atomic force microscopy techniques toanalyze morphology of isolated enamel crystals from MMP-20 nullmice and ascertain whether proteins were present inside the HAPcrystals. We present evidence that supports a novel function of ametalloproteinase in calcium phosphate biomineralization andprovides insight into the question of why extracellular proteinsneed to be cleaved. Understanding the molecular mechanisms thatgovern the physiological function of MMP-20 in mediating crystalformation is important for future development of a biomimetic

enamel-like material [29e31]. Such a material would have a greatpotential as an alternative dental restorative material for repairingdamaged human tooth enamel [32].

2. Materials and methods

2.1. Animals

MMP-20 heterozygous mice (MMP-20þ/�) with a C57BL/6Jbackground were obtained from the Mutant Mouse RegionalResource Center (MMRC) and housed in the University of SouthernCalifornia Vivarium. This study was approved by the University ofSouthern California Institutional Animal Care and Use Committee.

2.2. Enamel crystal isolation

TheMMP-20heterozygousmiceweremated to obtainMMP-20þ/þ

and MMP-20�/� colonies. The MMP-20þ/þ males and females weremated to obtainWTcolonieswhichwereused as controls in this study.The MMP-20�/� males and females were mated to obtain MMP-20null mice, which were used for all the experiments. The femaleswere checked for vaginal plugs every day. The pups were weaned atthe age of threeweeks andwere also tagged andgenotypedat this age.Genotyping was performed by Transnetyx using the followingprimers: MMP-20 null 50GCCGAGGATTTGGAAAAAGTGTTTA30 and30TTCATGACATCTCGAGCAAGTCTTT5'and WT 30ATACCCCAAAAAGCATGAAGAGACT3'and 30CAAGTTTTAAAGGTTGGTGGGTTGT5’. Mandib-ularandmaxillary incisors fromadultMMP-20null andWTmiceweredissected. The incisors were depulped and cleaned in simulatedenamel fluid (SEF) by sonicating them 3 times in awater bath for 30 seach, with a one minute interval in between each sonication. The SEFwas changed each time. The incisorswere air-dried and the secretory-stage enamelwas isolatedusing a scalpel and collected inpre-weighedtubes. TheWT incisors were freeze-dried for 12 h before the isolationof the maturation-stage enamel. Maturation-stage enamel from theMMP-20nullmicewaseasily removedbyscraping itwitha scalpel andwas therefore not freeze-dried prior to isolation.

2.3. Amelogenin preparation

Recombinant mouse amelogenin rM179 was expressed andpurified as previously described [33]. The amelogenin obtainedthrough this procedure is an analogue to M180 but lacks the firstmethionine and is non-phosphorylated.

2.4. Extraction of intra-crystalline enamel proteins

The isolated enamel was weighed and washed with a series ofprotein extraction buffers, specifically phosphate buffer (0.1 M pH7.4) and tris urea buffer (50mM Trisþ 4MUrea pH 7.4), as shown inFig. 1. These washes removed all the adsorbed proteins from theenamel surface and were followed by washes with distilled waterto remove the remaining buffer. The supernatant was collectedeach time and stored for further evaluation. The enamel crystalswere then dissolved in 1 M HCl. Supernatants collected from thesecond wash with Tris Urea buffer (W1UT, W2UT and W3UT) anddissolved crystals (W1HCl) were desalted using a Microcon Cen-trifugal Filter Devices MW: 3000 Da at 10,000 rpm for 40 min at4 �C. They were then freeze-dried and reconstituted in 200 ml ofdistilled water for further analysis.

2.5. Quantitative analysis of intra-crystalline proteins using UV-absorption and Western Blot

Supernatants collected from each wash, as described in Fig. 1,

Extract incisors (10 maxillary and 10 mandibular each) from Wild Type (WT) and MMP-20

Null adult mice

W1P, W2P, W3P (Phosphate Buffer 0.1 M pH 7.4) x 3 times

W1UT, W2UT, W3UT (50mM Tris+4M Urea pH 7.4) X 3 times

W1P’, W2P’ W3P’(Phosphate Buffer 0.1 M pH 7.4) x 3 times

Wash with dH2OTEM, SEM, AFM and RAMAN samples

SDS-PAGE, Western Blot, UV-adsorption

Dissolve enamel crystals in 1M HCl: W1HCl

Step 1

Step 2

Step 3

Step 4

Step 5

Fig. 1. Schematic showing methods used to isolate enamel crystals from WT andMMP-20 null mice. The isolated crystals were either used for characterization exper-iments or dissolved in 1 M HCl for protein analysis. W1P, W2P & W3P: Phosphatebuffer washes (Step 1); W2UT, W2UT & W3UT: Tris þ Urea washes (Step 2); W1P0,W2P’ & W3P’: Phosphate buffer washes (Step 3); W1HCl: Dissolution in 1 M HCl (Step5).

S. Prajapati et al. / Biomaterials 75 (2016) 260e270262

were either dialyzed before freeze-drying or directly freeze-dried.Protein was quantified from all the supernatants obtained asshown in Fig. 1 using a Nanodrop ND-1000 spectrophotometer(NanoDrop Products, Wilmington, DE) at l ¼ 280 nm. The super-natants were dissolved in 1X loading buffer, loaded in 12% acryl-amide gels and run at 120 V. One gel was used for silver stainingand the second gel was used for Western Blot. The gel was trans-ferred to a PVDF membrane using a wet transfer at 120 V for 1 h,incubated with 5% non-fat milk in PBST (0.01% Tween-20), immu-nostained with primary antibody and then visualized using anenhanced chemiluminescence plus Western blotting detectionsystem (GE Healthcare). The antibody used was a polyclonal anti-body raised against recombinant mouse amelogenin (rM 179) inchicken [34].

2.6. SEM and TEM sample preparation

Enamel crystals isolated from adult incisors of MMP-20 null andWT mice as described earlier (Fig. 1, step 4) were analyzed usingScanning Electron Microscopy (SEM) and High Resolution Trans-mission Electron Microscopy (HR-TEM). The enamel crystal sam-ples for SEM were suspended in 100% ethanol and placed on SEMmounts. They were gold-plated for 30 s and imaging was per-formed in a field emission scanning electronmicroscope (JEOL JSM-7001F) operating at an accelerating voltage of 10 keV.

