metc is essential for d -alanine independent growth of an · methionine synthesis was detected in...

1/36

Up-regulation of metC is essential for D-alanine independent growth of an

alr/dadX deficient E. coli strain

Lishan Kanga, #

, Allan C. Shaw b, #*

, Daqi Xua,Wenjuan Xia

a,

Jingyuan Zhanga, Jianhui Deng

a, Helle F. Wöldike

b, Yun Liu

a, Jing Su

a

# Contributed equally to this work

a Beijing Novo Nordisk Pharmaceutials Science and Technology Co., Ltd.,

29 Life Science Park Road, Beijing, China

b Department of Protein Expression, Novo Nordisk A/S,

Novo Nordisk Park, Maaloev, Denmark

Running title: Alanine racemase co-activity of MetC

Key words: Alanine racemase,D-alanine, Methionine repressor, cystathione beta-lyase, E. coli

* Corresponding author. Mailing address: Department of Protein Expression, Novo Nordisk A/S,

Novo Nordisk Park, DK-2760 Maaloev, Denmark. Phone: +45-44424403; Fax: +45-44444565;

E-mail address: [email protected].

Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.01027-10 JB Accepts, published online ahead of print on 30 December 2010

on January 3, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

2/36

ABSTRACT

D-alanine is a central component of the cell wall in most prokaryotes. D-alanine synthesis

in Escherichia coli (E. coli) is carried out by two different alanine racemases encoded by the alr

and dadX genes. Deletion of alr and dadX from the E. coli genome results in a D-alanine

auxotrophic phenotype. However, we have observed growth of prototrophic phenotypic 5

revertants during routine culturing of a D-alanine auxotrophic strain. We present a detailed

comparison of proteome and transcriptome profiles of the D-alanine auxotroph and a

prototrophic revertant strain. Most noticebly, a general up-regulation of genes involved in

Methionine synthesis was detected in the revertant strain. The appearence of the revertant

phenotype was genetically linked to point mutations in the Methionine repressor gene (metJ). 10

Our results reveal an alternative metabolic pathway, which can supply essential D-alanine for

peptidoglycan synthesis of alr and dadX deficient E. coli mutants， and provide evidence for a

significant alanine racemase co-activity of the E. coli cystathione beta-lyase (MetC).

INTRODUCTION 15

Alanine racemases (EC 5.1.1.1) are unique prokaryotic enzymes that catalyze the

reversible racemization of L- and D-alanine, the latter one being an essential component in the

biosynthesis of the bacterial peptidoglycan of gram-positive and gram-negative bacteria (47).

The bacteria investigated to date have been found to possess either one or two distinct alanine

racemase genes. The alr gene encodes a constitutively expressed alanine racemase, which 20

provides D-alanine for sufficient crosslinking of adjacent peptidoglycan strands in the cell wall.

The second gene encodes the so-called catabolic alanine racemase which is essential for L-

alanine catabolism (24,28,41,42,48). In E. coli, the alr encoded alanine racemase is


.org/D

ownloaded from

http://jb.asm.org/

3/36

constitutively expressed, whereas the dadX encoded enzyme is essential only for L-alanine

catabolism, providing a substrate for a D-alanine specific dehydrogenase encoded by the dadA

gene (51). The dadX gene product provides a secondary source of D-alanine for cell wall

biosynthesis.

D-alanine auxotrophic E. coli, Bacillus subtilis, Corynebacterium glutamicum, Listeria 5

monocytogenes, and Lactobacillus plantarum strains have been generated by inactivating genes

encoding alanine racemases (15,17,24,42,43,45). A strong selective pressure for maintenance of

an alanine racemase (dal) encoding plasmid in a chromosomal dal mutant of Bacillus subtilis

was observed upon growth on rich medium. In Lactobacillus plantarum, plasmids encoding

alanine racemase (alr) were efficiently selected in an alr deficient Lactobacillus plantarum strain 10

(5). In Listeria monocytogenes two genes, an alanine racemase gene (dal) and a D-amino acid

aminotransferase gene (dat), which control the synthesis of the D-alanine, had to be inactivated

in order to achieve complete D-alanine auxotrophy (46).

Under certain circumstances, the D-alanine auxotrophic phenotype was lost indicating a

redundancy of alanine racemase activity in bacteria. The D-alanine auxotrophic phenotype of a 15

Bacillus subtillis dal mutant was lost when grown in minimal medium without L-alanine

suggesting that Bacillus subtilis possesses a second, L-alanine-repressible, alanine racemase.

This finding was supported by the discovery of a second gene in the Bacillus subtilis genome

sequence, which encodes a protein with high homology to alanine racemases (17). In E. coli only

the alr/dadX double knock-out strain is dependent on D-alanine for growth (51). Removal of D-20

alanine from liquid rich medium during growth of an alanine racemases deficient strain resulted

in rapid cell lysis. However, this lysis was partially prevented when cells were grown in minimal

medium (50). It was speculated that the protection could be either from osmotic protective


.org/D

ownloaded from

http://jb.asm.org/

4/36

pressure or de-repression of a redundant alanine racemase, which was however not identified

(50).

