med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · web viewlist the muscles of...
TRANSCRIPT
![Page 1: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/1.jpg)
ANATOMYComplete Exams
May 20101. Classify synovial uniaxial joints .Mention the axis, movements&two examples
for each. (10 marks)2. Describe the superficial veins of the upper limb. (5 marks)3. Give the distribution of the ulnar nerve to the hand .Predict the deformity
produced by its lesion at the wrist. (5 marks)4. Enumerate the structures passing through the great sciatic foramen. (5 marks)5. Mention movements occurring at the knee joint. Name muscles producing these
movements and their nerve supply. (5 marks)6. List beginning ,end and branches of descending thoracic aorta. (7 marks)7. Give surface anatomy of the valves of the heart and their auscultatory areas.
(8 marks)8. Describe fate of bulbus cordis. (5 marks)9. Describe formation &fate of connecting stalk. (5 marks)
Case 1A 65 years old woman slips on the floor and falls. She complains of pain in her left hip and cannot stand up. She is taken to the hospital and she is recommended that she has a total hip replacement involving removal of the femoral head and replacing it with a prosthesis. The surgeon indicates that this procedure is necessary because of the interruption of the predominant blood supply to the head of femur. Questions : 1. Enumerate the arteries supplying the hip joint . (2 marks) 2. Which blood vessel gives rise to a branch that is the major source of blood
supply to the head of femur? (1 mark)3. In which direction the is commonly dislocated ? which nerve is liable to be
injured in such dislocation ? (2 marks )
Case 2A 45 years old mother& father brought their 6 months old girl to the doctor for check up. The doctor looked at the baby's face and palm, then asked for karyotyping (chromosomal pattern). The karyotype proved that the baby was Down's syndrome (mongolism)Questions : 1. Write the chromosomal formula for Down's syndrome ? (1 mark ) 2. What features in the face attracted the doctor's attention, and made him asked
for a karyotype ? (1 mark )
3. Name other congenital anomalies with abnormal chromosomal pattern. (2 marks)
4. list another factor that could cause congenital malformations apart from genetic factor. (1 mark)
![Page 2: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/2.jpg)
Case 3A 45 years housewife complains of burning sensation in her hand that started 3 weeks ago. the surgeon diagnosis was carpal tunnel syndrome Questions : 1. Define carpal tunnel.
(2 marks) 2. Which nerve is compressed in the carpal tunnel? (1 mark) 3. List the muscles that could be affected by this nerve compression. (2 marks)
Case 4 A football player received a strong kick to his knee, he felt sever pain and was transferred to hospital. The doctor diagnosed him as having an injured meniscus.Questions :1. Which meniscus is likely to be injured and why? (2 marks ) 2. What are the functions of the meniscus ? (1 mark ) 3. Enumerate the arteries supplying the knee joint. (2 marks)
May 2011Case 1: During recovery from anesthesia, the patient vomited and the material was aspirated in the trachea: A. The aspirated material would settle in which lung? (1 mark) Explain why?
(1 mark) B. Enumerate the bronchopulmonary segments of the superior lobe of the left lung
(3marks) Case 2: During a street fight, one victim was carried to the hospital with a stab wound in the lower neck. He was diagnosed to have pneumothorax: A. Explain the occurrence of pneumothorax although the wound was in the neck
(2 marks) B. Compare the nerve supply of the parietal and visceral pleura (3 marks)
Case 3:A 15-year-old boy presents to his doctor for a follow up visit after 2 months from a fracture to his humerus. On examination the doctor notices loss of contour of the right shoulder (flat shoulder): A. A. Which nerve was injured? (1 mark) & its root value (1 mark) B. B. Which part of the humerus was probably fractured? (1 mark) C. C. Name two muscles supplied by this nerve (2 marks) D. D. Which movement is mostly affected by that nerve? (1 mark) E. E. Which arteries could be injured in such fracture? (1 mark)
Case 4:
![Page 3: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/3.jpg)
A 45-year-old woman came to the clinic with a hard painless mass in the upper outer quadrant of her right breast. Examination revealed enlarged axillary lymph nodes on the right side. Biopsy of the mass proved the presence of cancer breast:(A) Which lymph nodes are likely to be affected? (2 marks )(B) What is the arterial blood supply of the breast? (1.5 marks)A. Name 3 muscles related to the base of the breast. (1.5 marks)B. Could this cancer spread to the other breast? and why? (2 marks)
Case 5:A gas tank explodes during a medical school barbeque. A large piece of metal embeds itself in a student’s thigh up, medially and anteriorly. Severe bleeding from an artery was apparent. A. Which artery is most likely to be affected? (1 mark) B. Mention its medial and lateral relations (1 mark) C. Mention its beginning and end (2 marks) D. Which artery is the main supply to the thigh? (1 mark) E. Mention the arteries sharing in the cruciate anastomosis (2 marks)
Case 6:A 52-year-old man complained of difficulty in walking .The doctor noticed a lurching gait during walking .The pelvis sinks on the unsupported side when the patient stands on the affected limbA. Which muscles could be affected (2 marks)B. What is the nerve supply to these muscles,mention its root value? (2 mark)C. Name another muscle supplied by this nerve (1 mark)D. What is the difference between waddling & lurching gaits? (2 marks)E. Define portal circulation. (2 marks)F. Enumerate sites without lymphatics in human body. (2 marks)G. Follow the oxygenated blood from the placenta till it reaches the arch of aorta.
(2 marks)H. Enumerate the anomalies of the truncus arteriosus. (2 marks)I. Define decidua; name its parts (2 marks).J. Describe two umbilical cord anomalies that could affect the life of the foetus?
(2 marks)June 2012
Case 1.A police man presented to the doctor with large tortuous veins in his right leg .The doctor diagnosed varicose veins and advised him not to stand for long periods.1. Explain the occurrence of varicose veins in this patient? (2 marks)2. Give beginning, course and termination of the great saphenous vein. (3 marks)3. What is meant by perforating veins? (2 marks)Case 2:A 36 year old woman complained of a painless swelling in the groin. The doctor found a 3x3 cms. Mass situated below & lateral to the pubic tubercle on the front of left thigh.
![Page 4: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/4.jpg)
1. If this is a femoral hernia, is it common in males or females? Give reasons. (2 marks)
2. What are the boundaries of the femoral ring? (4 marks)3. Which structure would be in danger during surgical repair of this hernia?