The samples for HR-TEM were suspended in 100% ethanol,placed on TEM grids (Carbon Type-B, Ted Pella Inc.) and dried for atleast 14 h before imaging. HR-TEM images were obtained on a JEOLJEM-2100 microscope using an accelerating voltage of 200 keV.

2.7. Raman spectroscopy

Micro-Raman spectroscopy was used to investigate the pres-ence of associated organic materials as well as to determine thecrystallinity of isolated enamel crystals of WT and MMP-20 nullmouse enamel, at both the secretory and maturation stages.

Samples were prepared as described in Fig. 1. The Raman spectrawere collected from 100 to 4000 cm�1 under backscattering ge-ometry by a LabRAM ARAMIS confocal Raman Microscope (HORIBAscientific, Japan) operated at a resolution of 2 cm�1 with an exci-tation wavelength of 532 nm and laser power of 2.5 mW. A � 60objective with numerical aperture of 0.75 was used to focus thesample and to collect the spectra for 20 s. The experiment wasrepeated 5 times for each sample and the results were averaged.

To evaluate the relative crystallinity of enamel crystals of WTand MMP-20 null animals in both secretory and maturation stages,the Raman peak of totally symmetric stretching mode (n1) of thePO4 group located at ~960 cm�1 was used for FWHM analysis [35].Gaussian functions of the form:

f ðxÞ ¼ y0 þA

sffiffiffiffiffiffi

2pp e�ðx�mÞ2=ð2s2Þ

where y0 is the intensity at the base of the peak, m is the x coor-dinate (cm�1 by Raman shift) at the center of the peak, A is the areaof the peak, and s is the standard deviation or Gaussian RMSwidth.Gaussian Functionwas used to fit the Raman peak at 960 cm�1 withconvergence of the R2¼ 0.99 by Origin 8.5 (Origin Lab Corporation).In this case, the FWHM was equal to 2

ffiffiffiffiffiffiffiffiffiffiffiffiffi

2 ln 2p

s.

2.8. Atomic force microscopy (AFM)

2.8.1. Crystal thickness measurementsA muscovite mica disc (diameter 9.9 mm, Ted Pella, Inc.) was

freshly cleaved and used as a supporting surface. The mica surfacewas washed with 50 ml poly-L-lysine solution (0.1% w/v, Ted Pella)for 5 min, thoroughly rinsed with water and dried by a stream ofnitrogen gas. WT and MMP-20 null enamel crystals from thematuration and secretory stages were prepared as described inFig. 1, and then dispersed in water by sonication for 10 min toprevent aggregation of the crystals. Three ml of this suspension wasplaced on the poly-L-lysine functionalized mica. To measure thethickness of the enamel crystals, all samples were imaged in air by aNanoScope 8 Atomic Force Microscope equipped with a J scanner.The images were captured in tapping mode with silicon tips (PPP-FMR rectangular cantilever, nominal spring constant k ¼ 2 N/m, tipradius <10 nm, resonance frequency 75 kHz in air, Nanosensors™).Cantilevers were resonated at approximately 75 kHz with a freeamplitude of 50 nm, and images were collected at a tappingamplitude of approximately 80% of free amplitude. All the widthand thickness values were determined manually from the imagesusing NanoScope Analysis 1.4 software and the histogram wasplotted by Origin 8.5 (OriginLab Corporation).

2.8.2. Force curvesThe fixation of samples on the surface was the same as

described above for thickness measurements. Thereafter both theenamel crystals and AFM cantilever were treated with plasma toremove residual organic material adsorbed on the surface. Time-lapse AFM images were continuously collected in an AFM equip-ped with a fluid cell after thermal relaxation for 10 min.

All in situ AFM imageswere captured in ScanAsystmode at roomtemperature (23 �C) with a NanoScope 8 Atomic Force Microscope(E scanner, Bruker) using silicon nitride tips (TR400PSA triangularlever; k¼ 0.08 N/m; tip radius ~20 nm; resonance frequency 34 kHzin air; Asylum Research, Inc.). The signal-to-noise ratio was main-tained above 10. The scanning speedwas 1e2 Hz. The peak force setpoint was carefully tuned to minimize the average loading force(~50 pN) during in situ imaging. Force curves between the siliconnitride tips and enamel crystals were measured in order to deter-mine the organic material trapped inside the crystals. Force curves

S. Prajapati et al. / Biomaterials 75 (2016) 260e270 263

were collected after etching the outer surface of WT and MMP-20null enamel crystals with 200 ml HCl at pH 4.6 followed bywashing with 400 ml of water. The measurements before and afteretching were performed in water. A constant approach andretraction velocity of 500 nm/s and dwell time of 1 s were used andmore than 50 individual force curves were collected for each sur-face condition. The average adhesion force was used to determinethe organic content.

2.9. Statistical analysis of the areas of imperfection in the crystals

All statistical analysis for Fig. 8E was performed in MicrosoftExcel 2010. The significance level was calculated by performingunpaired T-tests assuming unequal variances with p < 0.05. Theimperfections were calculated by taking a Fourier Transformation(FFT) of areas of interest (AOI) of dimensions 8.4� 8.4 nm2. The FFTwas calculated for each AOI using Digital Micrograph software. AOIsshowing no discernable diffraction pattern in the FFT were calcu-lated as regions of imperfections. All such AOIs from 6 differentcrystals (1 from secretory stage, 2 from maturation stage and 3mixed populations) from both WT and MMP-20 null mice werecalculated and averaged.