In this paper we isolated and characterized E. coli BL21(DE3)∆alr∆dadX mutants, which

were able to grow without D-alanine supplementation. Proteome and transcriptome analysis of

one phenotypic revertant, revealed that an alternative metabolic pathway involving the 5

Methionine regulon can be activated under certain growth conditions. Cystathionine beta-lyase

(MetC), which provides homocysteine for the final steps in methionine synthesis, was shown to

be the effector behind the D-alanine prototrophic phenotype.

MATERIALS AND METHODS 10

Replacement fragment construction. The flanking regions of the alr, dadX and metJ genes

were PCR amplified using the primer pairs shown in Table 1. The resulting paired amplicons

were then ligated simultaneously with a kanamycin resistance cassette (KmR) containing FRT

site (5'-GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC-3') at both ends. For alr and

dadX replacement, the upstream and downstream regions of corresponding genes were amplified 15

as left arm and right arm, respectively, for homologous recombination. To replace metJ, the MetJ

coding sequence and downstream region were amplified as left arm and right arm, respectively.

Gene disruption. BL21(DE3) cells carrying a Red helper plasmid (pKD46) (E. coli Genetic

Stock Center, Yale University) were grown in 50 ml Luria-Bertani (LB) liquid containing

ampicillin (100 µg/ml) at 30℃ with 300 rpm rotation until the OD600 reached 0.4. 1 mM L–20

arabinose was then added to cell culture at 30℃ for 1 h until OD600 reached 0.6. The cells were

made electro-competent by concentrating 100-fold and washing three times with ice-cold 10%

glycerol. The replacement DNA fragments containing a KmR gene flanked on both sides by


.org/D

ownloaded from

http://jb.asm.org/

5/36

homologous sequences of target genes were prepared by digestion of replacement vector with

corresponding enzymes, gel-purified, and suspended in water. Electroporation was done by using

Micropulser (Biorad) with 2.5 Kv voltage booster and 0.2-cm chamber according to the

manufacture’s instruction by using 40 µl of cells and 100 ng of replacement fragment. The

shocked cells were added to 1 ml SOC, incubated for 1 h at 37℃, and then spread onto LB agar 5

containing kanamycin (50 µg/ml) and D-alanine (100 µM) to select KmR transformants. KmR

colonies were screened by PCR with primers annealing to regions outside of the mutated

gene.The KmR gene could be excised by introducing the plasmid pCP20 encoding the FLP

recombinase (E. coli Genetic Stock Center, Yale University) when necessary. Plasmids pKD46

and pCP20 are both thermosensitive for replication and were cured at 42℃ (12,30). 10

Isolation of revertants and phenotypic analysis. The revertants were isolated by plating 50

µl BL21(DE3)∆alr∆dadX cells growing in mid-log phase in LB liquid medium containing 100

µM D-alanine onto LB agar plates. The cell viability was evaluated by plating cells onto LB agar

with or without supplementation of 100 µM D-alanine. For transmission electron microscopy

(TEM), cells were harvested by low speed centrifugation (1000 g, 5 min), washed twice in 15

sodium cacodylate buffer (200 mM, pH 7.3), pre-fixed in 3% (w/v) glutaraldehyde and fixed

with 1% (w/v) osmium tetroxide (OsO4). After dehydration with increasing concentrations of

ethanol, cells were embedded with EPOX 812 and polymerized at 60℃ for 48 h. To improve

contrast, the samples were stained with 4% (w/v) uranyl acetate and then with 0.4% (w/v) lead

citrate. Ultrathin sections were deposited on a copper grid and viewed in a HITACHI H600 20

electron microscope at 80 kV using a 30-mm objective aperture.


.org/D

ownloaded from

http://jb.asm.org/

6/36

Proteome analysis. A single colony of BL21(DE3)∆alr∆dadX or a phenotypic revertant strain

named BL21(DE3)∆alr∆dadXPR

was inoculated in 3 ml LB medium with or without 100 µM D-

alanine, and grown overnight with constant aeration at 37℃. The next day 50 ml LB medium

with or without D-alanine was inoculated with 0.5 ml of the corresponding overnight cultures

and grown at 37℃ with constant aeration to OD600=0.6. Cells were harvested by centrifugation at 5

3000 g for 10 min at 4℃. Pellets were washed gently on ice in PBS (50 mM, pH 7.2) and

centrifuged and then stored at -80℃ until used in proteome analysis or later microarray analysis.

Pellets corresponding to an amount of OD600=19 were resuspended in lysis buffer

consisting of 8 M Urea, 4% w/v 3-[3-cholamidopropyl]-dimethylammonium]-1-propanesufonate

(CHAPS), 2% v/v immobilized pH gradient (IPG) buffer (pH 3-10), 1% w/v dithiothreitol (DTT) 10

and sonicated on ice. Sonicated samples were centrifuged for 1 h at 40,000 g to remove cell

debris and supernatants were stored at -80℃ until used. Protein amounts were estimated using

the 2D Quant Kit (80-6486-22, GE Healthcare) according to manufacturer’s instructions.