(1 mark)4. What are the contents of the femoral canal? (2 marks)Case 3:A 32 year old diabetic woman delivered a large baby after a difficult labor in which the baby ,s head emerged ,but the shoulders were stuck requiring the doctor to supply some effort to free it up and complete the delivery. The baby appeared healthy buy his mother noted that the right arm was held in an abnormal position and was not moving as left arm.1. Name the clinical problem that affected the baby ,s right arm. (1 mark)2. Which nerve roots are probably affected? (1 mark)3. Name the deformity resulting from that injury? (1 mark)4. Explain the position taken by the affected arm? (1 mark)5. Can you locate the area of sensory loss in this condition? (1 mark)Case 4: A 52-year-old woman noted amass in medial of her left breast .the physician noticed that the mass was adherent to the underlying muscle .The surgeon removed the breast mass in addition to some lymph nodes . The pathologist confirms the diagnosis as breast cancer.1. Which lymph nodes are most likely to be affected? (1 mark)2. To which muscle was the mass attached? (1 mark)3. What could possibly be the skin changes in breast cancer? (1 mark)4. If after surgery the patient could not raise her arm to the level of head which
nerve could be injured? (1 mark)5. Could this cancer spread to the other breast? Why? (1 mark)Case 5: A 42-year-old male fell on his outstretched hand .The wrist was slightly swollen, and tender, but on deep palpation of the anatomical snuff box, he screamed from pain. The doctor suspected a fracture of scaphoid bone.1. What are the boundaries of the anatomical snuff box? (1.5 marks)2. Which artery, s pulse can be felt in the box? (1 mark)3. Name a vein and a nerve related to the roof of anatomical snuff box. (2 marks)4. Which other bone is present with the scaphoid in the floor of the anatomical
snuff box? (0.5 mark)Case 6:A 23-year-old male injured in an industrial explosion was found to have multiple small metal fragments in his thoracic cavity . The pericardium was cut inferiorly, the surgeon slid his fingers below the apex and upward and to the right within a sac of pericardium until they were stopped by reflection of pericardium near the base of the heart .1. His fingertips were in which sinus? (1 mark)
![Page 5: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/5.jpg)
2. Which structure is present anterior to the surgeon,s finger? (1 mark)3. Name a longitudinal structure present posterior to the surgeon,s finger?
(1 mark)4. Mention the nerve supply of the pericardium. (2 marks)
Case 7:A mother found her two year old boy playing with marbles. She counted the marbles &found one missing . after two dayes.the little boy developed fever & cough.Radiological imaging found marble settled in the lung1. Which the lung would the marble probably settle? (1 mark)2. Define bronchopulmonary segments? (1/2 mark)3. Name bronchopulmonary segments of the right lung? (2.5 marks)
Case 8:A 30 year old woman complained of severe pain in the lower abdomen with vomiting. She reported that her menstrual period was late. The patient was rushed for an abdominal ultrasound, which revealed no fetus or sac in the uterus, but her pregnancy test was positive. The patient underwent surgery and was found to have a ruptured fallopian tube caused by an ectopic pregnancy.1. Define ectopic pregnancy. (1 mark) 2. Locate other sites of ectopic pregnancy. (2 mark)
June 2013Case 1A 60 years old man had a shortness of breath, chest pain referring to tip of shoulder. He recommended an urgent chest X-ray showed an obliteration of the costo- diaphragmatic angle. The doctor ordered a thoracoscentesis1. What is thoracocentesis 1 mark2. Where is the best site for thoracocentesis 1 mark3. Explain the referred pain in this case? 1 markCase 2A twenty-eight year old man was driving home when he experienced sudden stabbing pain in his right pectoral and right lateral axillary regions. He began to feel out of breath and both his respiratory rate and heart rate increased dramatically. On examination, the doctor noted that the patient had no history of respiratory problems but was a heavy smoker. After viewing the chest radiograph, the doctor informed the patient that he had a spontaneous pneumothorax.1. Define pneumothorax? 1 mark2. What is the nerve supply of the pleura? 2 marks3. Mention the lung border (s) related to the pleural recesses. 2 marks
Case 3A 31-year-old woman had a blunt trauma to the lateral aspect of her right leg with an associated fracture of the neck of the fibula. She complains of decreased sensation in the anterolateral aspect of her leg down into the dorsum of foot. She also has foot drop with inability to dorsiflexion or evert her right foot.
![Page 6: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/6.jpg)
Questions:1. Damage to which major nerve is suggested in such injury? 1 mark 2. Explain the deformity and motor disability in this case. 3 marks3. Describe the sensory loss, if present in this case. 2 marks
Case 4:An old woman suddenly woke up in bed with severe pain in the left calf. The calf was very tender to touch and on placing her left on the ground, she felt further pain in her calf, there was a blue skin discoloration in the lower third of the leg alongside the Achilles tendon (tendon calcaneus).A diagnosis of torn muscle fibers in the left calf was made.1. Name the muscle (s) that could be injured. 1 mark2. Mention the arterial supply of the back of the leg. 2 marks3. The movements of the ankle joint are. 1 mark 4. Mention the distal attachment of tendocalcaneous 1 mark
Case 5:A middle age woman presented with difficulty in walking. When the doctor asked her to stand on the left foot her right hip tilted downwards1. Which nerve is injured in this patient? 1 mark 2. Which muscle (s) is supplied by this nerve? 1 mark3. Mention the action of this muscle 1 mark4. Mention 2 stabilizing factors of the hip joint 2 marks
Case 6:A young man was hit hard with a hockey stick in the midhumeral region of his left arm. He presented with swelling, deformity and abnormal movement of the left upper limb. The examination revealed an inability to extend the wrist (wrist drop) and digits. The radiological reports revealed fracture of the body of the humerus just distal to the midpoint. The proximal fragment was abducted.1. Determine which nerve was damaged? 1 mark 2. Which artery might have been torn in such case? 1 mark3. Why the proximal fragment was displaced in that manner? 1 mark4. Comment on the sensory defects in this person. 2 marksCase 7:A 52-year-old man was brought to the emergency room complaining of severe pain in the left arm. Physical examination suggested a broken humerus, which was confirmed radiologically. The patient was able to extend the forearm at the elbow, but supination appeared somewhat weak. Neurologic examination revealed an inability to extend the wrist (wrist drop).1. From the above features which nerve was affected? 1 mark2. Explain the observations that extension at the elbow appeared normal, but
supination of the forearm weak. 2 marks3. Explain the deformity of the wrist drop. 3 marks
Short Essay:
![Page 7: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/7.jpg)
1. Enumerate site of implantation. 2 marks2. Name the muscles extend & abduct the thumb. 2 marks3. Name the branches of the radial artery in the hand. 2 marks4. Mention the contents of the hilum of the lung. 2 marks5. Enumerate the tributaries of the coronary sinus 3 marks6. Boundaries of the adductor canal
June 2014Answer All questions – Please answer each question or case in a separate page and in the same order as they are listed below:Short essay questions (5 marks each):1. List muscles producing adduction and abduction of the wrist joint and their
nerve supply.2. Enumerate the branches of the profunda brachili artery.3. Discuss: The cutaneous innervations of the dorsum of the foot and toes.4. List the structures deep to the flexor retinaculum of the lower limb, from
medial to lateral.5. List the branches of the coronary arteries.6. Describe the function of the amniotic fluid.Cases (5 marks each):7. While performing clinical examination on a 50 year old lady, the clever final
year medical student discovered a swelling under the lady's right armpit. Upon inspection of the right breast, the student also noticed a patch of thickened skin with multiple dimples in it, together with retraction of the nipple. A diagnosis of breast cancer was later confirmed.a- What is the name of the observed skin change?b- What is the explanation of the dimples and the retracted nipple?c- Name three sources of artrerial blood supply to the breast?
