mcb 104 - quiz 2 combined answer key

7/24/2019 MCB 104 - Quiz 2 Combined Answer Key

1/6

MCB 104 Quiz 2 combined answer key (Different sections had different questions.)

Lecture 13:

1) During a river boat trip on the Amazon river, you encounter a small tribe of people that have

lived there for hundreds of years. Youre curious how isolated theyve been from other tribes in

the area, and decided to take a whole genome sequencing approach to identify unique

polymorphisms to their tribe. (Note that all sequences in the following problem are oriented 5 ->

3 and are from the same strand).

(A) Assemble the following reads from the Amazonian tribe genome project into a

contig.

There must be at least 5 bases that match in order for two reads to be considered

overlapping. Order the given reads into a contig, and list the read numbers in order (for

example, #5 -> #6 -> #7). (2pts)[3 -> 1 -> 2]

Read #1: GATGCTCGCCGTAGGAGACG

Read #2: GGAGACGTTCAGCGATCCTG

Read #3: CACGACAATCGGGCGATGCT

(B) In addition to the contig you found in A (Contig A), you also obtain two more

contigs:

Contig B: TTGCGAGTCAAGCGTTCACGACAATCGCCCGATC

Contig C: TCGAATTCGATTAGGGCGATTCCGTTAGATTCCCA

Now you would like to assemble all three into scaffolds, so you use additional paired-end

reads which span the contigs, shown below:

Paired-end read #1: TCCTGGAATCG.....Gap.....CGCATTCGAATT

Paired-end read #2:GCCCGATCCTG.....Gap.....ACCCACGACAA

Using the information above from the paired-end sequencing, assemble the three contigsinto scaffolds. List the contigs in order (for example, G -> E -> F), and indicate which

paired-end read connects which contigs. (4pts) [ B -> PE#2 -> A -> PE#1 -> C]

2) You have three DNA fragments that are 100bp long. You did paired-end sequencing and

below is the result

Fragment1: ACGCTCGTTATGCTA------------------------------------GCGTTATGTCGATTC

Fragment2: GAGGCGTTACGTCAA------------------------------------AGTCTATTGGCTAAA

Fragment3: TATTGGCTAAATCGA------------------------------------ATAGGACGCTCGTTA

You overlapped these results and discovered that the fragments partially overlap:___________________________ Fragment 1

___________________________ Fragment (i)

___________________________ Fragment (ii)

a) What is fragment (i) and fragment (ii)? [2p]

Fragment (i) = Fragment 3

Fragment (ii) = Fragment 2


2/6


b) How many contigs and gaps does this scaffold have? For this question, consider

single reads with no overlap as contigs. (2pts)

Contigs: 4, Gaps: 3

c) What is the total length of the scaffold? Show your work. (2pts)

100+100+100-11-10 = 279bp

3) Restriction enzymes cut DNA into fragments according to sequence. The restriction enzyme

HpyCH4V cleaves at sequences TG^CA (^ indicates where the cleaving occurs). How many

times does HpyCH4V cleave the following sequence? Please circle or underline the restriction

enzyme sites in the following sequence [6 points]

agtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaa

ggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccatacca

aacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagctt

cccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttat

tgctgataaatctggagccggtgagcgtgggtctcgcggtatcat

tgca

gcactgg

4) You do your paired-end sequencing of all the fragments for a whole-genome sequencing

project, but your computer file becomes corrupted. The reads are intact, but you no longer know

which reads correspond to which fragment - all the pairing (paired end) data is lost.

a. 2 pt Will you be able to assemble contigs with your remaining data? Why or why

not?

Yes, you still have reads and can overlap them to form a contig

b. 2 pt Will you be able to make scaffolds? Why or why not?

Nothing larger than a contig - you dont have the paired end data that linkscontigs together anymore

c. 2 pt. The computer technicians are able to recover additional sequence reads that

you didnt know were missing from that file, but they still lack pairing

information. Some of these new reads partially overlap with two

non-overlapping reads that you had before. How does this affect your answers to a

and b?

Youll be able to make longer contigs, but still no scaffolds

Lecture 14, Monday lecture:5) After completing the sequencing of the Ornithorhynchus anatinus (duck-billed platypus)

genome, you next want to know what portions of the platypus genome are transcribed. To find

transcribed genes within the genome, you purify mRNAs from three different tissue types (brain,

blood, and liver). You then synthesize cDNA from this mRNA as was covered in lecture, make a

cDNA library from each tissue, then sequence the end of every clone. Your initial sequencing

reveals three highly expressed platypus genes, which you name S, B, and M. You find cDNAs


3/6


from gene S in every tissue, but only find cDNAs from gene B in brain tissue and cDNAs from

gene M in blood.

(A) Why do you not find cDNAs from genes B and M in every tissue you sampled from?

(3pts)because gene B is only expressed in the brain/has a brain-specific

promoter/enhancers/cis-regulatory elements, and gene M is only expressed in the

blood/has a blood-specific promoter/enhancers/cis-regulatory elements

(B) It turns out that cDNAs of gene S derived from brain tissue have exons that are not

present in the cDNAs of gene S from the blood or liver libraries. How could you explain

this tissue-specific difference in what exons are present in the gene S cDNAs? (3pts)

splicing differences between tissues

6) Youve decided to undertake a transcriptome analysis (studying of all the mRNAs expressed

in a cell) of brain and heart tissue, focusing on mRNAs encoding components of voltage-gated

calcium channels.