3. Results and discussion

3.1. Qualitative and quantitative analysis of occluded proteinsinside the enamel crystals of MMP-20 null mice

Fig. 2 shows the SDS-PAGE andWestern blot analysis of proteinsextracted from WT and MMP-20 null mouse enamel crystals. TheSDS-PAGE analysis showed a decrease in the amount of adsorbedproteins on the enamel crystals collected from secretory andmaturation stages with each extraction buffer wash (Lanes 1e6,Fig. 2A&B). Washes W1UT and W2UT showed the maximumnumber of bands on the gel due to the presence of 4 M urea in theextraction buffer. The last washes, W2P0 and W3P0, showed noprotein bands, which indicates that all the adsorbed proteins fromthe enamel crystals had beenwashed off (Lanes 5 and 6, Fig. 2A&B).The crystals dissolved inW1HCl in theMMP-20 null mouse showeda band corresponding to the full-length amelogenin (M180), whichwas confirmed by Western Blot (data not shown). The amount ofintra-crystalline proteins recovered in the W1HCl wash were alsocalculated using a Nanodrop at l ¼ 280 nm (UV-absorption).Remarkably, the total amount (normalized) of proteins in theMMP-20 null crystals was almost 4 times what was found in theWTmice(Fig. 2C).

Since MMP-20 is expressed during the secretory stage of ame-logenesis, the enamel crystals from secretory and maturationstages for WT and MMP-20 null mice were evaluated separately inorder to investigate the function of MMP-20 (Western blot inFig. 2D). All the samples werewashed with the extraction buffers asshown in Fig. 1. Lanes 1 and 2 represent the samples from thesecretory-stage crystals of MMP-20 null andWTmice, respectively.The amount of protein observed in the MMP-20 null mouse wasmore than the WT mice as also shown in previous findings [36].Lane 2 showed some proteins, which was expected because itrepresents an early stage of enamel formation during which someenamel matrix proteins are still retained. Lanes 5 and 6 representthe maturation-stage crystals of MMP-20 null and WT mice,respectively. MMP-20 null mice showed the presence of full-lengthamelogenin even at this stage, whereas in theWTmice the amountof retained proteins was almost negligible. TheWTmice showed noband in the Western blot, which indicated that the mature enamelhad no retained amelogenin (Fig. 2D). The amount of intra-crystalline proteins calculated using UV-adsorption (Fig. 2E)

showed a similar trend to the Western blot (Fig. 2D). MMP-20 nullmice at the secretory stage had the highest amount of proteinswhereas the WT maturation stage had very small amountscompared to MMP-20 null mice.

Our present data corroborate an earlier report that the amountof volatiles (proteins andwater) at the maturation stage inMMP-20null enamel was almost twice the amount detected in the wild type[36]. The differences between our observations and those in pre-vious studies could be due to the difference in the processing of thetissue. In the previous study, enamel strips of 1 mm each were usedtomeasure themineral and protein content, whereaswe used bulk-scraped enamel to make our measurements. Here we demonstratethat the amount of proteins in the MMP-20 null enamel is highereven during the secretory stage, most likely due to the lack ofprotein degradation and entrapment of mostly full-length amelo-genin in the crystals at this early stage. The excess amount ofamelogenin seen at the maturation stage (lane 5 in Fig. 2D&E) inthe MMP-20 null mouse indicates that MMP-20 is an importantproteinase and amelogenesis is affected by its absence even thougha digestive enzyme such as KLK-4 is secreted during thematurationstage [37]. Based on our findings, we hypothesize that the inef-fectiveness of KLK-4 in digesting amelogenin proteins in MMP-20null mice is the result of amelogenin entrapment inside thesecretory-stage enamel crystals. Further studies are needed toaddress this hypothesis.

We also performed Raman Spectroscopy in order to confirm thepresence of organic material inside MMP-20 null mouse enamelcrystals (Fig. 3). At the secretory and maturation stages, the MMP-20 null enamel crystals showed the presence of a broad peak at3000 cm�1, which corresponds to the CeH vibrational ring and isindicative of organic material in the sample. The Raman results arealso consistent with the Western blot and UV-adsorption findings(Fig. 2DeE). In our previous in vitro study with calcite, similarorganic peaks were observed in the calcite crystals grown in thepresence of amelogenin without MMP-20 in the crystallizationsolution [28]. This also indicates that failure to degrade amelogenincan cause retention of these proteins within the crystals.

The presence of intra-crystalline proteins in enamel crystalsisolated fromMMP-20 null mice was further analyzed by AFM forcespectroscopy to measure the adhesive forces between the siliconnitride tip and the surface of the sample before and after thedissolution of the crystals with HCl at pH 4.6 (Fig. 4) [38]. Fig. 4Ashows the typical force curves that were obtained for WT andMMP-20 null enamel crystals at both secretory and maturationstages. It shows the presence of single and multiple rupture forcesin MMP-20 null secretory (Fig. 4I& J), maturation (Fig. 4 E&F) andWT secretory stage (Fig. 4G&H) enamel crystals before and afterdissolution with HCl. In contrast, the WT maturation stage(Fig. 4C&D) enamel crystals showed only a single rupture forcecurve before and after dissolution with HCl. Multiple rupture forcecurves are an indication of interaction between the Si3N4 tip andstretchable macromolecules such as proteins or polysaccharides[39,40]. The percentage of multiple rupture force curves out of thetotal number of curves measures the probability of the tip pickingup the organic material on the surface or on the newly exposedsurface after acid etching. The results (Fig. 4B) show a significantincrease in the percentage of multiple rupture force curves afteracid etching in enamel crystals from the WT secretory stage, MMP-20 null secretory and maturation stages, indicating the presence ofsome occluded organic macromolecules inside the enamel crystalsin these samples. Amelogenin and other enamel matrix proteinsmay act as nucleation centers for unseeded crystallization whenpresent in small quantities but may inhibit crystal growth whenpresent in larger quantities [41]. In the case of the MMP-20 nullmouse, an excess of enamel matrix proteins, mainly the full-length

Fig. 2. Qualitative and quantitative analysis of proteins occluded in enamel crystals (AeC: mixed secretory- and maturation-stage crystals and DeE: separated secretory- andmaturation-stage crystals). A, B: SDS-PAGE of WT and MMP-20 null supernatants obtained after washing isolated enamel crystals with extraction buffers as shown in Fig. 1. Lanes: 1)W1P, 2) W2P, 3) W1UT, 4) W2UT, 5) W1P0, 6) W2P0, 7) rM 179, 8) W1HCl, 9) Protein Standard. C: Normalized amount of proteins in the samples as measured by UV-absorptionobtained after dissolving the isolated crystals in 1 M HCl (W1HCl) for WT, MMP-20 heterozygous and MMP-20 null mice. D: Western blot of samples obtained from WT andMMP-20 null mice at the secretory and maturation stages. E: The normalized amount of proteins in the WT and MMP-20 null secretory- and maturation-stage enamel using UV-absorption (nanodrop).