8. Following a painful intramuscular injection the right buttock, the patient complained that this left hip dropped every time he lifted his left foot off the floor, but his pelvis remained level when he lifeted up his right foot.a- Whis nerve was punctured during the injection?b- What is its root value?c- Which muscles are affected?d- What is the name given to patient's gait?e- Where is the best location for administering intramuscular injections to avoid damaging any important structures?
9. A two year old girl filled her mouth with beads and suddenly developed continuous cough. Her mother suspected that she accidentally inhaled one of them in her airway and took her immediately to emergency hospital.a- To which lung would the bead go?b- Explain why.
August 2014 Answer All questions – Please answer each question or case in a separate page and in the same order as they are listed below:Short essay questions (5 marks each):
![Page 8: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/8.jpg)
1. Describe the boundaries of the anatomical snuff box and list the structures in it.2. List the branches of the brachial artery.3. Enumerate the contents of the popliteal fossa; mention how they enter and
leave.4. Discuss the medial longitudinal arch of the foot.5. List the structures that open into the right atrium.6. Mention five derivatives of the neural crests.Cases (5 Marks each)7. An old lady fell on her outstretched hand, dislocating her shoulder:
a- In which direction the joint is most likely dislocated? Explain why?b- Which nerve is most liable to injury? What is deformity that may result in such case?
8. While playing football, a young man injured his knee. He heard the doctor mentioning the term "unhappy triad".a- What does this term mean?b- Which meniscus is more liable to injury? Explain why?
9. A 40 year old man suffering from cough and left shoulder pain was sent to have a chest x-ray. The radiograph showed left pleural effusion and he was told that a thoracocentisis should be done:a- Explain the shoulder pain.b- Where would the doctor introduce the thoracocentisis needle?c- List the structures that will be pierced by the needle from superficial to deep.
Sept. 2015
Short essay questions (5 Marks each):1. List the muscles of the rotator cuff of shoulder and their nerve supply.2. Enumerate the branches of the brachial artery.3. Discuss the anatomy of the femoral canal, its function and its clinical
importance.4. List the arteries sharing in the anastomosis around the knee joint.5. Describe the venous drainage of the heart.6. Describe the development of the interatrial septum.Cases (5 marks each):7. After a difficult childbirth, the parents noticed that the newborn baby could not
abduct is are. In addition, the elbow was extended and the forearm pronated constantly.a- What is the name of this deformity?b- Where is the injury? Explain why?c- Which dermatomes would show sensory loss in such case?
8. A 40 year old male who used to wear high boots suffered tingling sensation on most of the dorsum of his foot together with weak eversion.a- Which nerve is most likely compressed?b- Name the other sensory nerves that supply the dorsum of foot.c- Which muscles are affected?
![Page 9: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/9.jpg)
9. A four-year-old girl was brought into the emergency room with severe cough and dyspnea after accidentally swallowing a small object while playing. X-ray confirmed aspiration of the object into the airway.a. To which lung would the object likely go?b. Explain why?c. In which lobe would the object settle?d. List the bronchopulmonary segements of that lobe.
PHYSIOLOGYComplete Exams
May 2010All the following questions are to be answered:1. a- Outline the different natural anti-clotting mechanisms
b- Enumerate the different types of T lymphocytes and mention the role of each in the immune response.
2. a- Define the chronaxie and mention the significance of it's measuring b- Compare and contrast between mechanisms of excitation-contraction
coupling in striated muscles and in smooth muscles.3. compare and contrast between the different types of cholinergic receptors,
regarding their sites, subtypes, structure, mechanism of action and drug acting. 4. mention the forms of Co2 transport in the blood , and describe the Co2 action
at the tissue capillaries. 5. define hypoxia, list its' types and define the causes of each, outline the
importence of O2 therapy . 6. Draw a normal electrocardiogram , label it's different waves , segments , and
intervals and relate each one to it's cause . Enumerate the ECG changes following coronary artery occlusion and clarify the cause of each
7. Discuss briefly the characteristics and the ionic bases of slow response action potential of the heart. Explain the effect of sympathetic stimulation on it.
8. Define the cardiac cycle and compare the different events occurring in the two isovolumetric phases of the cardiac cycle . explain the significance of each phase .
9. What's the relation between the cardiac output and the venous return ? Discuss the factors affecting the venous return to the heart.
10. Define the following pressures : arterial blood pressure , pulse pressure , and mean arterial pressure discuss long term regulation of arterial blood pressure
Biophysics Give an account on: vesicular transport reynold's number equation and it's relation to different types of blood flow. Biostatistics:
![Page 10: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/10.jpg)
Mention three functions of statistics in the medical field.
![Page 11: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/11.jpg)
May 2011All questions are to be answered :1. State factors affecting nerve conduction velocity.2. Describe mechanism of skeletal muscle relaxation.3. List types of autonomic ganglia and describe their functions. 4. Describe functions of thrombin .5. Define humoral immunity and state mechanisms of immunoglobulins action .6. Describe mechanics of quiet inspiration .7. Explain neural and local factors that control airway resistance .8. Name medullary and pontine respiratory centers . Explain role of medullary
centers in controlling respiration . 9. Enumerate characteristic that enable the sino-atrial node to be pacemaker of the
heart . Describe the factors affecting its firing rate .10. list functions of the atrio-ventricular node and outline different degrees of
atrio-ventricular heart block.11. list different phases of ventricular systole of the cardiac cycle .mention changes
of left ventricular and aortic pressures during these phases and their relation to the state of aortic valve .
12. Describe long lasting mechanisms of cardiac reserve and explain its limitations.13. Locate the site of arterial baroreceptors and explain its role in correction of the
drop in arterial blood pressure during acute hemorrhage .14. Outline factors that affect venous return to the heart .15. Describe the physiological characteristic of coronary circulation and explain
causes of death following myocardial infarction .