A. (1 pt) Which enzyme would you use to convert your RNAs to the corresponding cDNAs?

reverse transcriptase

B. (2 pts) If the same voltage-gated calcium channel genes are expressed in both brain and

heart, before you collect sequence data can you predict how much cDNA from each gene

will be found in brain versus heart tissue? Why or why not?

no, because even if the same genes are transcribed, the relative number of RNAs could

vary between tissue types

C. (3 pts) You discover that in both the brain and heart, there are moreunique types of

cDNAs (unique type meaning different sets of genomic sequences present in the cDNA)corresponding to voltage-gated calcium channels than there are genes. What is a possible

explanation for this discrepancy? How does this explanation account for the discrepancy?

alternative splicing (different exons being included/excluded in the final mRNA) leads to

multiple RNA types derived from the same gene

7) Youve discovered a new type of butterfly that looks very similar to the monarch butterfly.

Since they look so similar, you reason they might share some genetic features. Here is an

example sequence from genomic DNA and cDNA from both butterflies:

New butterfly:genomic DNA ATGCAGGAGCATAAATTCCGCAATTGGATTAGGATGCCCAGTATT-

cDNA ATGCAGGAGCAT TGGATTAGG

Monarch butterfly:

genomic DNA ATGCAGGAGCATCCATGAGACAATTGGATTAGGTACTTAAGTATT-

cDNA ATGCAGGAGCAT TGGATTAGC

A. (2 pts) Circle the introns and draw boxes around the exons in the genomic DNA


4/6


regions that are present also in the cDNA are exons, regions that are not also

present in the cDNA are introns

B. (2 pts) If this genomic region from the new butterfly was the most similar in

sequence to this genomic region from monarch butterflies (and vice versa), what

word would you use to describe the relationship between these two genes?

orthologs

C. (2 pts) There is a polymorphism in one of the exons. What kind of polymorphism

is it? A SNP (single nucleotide polymorphism) or single base substitution

8) mRNAs can not be sequenced directly by dideoxy (Sanger) sequencing.

a. To make cDNA from mRNA, what one kind of nucleic acid do you need (in addition

to the mRNA) and what one enzyme would you need to synthesize the cDNA? (2pts)

A primer (or oligonucleotide or poly-T primer) , and reverse transcriptase

b. (2 pt) If you put a cDNA into a plasmid and sequenced both ends, what type of reads

would you generate?

5 and 3 EST reads

c. (2 pts) Aside from learning regions of the genome where transcription occurs, what

else can you learn from comparing individual EST sequences to the genomic sequence in

cases where one EST read aligns perfectly to two blocks of genomic sequence?

location of introns/exons

Lecture 15: Wednesday lecture:

9) Some paternity tests, which test whether someone is the father of a particular child, work by

genotyping a large collection of SNPs from both the potential father and the child.a. On average, what percent of genome-wide SNPs on autosomes (non-sex chromosomes)

would be identical between a parent and their offspring, and why? [3p]

50%. Because a child inherits half of their chromosomes from each parent, you would

expect on average 50% of genome-wide genotypes to be identical.

b) Why would you want to genotype multiple SNPs in a paternity test, and not just a

single SNP? [3p]

It would be way too easy for a single SNP to be the same between two individuals just

by chance or from distant relatedness

10) You are given the DNA sequence at the same locus for a few individuals:

Person A GGCCGCGTGCCCAGGGTATATTTGGTCAGTATGGAATGGACT

Person B GGCCGCGTGCCCACGGTATATTTGGTCAGTATCGAATGGACT

Person C GGCCGCGTCCCCACGGTATATTAGGTCAGTATGGAATGGACT


5/6


Person 1 GGCCGCGTGCCCACGGTATATTTGGTCAGTATCGAATGGACT

Person 2 GGCCGCGTGCCCAGGGTATATTTGGTCAGTATGGAATGGACT

a. (2 points) Rank individuals A, B, and C in order of how closely they are related to Person

1, based on the above sequences.Person B is most closely related, then Person A, then Person C

b. (2 points) Rank individuals A, B, and C in order of how closely they are related to Person

2, based on the above sequences.

Person A is most closely related, then Person B, then Person C

c. (2 points) What do we call the bolded regions? How did you use them to answer parts a

and b?

SNPs, more closely related individuals share more SNPs

Lecture 16: Friday lecture:

11) Transposable elements (indicated by the arrows over yellow segments below) can cause

deletions. Using the following diagram, draw the products (2 points each) and the crossover

intermediate (2 points) from the aberrant recombination. Either single-stranded crossover ->

deletion, or two-stranded crossover -> deletion + duplication

12) Nonallelic homologous recombination occurs at two regions of homologous sequence that

arent at allelic positions.

a. (2 pt) If the homologous sequences are on the same direction on the same strand, what

outcome do you expect? What is/are the product(s)?

deletion plasmid with deleted sequence, chromosome missing deleted sequence

b. (2 pt) If the homologous sequences are in the opposite direction on the same strand, what

outcome do you expect? What is/are the product(s)?

inversion the sequence in between will be backwards (inverted)

c. (2 pt) What result do you expect from nonallelic homologous recombination between two

strands?

deletion and a duplication

13)


6/6


The above diagram shows some parts of two homologous chromosomes. The sequences i) and ii)

are identical. What are the two non-allelic crossing over events that could occur in these

chromosomes? Draw the events specifically. [3pts per event]

Deletion (crossing over within one chromosome or between two chromosomes)

Duplication (crossing over between two chromosomes)

See slides for diagrams of crossing-over events

mcb 104 - quiz 2 combined answer key

Documents