MMP-20 Null Secretory stageMMP-20 Null Maturation stageWT Secretory stageWT Maturation stage

Raman Shift (cm-1)

Inte

nsity

(A.U

.)

1000 2000 3000 4000

ν(P

O)

C-H

mod

es

ν(O

H)

Fig. 3. Raman spectra of WT and MMP-20 null mouse enamel crystals at secretory andmaturation stages. The Raman spectra suggest that the phase of all enamel crystals isapatite. The presence of a broad peak at 3000 cm�1 shows the presence of a muchgreater amount of organic material inside MMP-20 null enamel crystals than in WT,both at secretory and maturation stages.

S. Prajapati et al. / Biomaterials 75 (2016) 260e270264

amelogenin that remains due to the absence of MMP-20, may causeretention of amorphous calcium phosphate and inhibition of crystalgrowth or phase transformation [42]. Similar results have also beenshownpreviously in the growth of calcite crystals in the presence ofabalone nacre proteins [43].

3.2. The isolated enamel crystals of MMP-20 null mice haveabnormal size and morphology

Differences in enamel crystal size and morphology betweenWTand MMP-20 null mice were observed using TEM, SEM and AFM.There was a stark difference between theWT (Fig. 5A) andMMP-20null enamel crystals (Fig. 5E) when observed under TEM. The WT(Fig. 5A) crystals were long and showed dark bands which, as re-ported earlier, were due to differences in density caused by slightbends, leading to oblique views that create the appearance of theseband-like regions [44]. No dark bands were observed in the MMP-20 null enamel crystals (Fig. 5E) which may be the result of thedecrease in the length of the crystals. The MMP-20 null enamelcrystals appeared more plate-like compared to those of the WT.

Previous SEM studies of MMP-20 null mice have shown anabsence of the typical decussating pattern and an increase in pro-teins associated with enamel crystals [26]. In our study, the isolatedenamel HAP crystals of MMP-20 null mice (Fig. 5F) were more

0

20

40

60

80

100

Perc

enta

ge o

f mul

tiple

rupt

ure

curv

es (%

)

WT Secretory Stage

MMP-20 null Maturation Stage

MMP-20 null Secretory Stage

WT Maturation Stage

before dissolutionafter dissolution

Forc

e (p

N)

0 50 100 150 200Z (nm)

200 pN

Before Dissolution with HCl

After Dissolution with HCl

C

B

D

FE

G H

I J

A

WT Maturation Stage

WT Secretory Stage

MMP-20 null Secretory Stage

MMP-20 null Maturation Stage

Fig. 4. In situ AFM images and force curves of WT and MMP-20 null mouse enamel crystals at secretory and maturation stages showing single and multiple rupture curves (A). Themultiple ruptures are due to the interaction between stretchable organic material and the Si3N4 tip. The percentage of multiple rupture force curves (B) shows the probability of thetip picking up organic macromolecules during force curve measurement before and after dissolution of enamel crystals with HCl at pH 4.6. Panels CeH show images of the followingsamples before and after dissolution with HCl: WT maturation (C&D), MMP-20 null maturation (E&F), WT secretory (G&H) and MMP-20 null secretory stage (I&J).

S. Prajapati et al. / Biomaterials 75 (2016) 260e270 265

heterogeneous and showed an overall decrease in length comparedto the WT (Fig. 5B) controls. They also appeared wider and thinnerthan in the WT. The enamel crystals of MMP-20 null mice weredifficult to isolate because of the amount of proteins associatedwith them. Previously it was shown that the addition of mineralions to maturation-stage enamel crystals did not cause any growthin the crystals until the residual proteins were removed by 8M ureaor sodium hypochlorite [45]. This shows the importance of proteinprocessing by MMP-20 and demonstrates how the length of theenamel crystals may be affected by the excess retention of enamelmatrix proteins.

Systematic analysis of the size distribution of isolatedmaturation-stage enamel crystals from WT and MMP-20 null micewas performed by AFM (Fig. 5 CeD&G-H). The histogram wascalculated using 137 dispersed crystals from WT mice and 28crystals from MMP-20 null mice, and shows the difference in thewidth and thickness of these crystals. The width of the majority ofWT enamel crystals ranged from 50 to 90 nm (Fig. 5C) whereas theMMP-20 null enamel crystals had a wide distribution in size, withthe majority ranging from 60 to 120 nm (Fig. 5G). The MMP-20 nullcrystals also showed a slight decrease in thickness (Fig. 5D), withmost crystals ranging from 20 to 30 nm, whereas the majority ofWT crystals ranged from 20 to 40 nm (Fig. 5H).

The effect of amelogenin on the morphology of OCP crystals,used as a model for enamel apatite crystals, was previously re-ported in an in vitro study. The length-to-width ratio of OCP crystalsincreased in the presence of the degradation product of MMP-20action, namely mouse amelogenin lacking the c-terminal(rM166), as compared to the controls. It was reported thatfollowing the interactions of truncated amelogenins with the hy-drophobic (010) faces of OCP, the width-to-thickness ratio in thepresence of rM166 as well as the presence of extracted bovineamelogenins decreased as compared to the controls [46]. Thesestudies together with our present findings support the notion thatthe timely processing of amelogenin and possibly other enamelproteins by MMP-20 is important for the proper growthmorphology and maturational volumetric expansion of the enamelcrystals. We therefore suggest that step-wise processing of ame-logenin by MMP-20 determines the growth morphology of enamelcrystals. Whether the presence of occluded organic material oramorphous calcium phosphate (ACP) can affect the overall growthmorphology of enamel crystals is a subject left for future investi-gation. However, the presence of organic material occluded in theenamel crystal lattice may affect the crystallinity and the latticeperiodicity [10e12].