June 2012Answer the Following Questions :Section 1 :1. Describe saltatory conduction and mention its advantages (3 marks)2. Describe effect of long duration, moderate, moderate intensity exercise training
on the skeletal muscle fibers. (3 marks)3. Compare between the effects of sympathetic and parasympathetic stimulation
on the eye and on the salivary. (3 marks )4. Mention the sites of nicotinic receptors and the mechanism of their stimulation
(3 marks ) 5. Describe four functions of plasma protiens. (3 marks)6. Mention the type and the cause of anemia in gastric mucosal atrophy. (2 marks)7. Explain the role of B-lymphocytes in immunity. (2 marks)Section 2 : 8. A. Why blood velocity is slowest in the capillaries ? Mention the significance
of this. (3 marks )B . Describe charactersitic functions of the AV nodal conduction . (3 marks)
9. Draw a labeled diagram for a normal ECG and for a case of ventricular fibrillation and clarify why it is more serious arrhythmia than atrial fibrillation.
(6 marks)
![Page 12: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/12.jpg)
10. A. Describe jugular venous pulse and explain the cause of each wave. (3 marks)
B. Describe long lasting mechanisms of cardiac reserve. (3 marks)11. Discuss the role of arterial baroreceptors in blood pressure regulation.(6 marks)12. Explain the direct and the indirect effects sympathetic stimulation on the
coronary circulation . Descibe the effects of coronary artery insufficiency. (6 marks )
Section 3 : 13. Discuss functions of pulmonary surfactant . (5 marks) 14. During acclimatization to high altitude , the body increases both RBCs
formation and oxygen liberation to the tissues . Explain mechanisms underlying such changes. (5 marks)
15. Compare between peripheral and central chemoreceptors in regulating respiration. (5marks)
September 212 Answer the Following Questions : Section 1:1. Describe local potential and enumerate its characteristic features. (3 marks)2. Describe steps of cross bride cycle of skeletal muscle contraction. (3 marks)3. Mention factors responsible for the generalized actions of sympathetic
stimulation (3 marks)4. Give three examples for muscarinic action of acetylcholine. (3 marks) 5. Describe erythropoiesis and mention the factors needed for it. (3 marks)6. List four of the natural anticlotting mechanisms. Describe actions of protein C.
(2 marks)Section 2 : 7. Mention the ionic basis and the significance of :
a. prepotential of the slow response action potential of the heart. (3 marks)b. plateau of the fast response action potential of the heart. (3 marks)
8. A. Mention the cause of each wave of the ORS complex. State the significance of the QRS voltage and duration (3 marks)B. Describe ECG changes following coronary artery occlusion. (2 marks)
9. Describe with a labeled diagram the left ventricular pressure – volume loop. (6 marks)
10. Discuss heterometric regulation of the cardiac output (6 marks)11. List forces affecting tissue fluid formation. Explain how the alteration in the
these forces cause edema (6 marks)Section 3 : 12. Discuss dead space, mention its different types and out its significance.
(5 marks) 13. Explain the ventilator response to increased arterial PCO2. (5 marks)14. Define cyanosis , enumerate types of hypoxia that could be associated with
cyanosis and explain why it does not appear in very cold weather . (5 marks)
![Page 13: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/13.jpg)
June 2013Answer the Following Questions:1. a. Define resting membrane potential and explain its causes. (3 marks)
b. Mention the source and the role of calcium in skeletal muscle contraction.(3 marks)
c. List sites of acetylcholine release and mention type of receptors at each site.(3 marks)
2. a. Describethe mechanism of platelet plug formation and explain why it is limited to the site of vessel injury. (3 marks)b. Compare between anemia associated with gastric atrophy and that with chronic renal disease, concerning the cause and characters of red blood cells of each. (3 marks)
3.a. Describe effect of sympathetic stimulation on pacemaker potential of the heart. (3 marks)
b.Mention the significance of the long absolute refractory period of the fast response action potential of the heart. (3 marks)
4. Outline the conducting system of the heart. Describe briefly the three degrees of atrioventricular heart block and their ECG pictures. (6 marks)
5. Describe the changes in left ventricular pressure during isovolumetric phases of the cardiac cycle and mention the significance of these changes. (6 marks)
6. Define cardiac reserve and discuss its limitation. (6 marks)7. Describe short-term compensatory mechanisms in acute hemorrhage to correct
the drop in blood pressure. (6 marks)8. a. Explain the cause of the negativity of intrapleural pressure and mention its
importance. (5 marks)b. Compare factors that promote alveolar collapse with those keeping the alveoli open. (5 marks)
9. Draw a labeled diagram for oxygen-hemoglobin dissociation curve. Explain the significance of its steeper part. (5 marks)
10. An adult man was locked for some time in a room with reduced O2 level. State the effect on his respiration and the underlying mechanism of action. (5 marks)
June 2014Answer the following questions [65 marks):1. a- Define chronaxie and mention its significance. (3 marks)
b- Describe mechanism of skeletal muscle relaxation. (3 marks)2. Describe function of the autonomic ganglia. Explain why the adrenal medulla is
considered a modified sympathetic ganglion. (3 marks)3. a- List functions of plasma proteins. (3 marks)
b- Describe the functions of blood platelets. (3 marks)4. The heart acts as a functional syncytium. Explain this statement. (5 marks)5. a- Draw a labeled diagram for the slow response action potential of the heart.
Describe the effects of sympathetic and parasympathetic nerves stimulation. (6 marks).
![Page 14: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/14.jpg)
b- Describe the characteristics of the atrio-ventricular nodal conduction. Outline different types of heart block. (6 marks)
6. a- Describe ventricular pressure changes during different phases of the cardiac cycle. (6 marks)b- Describe the effect of the cardiac cycle on the coronary blood flow.(6 marks)
7. Discuss arterial baroreflex under normal arterial blood pressure and during hemorrhage. (6 marks)
8. Discuss mechanics of quiet breathing. (6 marks)9. Explain the ventilator response to mild and severe increase in arterial PCO2.
(5 marks)10. Define hypoxia. List its different types and mention the causes of each.
