md schulz et al. nature 000 , 1-5 (2014) doi:10.1038/nature13398

1

MD Schulz et al. Nature 000, 1-5 (2014) doi:10.1038/nature13398 Butyrate supplementation, but not prebiotics, confers protection against HFD-induced tumorigenesis.

Upload: derek-lloyd

Post on 31-Dec-2015

49 views

Category:

Documents

4 download

Report

Download

Embed Size (px):

DESCRIPTION

Butyrate supplementation, but not prebiotics, confers protection against HFD-induced tumorigenesis. MD Schulz et al. Nature 000 , 1-5 (2014) doi:10.1038/nature13398. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: MD Schulz et al. Nature 000 , 1-5 (2014) doi:10.1038/nature13398

MD Schulz et al. Nature 000, 1-5 (2014) doi:10.1038/nature13398

Butyrate supplementation, but not prebiotics, confers protectionagainst HFD-induced tumorigenesis.

doi:10.1038/nature12886 Neanderthal from the Altai

doi:10.1038/nature06481 LETTERS

1 November 2007 doi:10.1038/nature06221 LETTERS

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

GI Motility online (May 2006) | doi:10.1038/gimo48

doi:10.1038/nature05202 LETTERS

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

17 September 2009 doi:10.1038/nature08355 LETTERS

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

doi:10.1038/nature05150 LETTERS

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

GI Motility online (May 2006) | doi:10.1038/gimo12

GI Motility online (May 2006) | doi:10.1038/gimo31

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

GI Motility online (May 2006) | doi:10.1038/gimo46

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo6

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

Nature Structural & Molecular Biology: doi:10.1038/nsmb Structural & Molecular Biology: doi:10.1038/nsmb.3120. reduction in the pocket volume, we combine the volumes from the closed

TJ Schulz et al. Nature 000 , 1-5 (2013) doi:10.1038/nature 11943

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Nature Biotechnology: doi:10.1038/nbt

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385