The crystal lattice patterns of the isolated WT and MMP-20 null

Fig. 5. Size and morphology of isolated enamel crystals (AeD: WT and EeH: MMP-20 null mice).A, E: TEM of isolated WT (A) and MMP-20 null (E) enamel crystals. Note thedifference in their length. B, F: SEM of enamel crystals isolated fromWT (B) and MMP-20 (F) null mice. The enamel crystals of MMP-20 null mice are more heterogeneous, smaller inlength and wider than those of the WT.C-D, G-H: Size distribution of isolated crystals fromWT (C-D) and MMP-20 null (G-H) mice enamel imaged by tapping mode AFM in air. Themajority of enamel crystals have a width ranging from 50 to 90 nm in WT mice whereas the MMP-20 null enamel crystals range between 60 and 120 nm in width. MMP-20 nullenamel is thinner, ranging between 10 and 30 nm, as compared to the WT, which is 20e40 nm in thickness.

S. Prajapati et al. / Biomaterials 75 (2016) 260e270266

enamel crystals were observed using HR-TEM (Fig. 6). In agreementwith our SEM study (Fig. 5), MMP-20 null enamel crystals (Fig. 6D)appeared shorter in length, thinner and more plate like than thoseof the WT (Fig. 6A). Panels 6B and 6E show higher-magnificationviews of individual crystals from WT and MMP-20 null mice,respectively. The insets in these panels show the diffraction patternof the highlighted region created by Digital Micrograph (DM)

2.30.542.0 software. Based on the 002 and 004 diffraction, thepatterns were typical of hydroxyapatite, as shown previously[44,47]. Panels 6C (10 � 10 nm2) and 6F (10 � 10 nm2) show high-resolution views of the highlighted areas in Fig. 6B and E, respec-tively. The WT enamel crystal (Fig. 6C) shows a pattern character-istic of HAP crystal lattice. A similar pattern can be observed in theenamel from MMP-20 null mice (Fig. 6F), but notably there is also

Fig. 6. HR-TEM of WT (A, B, C) and MMP-20 null (D, E, and F) isolated enamel crystals. Fig. 7A and B shows the length of the crystals in WT and MMP-20 null mice, respectively. FigsB and E show a single crystal at a higher resolution. The insets in these panels show the diffraction patterns of marked regions as obtained by Digital Micrograph software. Figs C andF are enlarged areas (10 � 10 nm2) of WT and MMP-20 null enamel crystals. The sudden loss of lattice pattern can be seen in the MMP-20 null crystals (area marked by dotted lines),indicating imperfections caused by the occlusion of enamel matrix proteins.

S. Prajapati et al. / Biomaterials 75 (2016) 260e270 267

an area showing an absence of the lattice pattern (highlighted bydotted lines). This is an example of the imperfections that arepresent throughout the HAP crystals in MMP-20 null mice.

WT Maturation Stage

WT Secretory Stage

MMP-20 Null Maturation Stage

MMP-20 Null Secretory Stage

12.0

12.5

13.0

13.5

14.0

14.5

15.0

15.5

FWH

M (c

m )

Fig. 7. Full width of half maximum (FWHM) of peak of totally symmetric stretchingmode (n1) of the tetrahedral PO4 at 960 cm�1. The crystallinity of WT enamel is higher(lower FWHM) than that of MMP-20 null enamel and the maturation-stage enamel ismore crystalline than the secretory-stage enamel in both groups.

3.3. The crystallinity of MMP-20 null enamel is affected

The full width of half maximum (FWHM) of the peak in totallysymmetric stretching mode (n1) of the tetrahedral PO4 at 960 cm�1

is used as a measure of crystallinity inside apatite crystals (Fig. 7).The lower FWHM shows that the WT enamel had higher crystal-linity than MMP-20 null enamel and that the maturation-stageenamel had higher crystallinity than the secretory stage enamelinboth WT and MMP-20 null mice.

HR-TEM images (Fig. 8AeD) show different types of defects inthe enamel crystals of MMP-20 null mice. The sudden loss of latticepattern in a single crystal is shown in Fig. 8A and B, as indicated bythe arrows.We interpret these lattice imperfections to be the resultof the presence of occluded enamel matrix proteins or the presenceof amorphous calcium phosphate, or both. Studies have shown thatthe enamel HAP crystals form through an intermediate stage of ACPand in vitro studies have demonstrated that the full-length ame-logenin stabilizes ACP and prevents its transformation into HAP[4,20,48]. Fig. 8C and D shows misalignment in the lattice intervalsin a single enamel crystal. Such misalignments could also be aresult of protein occlusion inside these crystals. These misalignedareas showed an absence of a diffraction pattern when a FourierTransform (FFT) was performed on a single crystal using DigitalMicrograph software. We calculated the areas of such imperfec-tions in the MMP-20 null mice and compared them to the areas ofimperfections in the WT mice. Remarkably, the MMP-20 null mice

showed imperfections covering 31% of the area, as compared to 10%in the WT mice, which is a statistically significant difference(Fig. 8E). The observation that full-length amelogenin M180 wasoccluded within the crystals in MMP-20 null mice (Fig. 2) supportsthe notion that both protein and ACP could coexist in the areas of

Fig. 8. Representative HR-TEM images (10 � 10 nm2) of imperfections found in MMP-20 null enamel demonstrating; A, B: complete absence of lattice pattern, marked by an arrow,in a single enamel crystal C, D: misalignments in lattice intervals. E: normalized areas of imperfections in the enamel crystals calculated from the HRTEM images (represented in 8A-D) in the MMP-20 null and WT mice. The MMP-20 null enamel crystals have almost 31% imperfections as compared to 10% in WT mice.