(5 marks) September 2014
Answer the following questions:Section 1:1. a- Give a brief account on exitability changes during action potential. (4 marks)
b- Explain molecular basis of skeletal muscle contraction. (4 marks)2. Compare nicotinic and muscarinic recptors as regards the site, subtypes,
agonists and antagonist. (4 marks)3. a- Outline the functions of the plasma proteins. (4 marks)
b- Discuss the immediate complications of incompatible blood transfusion. (4 marks)
Section 2:4. Compare fast and slow response cardiac muscle fibers as regards the location
and action potential of each. (6 marks)5. Describe ECG picture of:
a- Atrial flutter. (3 marks)b- Ventricular paroxysmal tachycardia. (3 marks)
6. a- Mention the changes in ventricular volume and pressure in the different phases of ventricular systole of cardiac cycle. (6 marks)b- Discuss heterometric regulation of the cardiac output. (6 marks)
7. Explain the ole of baroreceptor reflex in moment to moment regulation of arterial blood pressure. (6 marks)
8. Discuss factors affecting venous return to the heart. (5 marks)Section 3:9. Explain the importance of pulmonary surfactant. (5 marks)10. Describe oxygen-Hemoglobin dissociation curve and mention the physiologic
significance of different parts of the curve. (5 marks)September, 2015
Answer the following questions: 1.a- Compare and contrast between action potential and focal potential (4 marks).
b- Describe the role of calcium iorns in skeletal and smooth muscle contractions. (4 marks)
2.Compare between nicotinic and muscarinic receptors. (4 marks)3.a- What are the types of plasma proteins and mention their functions.(4 marks)
![Page 15: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/15.jpg)
b- Vitamin K is called anti-hemorrhagic factor. Explain this statement?(4 marks)
4. What are qualifying conditions that make the (SAN) the pacemaker of the heart? (5 marks)
5.a- Why the depolarization of the (SAN) and (AVN) is not recorded in the ECG?(2 marks)
b- Ventricular fibrillation is often initiated when a premature impulse arrives during the vulnerable period. Explain this statement? (4 marks)
6. Describe the left ventricular pressure changes during both the isovolumetric contraction and isovolumetric relaxation phases of the cardiac cycle and explain the significance of these changes. (6 marks)
7. Define cardiac output and describe its heterometric regulation. (6 marks)8. Discuss the role of arterial barorecepors in facing the increased arterial blood
pressure. (6 marks)9.Define circulatory shock and describe its types according to the cause.
(6 marks)10. a- Describe the mechanics of quiet breathing. (5 marks)
a-What are the medullary and pontine respiratory centers and describe the role of each. Where does the generation of respiratory rhythm take place.
(5 marks)
BiochemistryComplete Exams
May 2010Question 1:A. Define and give one biological importance for :B. Zymogens - Active transport- Electrophoresis- Km- DNA Replication.
(10 Marks) C. Physiological role and deficiency manifestations of vitamin C. (5 Marks) D. Maturation of mRNA (post transcriptional modification) (5 Marks)Question 2:A. Mention 3 points of comparison between apoenzyme and coenzyme. (6 Marks)B. Mention3 characteristics of:
a) Non-functional plasma enzymes. Give 2 examples (6 Marks)b) Competitive inhibition of enzymes. Give 2 examples.. (6 Marks)c) Summarize oligonucleotide excision repair of thymine dimer. (7 Marks)
Question 3:a. Enumerate 4 second messengers which mediate hormone action. (4 Marks) b. Show in a diagram the source of different carbon and nitrogen atoms In a
purine ring. (5 Marks)a. Explain how oxygen molecules bind normal hemoglobin. (6 Marks)Question 4:
![Page 16: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/16.jpg)
Give the reaction(s) required for each of the following conversions:1. IMP to AMP and GMP. (6 Marks)2. Ribose-5-P to Phosphoribosyl pyrophosphate (PRPP). (4 Marks)3. Heme to bilirubin. . (8 Marks)Question 5:A. Mention three examples for:
1. Branched chain amino acids. (3 Marks)2. Extracellular matrix proteins. (3 Marks)
B. Mention three functions of membrane proteins. (3 Marks)C. List three types of glycerol- containing phospholipids constituting
biological membranes. (3 Marks)May 2011
Answer all the following questions:1. A young boy had repeated bone fractures on minor traumas . His condition was
diagnosed as osteogenesis imperfecta.a. What is the molecular basis of this condition ? (1 mark)b. Illustrate the importance of vitamin C for normal collagen formation.
(4 marks) c. List the other major components of intercellular matrix ( = extracellular
matrix ). (3 marks) d. Draw a schematic with labels showing the structure of cell membrane.
(2 marks)2. An 18 years old student developed severe pallor with lowered capacity for
ordinary activity. Her history showed no abnormalities apart from heavy menstruations for the preceding one year. Her blood picture showed a microcytic hypochromic anemia.a. What nutrient does this patient need to treat her anemia? (1 mark)b. Illustrate the chemical reaction in hemoglobin synthesis in which this
nutrient is needed. (2 marks)c. Name other compounds that contain the same prosthetic group of
hemoglobin. (2 marks)d. List the normal excreted products of catabolism of this prosthetic group and
their routes of excretion. (2 marks )e. Describe the composition of the protein part of normal adult hemoglobin.
(2 marks )f. Give one example of point mutation that results in hemoglobinpathy.
( 1 mark )3. A patient was admitted to the hospital suffering from acute chest pain. His
condition was diagnosed as a thrombus in a coronary artery. He was given heparin and streptokinase injections.a. What is the elevated plasma enzyme that confirms this diagnosis? (1 mark)b. Explain the mechanism of action of streptokinase in this patient. (2 marks)c. illustrate the action of thrombin in developing this condition. (1 mark)b. (d) Explain the mechanism of action of heparin. (1 mark)
![Page 17: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/17.jpg)
4. A 40 years old man had a severe pain accompanying inflammation of a big toe joint. Laboratory investigations showed a high plasma uric acid concentration. After treating this acute condition, the patient was given a drug that inhibits the formation of uric acid from its immediate precursor.a. List the causes of hyperuricemia. (3 marks)b. Give the name of the enzyme inhibited by the prescribed drug and illustrate
the reaction it catalyzes. (3 marks)a. What food do you expect to contribute to a high plasma uric acid? (1 mark)
5. compare between prokaryotic DNA polymerase and RNA polymerase in a table demonstrating the points of difference between them. (4 marks)
6. A molecular biology scientist was conducting an experiment on insulin gene. He observed that insulin hormone was only produced when the insulin gene-associated histones were acetylated. a. What are histones? (1 mark )b. Explain the molecular basis of this observation. (3 marks )
7. An eighteen months child suffered from a tumor in her eye. She was diagnosed as a malignant tumor in the retina. Molecular analysis of the tumor revealed a deletion of a tumor suppressor gene.a. List two examples of tumor suppressor genes. (2 marks)b. Explain how deletion of one of these tumor suppressor genes leads to
development of this patient's tumor. (3 marks)September2011
Answer all the following questions (8 questions in two pages)1. Its advised to boil eggs for eating
a. Describe the physical and chemical changes in egg protein by boiling. (2 marks)
b. List the protein bonds that are affected and those not affected by boiling. (4 marks)
c. Why is boiling of eggs beneficial? (1 marks)2. Some medically used drugs act as enzyme inhibitors.
A. Give two examples with different mechanisms of enzyme inhibition. (4 marks)
B. Draw diagrams showing the effect of these drugs on enzyme kinetics. (2 marks)
3. A patient suffered from repeated intestinal colic. His condition was diagnosed as deficiency of intestinal enzymes that hydrolyze disaccharides. List the following in a table:A. Three major disaccharides. (1.5 mark)B. Their sources (1.5 mark)C. Their hydrolyzing enzymes. (1.5 marks)D.The products of their hydrolysis. (1.5 marks)
4. A patient suffered from recurrent joint pain with jaundice . His blood examination showed low hemoglobin concentration and sickle shaped red blood cells.A. Define the molecular cause of this disease (1 marks)
![Page 18: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/18.jpg)
B. Explain why red blood cells are sickle shaped in this patient (1 marks)C. Illustrate the hemoglobin electrophoresis pattern in this patient (2 marks)D. List the monomers of normal hemoglobin protein (2 marks)
5. A man with a family history of colon cancer suffered from abdominal discomfort with bloody stool. He was diagnosed as colon cancer (HNPCC)A. Define the DNA lesion in this patient . (1 marks)B. Describe the normal DNA repair system that corrects this DNA lesion.
(3 marks)6. AN infant suffered from severe respiratory tract infection. His lab tests
demonstrated a decrease in T cells , B cells and antibodies. His red blood cells completely lacked an essential enzyme in purine degradation pathway . A) Name the defiective enzyme in the patient . (1 mark)B) Outline the chemical reaction catalyzed by this enzyme . (2 marks)C) Explain how this enzyme defect affects DNA synthesis .
7. Molecular analysis of a malignant tumor revealed inhibition of the executive enzyme of apoptosis .A. Define apoptosis . (1mark)B. Name the executive enzymes of apoptosis . (1 mark) C. Describe how these enzyme are normaly activated by intrinsic pathway.
(3 mark)D. List the protiens that inhibit apoptosis. (1 mark)
8. A genetic testing of a patient indentified a mutation in a gene as shown below:
Normal 5`-……………………..GAA ………………………3`Patient 5`……………………….GUA ………………………3`
UUUUUC UUAUUGCUUCUCCUACUG
AUUAUCAUA AUG
GUUGUC GUAGUG
Phe
Leu
Leu
LleMet
Val
UCUUCCUCAUCGCCUCCCCCACCG
ACUACCACAACG
GCUGCCGCAGCG
ser
pro
thr
Ala
UAUUACUAAUAGCAUCACCAACAG
AAUAACAAAAAG
GAUGACGAAGAG
Tyr
stop
hisGln
Asn
Lys
Asp
Glu
UGUUGCUGAUGGCGUCGCCGACGG
AGUAGCAGAAGG
GGUGGCGGAGGG
Cys
StopTrp
Arg
SerArg
Gly
![Page 19: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/19.jpg)
June 20121. A forty-year-old man had repeated chest infection with abnormally distended
lungs (emphysema). His condition was attributed to deficiency of an important protein synthesized by the liver cells.a. Name this protein. (1 mark)b. Explain the biochemical basis of lung destruction in this case. (3 marks)c. List major proteins found in the tissue inter-cellular space. (3 marks)
2. A 40 - year - old woman developed obstruction of the common bile duct, with yellow discoloration of skin , A blood analysis was ordered . a. Name the blood analyte that causes this abnormal skin color. (1 mark)b. Outline the pathway for production of the analyte. (3 marks) c. What is the color of this patient’s urine? Why? (1.5 mark)d. What is the color of this patient’s stool? Why? (1.5 mark)
3. A patient was admitted to the coronary care unit with a thrombus in the coronary circulation. He was given heparin and streptokinase injections. a. Explain the mechanism of action of streptokinase in this patient. (2 marks)b. Explain the advantage of tissue plasminogen activator in this case.(2 marks)c. Explain the mechanism of action of heparin. (2 marks)
4. Explain the biochemical basis of the following : a. The catalytic efficiency of factor Xa is only maximized by its assembly in
prothrombinase complex on platelet membrane. (2 marks)b. 1gM may bind 10 molecules of the same antigen while 1gG binds only two.
(2 marks) c. Iron homeostasis is regulated at the level of intestinal absorption. (3 marks) d. Changing the PH of reaction mixture of an enzyme-catalyzed reaction
affects enzyme activity (2 marks)
5. Explain the molecular mechanism of the following : a. DNA pol I has 5` to 3` exonuclease activity while DNA pol III does not.
(2 marks)b. His tone acetylating stimulates gene transcription while DNA methylation
inhibits transcription . (3 marks)c. C) Aminoacyl - tRNA synthetase has proofreading activity. (2 marks)
6. A patient suffered from recurrent joint pain with jaundice. A genetic testing of this patient identified the mutation of the underlined base in his HbA beta chain gene in a homozygous state the nucleotide sequence of this patient in comparison to normal sequence are shown below : Normal nucleotide sequence 5- GAA CAU AAA UGU UAU UUU -3 Patient nucleotide sequence 5- GAA CAU AAA UGU UAU UUU -3
7. With the help of genetic code table provided above , answer the following: a. Write the amino acid sequence in this patient. Is it different from normal? b. Define mutation. c. What is the type of mutation in this case? d. Describe other types of mutation.
![Page 20: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/20.jpg)
e. Illustrate the hemoglobin electrophoresis pattern in this patient. f. Describe the shape of RBCs in this patient and explain why they have this
specific shape. g. What is the effect of this mutation on Hb normal function oxygen binding?
July 20131. Case 1 : A 30-year old woman was hosoitalized for repeated attacks of
venous thrombosis. Blood testing of this patient revealed circulating immunoglobulins against acisic phospholipids. The patient started dicumarol therapy. (20 marks)1. Illustrate the structure of phosphatidic acid. (1 mark) 2. Name 4 membrane phospholipids. (2 marks) 3. Describe how phospholipids are organized in a cell membrane. (3 marks) 4. Draw a diagram of basic immunoglobulin structure. (4 marks)5. Explain the biochemical mechanism of the Dicumarol drug in this patient.
(5 marks)6. Draw a diagram showing the effect of this drug on enzyme kinetics.