S. Prajapati et al. / Biomaterials 75 (2016) 260e270268

imperfections in the crystals (Fig. 8A&B).In vitro studies have shown that the full-length amelogenin

stabilizes calcium phosphate clusters and forms a metastable ACP-amelogenin complex which ultimately transforms into HAP [49].The presence of a transient ACP phase at early stages of enamelformation was also demonstrated by Beniash [20]. The interactionof the hydrophilic carboxyl-terminal in the full-length amelogeninwith calcium phosphate ions is important for the function ofamelogenin to interact with apatite crystal surfaces and stabilizingthe ACP phase. Therefore, it was hypothesized that cleavage of thisC-terminal may promote the phase transformation from ACP toapatite, which ultimately fuses together to form hard enamel [4].

Certain amino acids, like aspartic acid, adopt a b sheet structureafter binding to Ca2þ ions, which makes it easier for the protein tointeract with a certain phase of the crystal [41,50]. In the case ofamelogenin it was shown that certain regions of the protein adopt ab sheet structure when they come in contact with HAP crystals [51].This could result in the occlusion of full-length amelogenin withinthe crystal if not cleaved on time by the MMP-20. We have shownpreviously that the hydrophilic c-terminal of amelogenin interactsstrongly with apatite crystals [52]. The full-length amelogenin maybecome trapped inside the growing crystals because the proteinshave a tendency to adhere to the crystals [52]. In the absence ofMMP-20, full-length amelogenin is retained, which makes it easierfor the protein to become occluded within the enamel crystal.

Tao et al. also showed that during the transformation of ACP toHAP in the presence of glycine and glutamic acid, these amino acidswere expelled from the interior of the crystals [53]. Although it isnot yet clear whether this is the case in vivo, the notion that smallpeptides resulting from the degradation of enamel matrix proteinscould be expelled from the crystals duringmineralization cannot beeliminated, and the presence of amelogenin in MMP-20 null

enamel crystals as well as the absence of amelogenin in the WT(Fig. 2) strongly support this idea.

Previous studies have elucidated the roles of enzymes in bio-mineralization. In an in vivo study it was shown that alkalinephosphatase (ALP) plays a role in the initiation of mineralization byaiding the maturation of organic matrix protein during the shellformation of European abalone [54]. In vitro study demonstratedthat ALP mediated the mineralization of a peptide matrix in thepresence of b-glycerophosphate. It was further shown that ALPinduces mineral formation by hydrolyzing the heavily phosphory-latedmatrix and releasing phosphate ions [55]. In the present studywe propose a new function of enzymes in biomineralization and inparticular demonstrate that MMP-20 guides HAP formation duringamelogenesis by altering amelogenin biochemistry and hence itseffect on mineral formation.

Our systematic comparison of enamel crystals isolated fromWTand MMP-20 null mice may shed some light on the mechanisms ofenamel crystal formation at a molecular level. The presence of full-length amelogenin and crystal lattice defects in the maturation-stage enamel of MMP-20 null mice shows that the stepwisecleavage of the hydrophilic c-terminal of amelogenin is crucial tothe growth morphology and high crystallinity of enamel crystals.Another protease; KLK-4 which is secreted in the maturation stagein these mice is not able to compensate completely for the loss ofMMP-20, which shows that the initial processing of enamel matrixproteins by MMP-20 is a prerequisite for the complete degradationby KLK-4. The interplay between organic and inorganic moleculesin enamel formation is crucial to its unique structural and me-chanical properties [41]. We demonstrate that amelogenin pro-cessing by MMP-20 is crucial for complete mineralization of theenamel. An in vitro study showed that MMP-20 processing ofamelogenin accelerates mineralization and promotes crystal

S. Prajapati et al. / Biomaterials 75 (2016) 260e270 269

growth [56]. Therefore, in the case of MMP-20 null mice, theabsence of MMP-20 can inhibit the rate of mineralization, pre-venting the enamel crystals from maturing properly. Ameloblastinand enamelin are major non-amelogenins which are important forenamel formation. In our previous in vitro studies we have reportedthat cooperative interaction between the 32 kDa enamelin andamelogenin regulated the growth of octacalcium phosphate (OCP)crystals. The presence of enamelin also increased the aspect ratio ofthe OCP crystals [57,58]. The presence of enamelin or ameloblastinwas not analyzed in our study. However, we cannot rule out theirrole in enamel crystal formation and hence the possibility that theyare present in the areas of imperfections in the crystals along withamelogenins.

Because dental enamel does not regenerate itself, developingstrategies to mimic dental enamel is of significant importance forclinical applications. Several studies have attempted to growartificial enamel, which could be used to fill clinical defects orpathologies involving enamel. We have recently demonstratedthat a biomimetic amelogenin hydrogel could promote the for-mation of enamel-like co-aligned crystals [29]. The repairedenamel showed a remarkable improvement in its mechanicalproperties, though they were still not on par with natural enamel.Beniash et al. have reported that enamel from MMP-20 null micewas about 37% softer than normal enamel. The biggest differencein mineralization observed in that study between control andMMP-20 null mice was in mature enamel [27]. Our study providesan improved understanding of enamel HAP formation and the roleof MMP-20 in this process. It also shows that the degradation ofenamel matrix proteins in the secretory stage prevents occlusionof these proteins in the HAP crystals. Although we have been ableto “re-grow” enamel-like layers in vitro, in the future, we can usethe strategy of implementing proteinases, to mimic the naturalprocess and “re-grow” a biomimetic layer with improved me-chanical properties.