(4 marks)7. Suggest a biochemical explanation for repeated thrombosis attacks in this
patient. (1 mark)
Case 2: A 2-yearinfant was admitted to the hospital with severe pallor, difficulty in breathing and general weakness. Blood testing revealed severe anemia. He had a positive family history of thalessemia. A genetic testing of this patient identified the mutation of the underlined base in his HbA beta chain gene in a homozygous state. The nucleotide sequence of this patient in comparison to normal sequence are shown below. (12 marks)Normal nucleotide sequence 5'-GAA CAU AAA UGU UAU CGA-3'Patient nucleotide sequence 5'-GAA CAU AAA UGA UAU CGA-3'
With the help of genetic code table provided, answer the following:1. Write the amino acid sequence in this patient. Is this different from normal?
(2marks)2. Define mutation ? (1 mark)3. What is the type of mutation in this case ? (1 mark)4. What is the diagnosis of this infant ? (1 mark)5. Name other types of mutation which may produce the same disease in this
infant. (3 marks)6. Explain the biochemical basis of anemia in this child. (2 marks)7. Describe the composition of the protein part of normal adult hemoglobin.
(2 marks)
![Page 21: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/21.jpg)
Cys
StopTrp
UGUUGCUGAUGG
Tyr
Stop
UAUUACUAAUAG
SerUCUUACUCAUCG
Phe
Leu
UUUUUCUUAUUG
ArgCGUCGCCGACGG
His
Gin
CAUCACCAACAG
ProCCUCCCCCACCG
LeuCUUCUCCUACUG
Ser
Arg
AGUAGCAGAAGG
Asn
Lys
AAUAACAAAAAG
ThrACUACCACAACG
Ile
Met
AUUAUCAUAAUG
GlyGGUGGCGGAGGG
Asp
Glu
GAUGACGAAGAG
AlaGCUGCCGCAGCG
ValGUUGUCGUAGUG
Case 3: DNA testing of a malignant tumor revealed methylated promoter of p53 tumor suppressor gene in this tumor in a homozygous state. (8 marks)1. Define epigenetics. (1 mark)2. Explain how promoter methylation affect gene expression. (3 marks)3. What is the effect of methylated p53 on p21 gene expression. (1 mark)4. Explain how does this affect cell cycle progression. (3 marks)
Case 4: At age of 6 months a boy showed signs of slow motor development. Both urinary uric acid and serum urate were abnormally increased. Lesch-Nyhan syndrome was suspected. (5 marks)1. Name the enzyme defective in this case. (1 mark)2. Explain how this enzymatic defect led to excessive urate excretion. (4 marks)
September, 2015Answer all the following five questions:1. A 24 year old lady suffering from systemic lupus recently developed massive
proteinuria. Lab testing of this patient revealed antibodies against splicesomes.a- Describe the structure and function of spliceosomes. (4 marks)b- List the major plasma proteins in a normal person. (2 marks)c- Draw a diagram with lables showing the structure of a typical antibody
molecule. (2 marks)2. A young boy had repeated bone fractures on minor traumas. His condition was
diagnosed as osteogenesis imperfect.a- What is the molecular basis of this condition? (2 marks)b- Illustrate the importance of vitamin C for normal collagen formation.
(4 marks)c- List the other major components of intercellular matrix. (3 marks)
![Page 22: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/22.jpg)
3. It is advised to boil eggs for eating.a- Describe the chemical and physical changes in egg proteins by boiling.
(2 marks)b- List the protein bonds that are affected and those not affected by boiling.
(4 marks)c- Why is boiling of eggs beneficial? (2 marks)
4. Some medically used drugs act as enzyme inhibitors.a- Give medically used drugs act as enzyme inhibition. (4 marks)b- Draw diagrams showing the effect of these drugs on enzyme kinetics.
(4 marks)5. A child suffered from weakness, pallor, joint pain and jaundice. The nucleotide
sequence of hemoglobin beta chain mRNA of this patient in comparison to normal sequence is shown below:Normal nucleotide sequence 5'-GAG CAC CUG AC U CCU GAG….-3'Patient nucleotide sequence 5'-GUG CAC CUG ACU CCU GUG.…-3'With the help of the genetic code table provided, answer the following:a- Write the amino acid sequence corresponding to both nucleotide sequences.
(2 marks)b- What is the type of mutation in this case? (2 marks)c- List 3 other types of mutation. (3 marks(d- Illustrate the hemoglobin electrophoresis pattern in this patient in
comparison with normal. (2 marks)e- Describe the shape of RBCs in this patient and explain why they have this
specific shape. (1 marks)f- List the monomers of normal adult and fetal hemoglobin protein. (2 marks)
UUUUUC UUAUUGCUUCUCCUACUG
AUUAUCAUA AUG
GUUGUC GUAGUG
Phe
Leu
Leu
LleMet
Val
UCUUCCUCAUCGCCUCCCCCACCG
ACUACCACAACG
GCUGCCGCAGCG
ser
pro
thr
Ala
UAUUACUAAUAGCAUCACCAACAG
AAUAACAAAAAG
GAUGACGAAGAG
Tyr
stop
hisGln
Asn
Lys
Asp
Glu
UGUUGCUGAUGGCGUCGCCGACGG
AGUAGCAGAAGG
GGUGGCGGAGGG
Cys
StopTrp
Arg
SerArg
Gly
![Page 23: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/23.jpg)
![Page 24: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/24.jpg)
HISTOLOGYMay 2010
Answer all the following questions:illustrate the answers with diagrams:1. Classify the living cellular structure in the cytoplasm. Describe the LM and EM
structure of the organelle involved un energy production. (8 marks)2. Describe the structure and correlated functions of :
a. Mast cell (4 marks)b. Spot desmosome (4 marks)c. Blood-air barrier (4 marks)
3. Correlate between the strucutre and fuction of the thymic lobule with special reference to the blood thymic barrier (10 marks)
4. In atable form,mention five histological differences between each of the followings:a. Chondroblast and osteoblast (5 marks)b. Spinal and symapthetic ganglia (5 marks)c. Thin and thick skin (5 marks)
5. Enumrate granular leucocytes. Give an account on the cell which increase in acute pyogenic infection (8 marks)
6. Asess the value of the following :a. Presence of vasa vasora in the advetitia of large blood vessles (1.5 marks)b. High fluid content in the matrix of hylaine cartilage (1.5 marks)c. The presence of Gap junction between cardiac Myocytes (1.5 marks)
7. Draw and label a diagram of transverse section (T.S) of trachea (10 marks)September 2010
Answer all the following questions:illustrate the answers with diagrams:1. Enumrate non memberanous organelles.describe in detail the structure
correlated functions of one of the organelles involved in cell division. (10 marks)
2. Describe the structure and correlated functions :a. Neuroepithelium. (4 marks)b. Gap junction . (4 marks)
3. In atable form ,mention five histological differences between each of the following:a. Meduim sized arteries and veins. (5 marks)b. Lymph npdes and spleen. (5 marks)
4. Describe the structure and correlated functions of :a. Plasma cell (5 marks)b. Smooth muscle fiber (5 marks)
5. Give an account on the structure and correlated functions of :a. Osteoclast ( 5 marks)b. Eosinophils ( 5 marks)
![Page 25: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/25.jpg)
c. Clara cell ( 5 marks)6. Evaluate the role of the following:
a. The presence of neuilemmal sheath in the nerve fiber (1.5 marks)b. The presence of synovial membrane in articular cartilage (1.5 marks)c. The presence of langerhan's cells in the epidermis of the skin (1.5 marks)
7. Draw and label adiagram of transverse section (T.S) of Ear pinna (10 marks)
May 2011Answer all the following questions:Illustrate the answers with diagrams:1. a- Mention the types, sites and functions of intermediate filaments. (3 marks)
b- Describe the structure and correlated functions of nucleolus. (3 marks)2. in a table form, mention the structural differences between :
a. Type I and type II pneumocytes. (3 marks)b. Protoplasmic and fibrous astrocytes. (3 marks)
3.(a) Describe in details the electron microscopic structure and correlated function of the intercalated disc. (4 marks)
(b) Discuss the types and correlated functions of T lymphocytes. (4 marks)4. Describe the structure (LM and EM) of :
(a) Osteocytes. (2 marks)(b) Langerhans. (2 marks)
5. Correlate the structure to the function of different types of blood capillaries. (4 marks)
6. Give reason for : a. Scar formation in the wall of the heart after myocardial infraction. (1 mark)b. Presence of tracheal muscles in the posterior part of the wall of the trachea.
(1 mark)c. Predominance of elastic elements in the wall of the aorta. (1 mark)
7. Draw a labeled diagram of H & E section of a lymph node. (6 marks)June 2012
ANSWER THE FOLLOWING:Illustrate your answers with diagrams: 1. Describe the structure ( LM and EM ) and correlated function of :
a. A self replicating organelle . (3 marks)b. Protein component of plasma membrane . (3 marks) c. Nuclear envelope . (3 marks)
2. In a table form, compare between the light microscopic structure of : a. Ordinary cardiac muscle fiber and Purkinje fiber. (3 marks)b. Palatine and pharyngeal tonsil . (3 marks)
3. Correlate the structure ( LM and EM ) to the function of : a. Blood platelets . (3 marks)b. Neutrophils . (3 marks)
4. Describe the light microscopic structure and correlated function of : a. Eccrine sweat glands . (3 marks)
![Page 26: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/26.jpg)
b. Neuroepithelium . (3 marks)5. a. Enumerate phagocytic cells in different tissues of the body. (1 marks)
b. Describe the structure (LM and EM) of the phagocyte cell of connective tissae proper with reference to its function. (3 marks)
6. a. Define the nerve fiber and describe its structure (LM and EM) and correlated function. (3 marks)
b. Mention the different types of nerve fibers. (1 marks) 7. Assess the value of the following:
a. The presence of blood brain barrier . (1 marks) b. Predominance of smooth muscle fibers in the wall of medium sized arteries.
(1 marks) c. Microvilli on apical surface of columnar epithelial cells lining the small
intestine. (1 marks) 8. Draw a labeled diagram of a section in compact bone. (7 marks).
September 2012
Illustrate your answers with diagrams :1. Describe the structure ( LM and EM ) and correlated function of :
a. Centrioles . (3 marks)b. Nucleolus . (3 marks)c. Ribosomes . (3 marks)
2. In a table from, mention 3 structural differences between : a. Mucous and serous acini. (3 marks)b. Osteocyte and chondrocyte . (3 marks)
3. Correlate the structure ( LM and EM ) to the function of : a. Megakaryocyte . (3 marks) b. Eosinophils . (3 marks)
4. Describe the microscopic structure of : a. Intercalated disc . (2 marks)b. Astrocytes . (2 marks)c. Langerhans cells . (2 marks)
5. Mention the components of each of the following structures : With special reference to the function : a. Blood thymic barrier . (3 marks)b. Matrix of hyaline cartilage . (3 marks)
6. Deseribe the microscopic structure of the cell involoved in : a. Henling and repair of injured connective tissue . (2 marks)b. Melanin formation in skin . (2 marks)
7. Assess the value of : a. Absence of nucleus and organelles of the red blood corpuscles (RBCs).
(1 mark)b. Sarcoplasmic reticulum in striated muscle fiber. (1 mark)c. Tight junction between the superficial cells of the transitional epithelium.
(1 mark)8. Draw a labeled diagram of a section in aorta stained by H & E. (5 marks)
![Page 27: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/27.jpg)
June 2013Answer all the following questionsIllustrate your answers with diagrams1. List the non-membranous organelles and describe the structure
(LM&EM) of one involved in cell division. (4 marks) 2. Describe the chromatin in terms of:
a. Structure.b. Types.c. Light and electron microscopic appearance. (4 marks)
3. Correlate the structure to the function of:a. Gap junction. (3 marks)b. Blood thymic barrier. (4 marks)
4. Describe the structure (LM&EM) and the correlated function of:a. Nerve cell body (3 marks)b. Bone resorping cell. (3 marks)
5. In a table form compare between the structure (LM&EM) of each of the following:a. Continuous and sinusoidal capillaries. (3 marks)b. Smooth and skeletal muscle fibers (4 marks)
6. Describe the structure (LM&EM) of the cells concerned with:a. Surfactant formation in the lung. (3 marks)b. Immunoglobulin (antibodies) formation. (3 marks)c. Antigen presentation in skin. (3 marks)
7. Assess the value of:a. Dyenin arms in cilia. (1 mark)b. Membrane bounded granules in stratum granulosum of skin. (1 mark)c. Cell membrane if RBCs is associated with spectrin. (1 mark)
8. Draw a labeled diagram of a section in spleen stained with H&E (5 marks)
![Page 28: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/28.jpg)
June 2014
![Page 29: med.asu.edu.egmed.asu.edu.eg/uploads/med/1st_year_exam_2016060… · Web viewList the muscles of the rotator cuff of shoulder and their nerve supply. Enumerate the branches of the](https://reader036.vdocument.in/reader036/viewer/2022070714/5ed4a642546fe2008a13b957/html5/thumbnails/29.jpg)
September 2014