4. Conclusions

We used biochemical, spectroscopy and imaging techniques toprovide evidence that amelogenin was occluded inside the enamelcrystals isolated from MMP-20 null mice, resulting in theirabnormal size and morphology. The MMP-20 null enamel crystalswere smaller in size, wider and thinner in shape, and had moreareas of imperfections inside them when compared to those of theWT. The MMP-20 null mice had almost 4 times the protein asso-ciated with their enamel crystals than the WT. The occlusion ofamelogenin inside the MMP-20 null crystals decreased their crys-tallinity. All these findings support the notion that MMP-20 is acrucial enzyme during the process of amelogenesis that controlsthe HAP crystal formation by degrading the enamel matrix pro-teins, the absence of which affects the overall morphology andcrystallinity of enamel crystals. Our systematic approach tostudying the enamel secretory- and maturation-stage crystals canalso be used in other animal models in which enamel matrix pro-teins are missing or mutated. Our findings further elucidate themechanisms of enamel formation and contribute to the efforts ofdeveloping novel enamel biomimetic materials with improvedmechanical properties.

Acknowledgments

This research was supported by NIH-NIDCR R01 grants DE-13414 and DE-020099. SEM and TEM images were acquired at theCenter for Electron Microscopy and Microanalysis at the Universityof Southern California. AFM and Raman measurements were per-formed at Pacific Northwest National Laboratory, which is operated

by Battelle for the U.S. Department of energy under Contract DE-AC05- 76RL01830. We would also like to thank Lianna Damargi forher help with the mouse dissection and sample preparations.

References

[1] H.A. Lowenstam, S. Weiner, On Mineralization, Oxford University Press, NewYork, 1989.

[2] H. Gao, et al., Materials become insensitive to flaws at nanoscale: lessons fromnature, Proc. Natl. Acad. Sci. U. S. A. 100 (10) (2003) 5597e5600.

[3] L. Addadi, S. Weiner, Interactions between acidic proteins and crystals: ste-reochemical requirements in biomineralization, Proc. Natl. Acad. Sci. 82 (12)(1985) 4110e4114.

[4] S.Y. Kwak, et al., Regulation of calcium phosphate formation by amelogeninsunder physiological conditions, Eur. J. Oral Sci. 119 (Suppl. 1) (2011) 103e111.

[5] S.R. Qiu, et al., Molecular modulation of calcium oxalate crystallization byosteopontin and citrate, Proc. Natl. Acad. Sci. U. S. A. 101 (7) (2004)1811e1815.

[6] C.A. Orme, et al., Formation of chiral morphologies through selective bindingof amino acids to calcite surface steps, Nature 411 (6839) (2001) 775e779.

[7] H.H. Teng, et al., Thermodynamics of calcite growth: baseline for under-standing biomineral formation, Science 282 (5389) (1998) 724e727.

[8] J.J. De Yoreo, A. Wierzbicki, P.M. Dove, New insights into mechanisms ofbiomolecular control on growth of inorganic crystals, CrystEngComm 9 (12)(2007) 1144e1152.

[9] A. Herman, L. Addadi, S. Weiner, Interactions of sea-urchin skeleton macro-molecules with growing calcite crystals: a study of intracrystalline proteins,Nature 331 (6156) (1988) 546e548.

[10] S. Weiner, L. Addadi, H.D. Wagner, Materials design in biology, Mater. Sci. Eng.C 11 (1) (2000) 1e8.

[11] J. Aizenberg, et al., Control of macromolecule distribution within syntheticand biogenic single calcite crystals, J. Am. Chem. Soc. 119 (5) (1997) 881e886.

[12] A. Berman, et al., Intercalation of sea urchin proteins in calcite: study of acrystalline composite material, Science 250 (4981) (1990) 664e667.

[13] M. Mina, E.J. Kollar, The induction of odontogenesis in non-dental mesen-chyme combined with early murine mandibular arch epithelium, Arch. OralBiol. 32 (2) (1987) 123e127.

[14] I. Thesleff, et al., Epithelial-mesenchymal signaling during tooth development,Connect. Tissue Res. 32 (1e4) (1995) 9e15.

[15] J. Elliott, Structure, crystal chemistry and density of enamel apatites, in:D.J. Chadwick, G. Cardew (Eds.), Dental Enamel; Ciba Foundation, first ed.,John Wiley & Sons Ltd, 1997, pp. 54e66.

[16] D.F. Travis, M.J. Glimcher, The structure and organization of, and the relationship between the organic matrix and the inorganic crystals of embryonicbovine enamel, J. Cell Biol. 23 (1964) 447e497.

[17] H.J. Orams, An examination of the prism core, prism sheath and interprismaticsubstance using the electon microscope, Aust. Dent. J. 11 (2) (1966) 93e104.

[18] J. Bartlett, J. Simmer, Proteinases in developing dental enamel, Crit. Rev. OralBiol. Med. 10 (4) (1999) 425e441.

[19] J. Simmer, A. Fincham, Molecular mechanisms of dental enamel formation,Crit. Rev. Oral Biol. Med. 6 (2) (1995) 84e108.

[20] E. Beniash, et al., Transient amorphous calcium phosphate in forming enamel,J. Struct. Biol. 166 (2) (2009) 133e143.

[21] E. Llano, et al., Identification and structural and functional characterization ofhuman enamelysin (MMP-20), Biochemistry 36 (49) (1997) 15101e15108.

[22] T. Nagano, et al., Mmp-20 and Klk4 cleavage site preferences for amelogeninsequences, J. Dent. Res. 88 (9) (2009) 823e828.

[23] J. Moradian-Oldak, et al., Controlled proteolysis of amelogenins revealsexposure of both carboxy- and amino-terminal regions, Biopolymers 58 (7)(2001) 606e616.

[24] J.W. Kim, et al., MMP-20 mutation in autosomal recessive pigmented hypo-maturation amelogenesis imperfecta, J. Med. Genet. 42 (3) (2005) 271e275.

[25] H.C. Chan, et al., Target gene analyses of 39 amelogenesis imperfecta kindreds,Eur. J. Oral Sci. 119 (Suppl. 1) (2011) 311e323.

[26] J.J. Caterina, et al., Enamelysin (matrix metalloproteinase 20)-deficient micedisplay an amelogenesis imperfecta phenotype, J. Biol. Chem. 277 (51) (2002)49598e49604.

[27] J.D. Bartlett, et al., Decreased mineral content in MMP-20 null mouse enamelis prominent during the maturation stage, J. Dent. Res. 83 (12) (2004)909e913.

[28] K.M. Bromley, et al., Amelogenin processing by MMP-20 prevents proteinocclusion inside calcite crystals, Cryst. growth & Des. 12 (10) (2012)4897e4905.

[29] Q. Ruan, et al., An amelogeninechitosan matrix promotes assembly of anenamel-like layer with a dense interface, Acta Biomater. 9 (7) (2013)7289e7297.

[30] S. Habelitz, Materials engineering by Ameloblasts, J. Dent. Res. 94 (6) (2015)759e767.

[31] V. Uskokovic, W. Li, S. Habelitz, Biomimetic precipitation of uniaxially growncalcium phosphate crystals from full-length human amelogenin sols, J. BionicEng. 8 (2) (2011) 114e121.

[32] Q. Ruan, J. Moradian-Oldak, Development of amelogenin-chitosan hydrogelfor in vitro enamel regrowth with a dense interface, J. Vis. Exp. 89 (2014).

S. Prajapati et al. / Biomaterials 75 (2016) 260e270270

[33] J. Moradian-Oldak, et al., Self-Assembly Properties of Recombinant Engi-neered Amelogenin Proteins Analyzed by Dynamic Light Scattering andAtomic Force Microscopy, J. Struct. Biol. 131 (1) (2000) 27e37.

[34] J.P. Simmer, et al., Isolation and characterization of a mouse amelogeninexpressed in Escherichia coli, Calcif. Tissue Int. 54 (4) (1994) 312e319.

[35] B. Wopenka, J.D. Pasteris, A mineralogical perspective on the apatite in bone,Mater. Sci. Eng. C 25 (2) (2005) 131e143.

[36] C.E. Smith, et al., Relationships between protein and mineral during enameldevelopment in normal and genetically altered mice, Eur. J. Oral Sci. 119 (s1)(2011) 125e135.

[37] Y. Yamakoshi, et al., Enamel proteins and proteases in Mmp20 and Klk4 nulland double-null mice, Eur. J. Oral Sci. 119 (s1) (2011) 206e216.

[38] C. Robinson, et al., Dental enamel-a biological ceramic: regular substructuresin enamel hydroxyapatite crystals revealed by atomic force microscopy,J. Mater. Chem. 14 (14) (2004) 2242e2248.

[39] M. Rief, et al., Single molecule force spectroscopy on polysaccharides byatomic force microscopy, Science 275 (5304) (1997) 1295e1297.

[40] J. Tao, et al., Energetic basis for the molecular-scale organization of bone.Proceedings of the National Academy of Sciences 112 (2) (2015) 326e331.

[41] F.C. Meldrum, H. C€olfen, Controlling Mineral Morphologies and Structures inBiological and Synthetic Systems, Chem. Rev. 108 (11) (2008) 4332e4432.

[42] S.Y. Kwak, et al., Role of 20-kDa amelogenin (P148) phosphorylation in cal-cium phosphate formation in vitro, J. Biol. Chem. 284 (28) (2009)18972e18979.

[43] L. Wang, G.H. Nancollas, Calcium orthophosphates: crystallization anddissolution, Chem. Rev. 108 (11) (2008) 4628e4669.

[44] H. Warshawsky, Response to the critical comments on the article entitled“organization of crystals in enamel”, Anat. Rec. 224 (2) (1989) 264.

[45] C. Robinson, et al., Control of crystal growth during enamel maturation,Connect. Tissue Res. 22 (1e4) (1989) 139e145.

[46] M. Iijima, J. Moradian-Oldak, Control of octacalcium phosphate and apatitecrystal growth by amelogenin matrices, J. Mater. Chem. 14 (14) (2004)

2189e2199.[47] B. Kerebel, G. Daculsi, L.M. Kerebel, Ultrastructural studies of enamel crys-

tallites, J. Dent. Res. 58 (Spec Issue B) (1979) 844e851.[48] E. Beniash, J.P. Simmer, H.C. Margolis, The effect of recombinant mouse

amelogenins on the formation and organization of hydroxyapatite crystalsin vitro, J. Struct. Biol. 149 (2) (2005) 182e190.

[49] X. Yang, et al., How amelogenin orchestrates the organization of hierarchicalelongated microstructures of apatite, J. Phys. Chem. B 114 (6) (2010)2293e2300.

[50] S. Weiner, L. Hood, Soluble protein of the organic matrix of mollusk shells: apotential template for shell formation, Science 190 (4218) (1975) 987e989.

[51] J.X. Lu, et al., Mineral association changes the secondary structure and dy-namics of murine amelogenin, J. Dent. Res. 92 (11) (2013) 1000e1004.

[52] J. Moradian-Oldak, et al., Analysis of self-assembly and apatite bindingproperties of amelogenin proteins lacking the hydrophilic C-terminal, MatrixBiol. 21 (2) (2002) 197e205.

[53] J. Tao, et al., Roles of amorphous calcium phosphate and biological additives inthe assembly of hydroxyapatite nanoparticles, J. Phys. Chem. B 111 (47)(2007) 13410e13418.

[54] B. Gaume, et al., Biomineralization markers during early shell formation in theEuropean abalone Haliotis tuberculata, Linnaeus, Mar. Biol. 158 (2) (2011)341e353.

[55] E.D. Spoerke, S.G. Anthony, S.I. Stupp, Enzyme directed templating of artificialbone mineral, Adv. Mater. 21 (4) (2009) 425e430.

[56] V. Uskokovi�c, et al., Hydrolysis of amelogenin by matrix metalloprotease-20accelerates mineralization in vitro, Arch. Oral Biol. 56 (12) (2011) 1548e1559.

[57] M. Iijima, et al., Tooth enamel proteins enamelin and amelogenin cooperate toregulate the growth morphology of octacalcium phosphate crystals, Cryst.Growth & Des. 10 (11) (2010) 4815e4822.

[58] D. Fan, et al., The cooperation of enamelin and amelogenin in controllingoctacalcium phosphate crystal morphology, Cells Tissues Organs 194 (2e4)(2011) 194e198.