IPG two-dimensional polyacrylamide gel electrophoresis (2D PAGE) was used for

proteome investigations. 24-cm non-linear IPG 3-10 strips (GE Healthcare) were used for 15

isoelectric focusing with the Ettan IPG phor (GE Healthcare). The strips were rehydrated with

150 µg of protein in lysis buffer for 12 h at 30 V. The voltage was then increased as follows: 1 h

at 100 V, 1 h at 250 V, 1 h at 500 V, 1 h at 1000 V, 2 h at 3000 V and focusing was completed at

8000 V (max 50 mA current, 20℃) until at total of ~60,000 Vhrs was reached. After the first

dimension was completed the strips were equilibrated in a buffer containing 6 M urea, 1% w/v 20

DTT, 50 mM Tris-HCl pH 8.8, 30% v/v glycerol, 2% w/v sodium dodecyl suphate (SDS) and

bromphenol blue for 15 min. The strips were then equilibrated in the buffer in which DTT was


.org/D

ownloaded from

http://jb.asm.org/

7/36

replaced with 4% iodoacetamide for 15 min. The Ettan Dalt Six electrophoresis unit (GE

Healthcare) was used to separate proteins according to their molecular weight on 9-16% linear

gradient polyacrylamide gels (25×20×0.1 cm) overnight at 100 V at 15℃.

After second dimensional runs, E. coli proteins were visualized using a silver staining

protocol according to Gharadaghi et al (19). Silver stained gels were scanned at 300 dpi and 5

analyzed using Image master version 5.0 (GE Healthcare). Protein spots, which were observed

up-regulated in the revertant strain on three independently run sets of gels were excised and

analysed by mass spectrometry.

The general strategy for mass spectrometric analysis was performed essentially as

previously reviewed (25). Excised protein spots were subjected to in-gel digestion using 12.5 10

ng/mL porcine trypsin (Promega) in 50 mM NH4CO3 buffer for enzymatic cleavage of proteins,

which have been reduced and alkylated with 10 mM DTT and 55 mM iodoacetamide,

respectively. Tryptic peptides were desalted and concentrated by using reversed phase micro-

columns (Zip-Tip C18, Millipore) according to the manufacturer’s instructions. Peptides were

co-crystallized on MALDI target plates using 4-hydroxy-α-cyanocinnamic acid by the dried-15

droplet method. Mass spectra were acquired on a prOTOFTM

2000 matrix-assisted laser

desorption/ionization orthogonal time-of-flight (MALDI O-TOF) mass spectrometrer interfaced

with the TOFWorksTM

software (Perkin Elmer/SCIEX). Proteins were identified using a

threshold for peptide mass tolerance of 30 ppm by submitting peptide mass peaklist to database

search (with species restrictions to E. coli) using the TOF works software. Minimum 25% 20

sequence coverage was observed for identifications.

Microarray analysis. Total RNA was isolated from the cell pellets prepared in previous

section using the protocol accompanying the RNeasy Mini Kit (Qiagen), and cDNA synthesis


.org/D

ownloaded from

http://jb.asm.org/

8/36

and labeling were done as described in the Affymetrix GeneChip E. coli Genome Array Technical

Manual. Affymetrix GeneChip E. coli genome arrays were used to analyze the complete E. coli

transcriptome. Biotin-labeled fragmented cDNA (2.5 µg) was hybridized to E. coli genome

arrays at 45℃ for 16 h as recommended in the GeneChip technical manual. The probed arrays

were scanned at 570 nm at a resolution of 1.5 µm using a Scanner3000 (Affymetrix). Gene 5

expression levels were calculated with GCOS1.2 software. The mean hybridization signal of all

probe sets on each array was scaled to a common value of 200. Affimetrix detection algorithm

was applied to determine whether a gene was expressed. The change between two experimental

conditions (n-fold) was calculated by taking a mean of the log ratios of probe pair intensities

across the two arrays. For each strain, three independent cultures were prepared and the RNA 10

was analyzed.

Complementary expression plasmid construction. Genomic DNA, isolated from overnight

culture of BL21(DE3) or BL21(DE3)∆alr∆dadX, was used as template for amplification of full-

length open reading frame of glyA, metB, metC, asd, ybdL, trpB and malY. Primers with NdeI or

XbaI at 5' primer and BamHI at 3' primer overhangs for each gene were designed to amplify the 15

full length genes. The gel purified amplicons were ligated into pET11a expression vectors

(Novagen) resulting in glyA, metB, metC, asd, ybdL, trpB and malY expression constructs,

respectively.

Western blot. Cells were collected by centrifugation and then resuspended in lysis buffer (20

mM Tris, 5 mM EDTA, pH 8.0). Cells were lysed by sonication and then centrifuged at 20,000 g 20

for 15 min to collect soluble fraction. The soluble fraction was normalized to 10 OD/ml and

analyzed by immunoblotting using anti- E. coli MetC antibody (a polyclonal rabbit antibody

developed against E. coli produced full-length MetC).


.org/D

ownloaded from

http://jb.asm.org/

9/36

RESULTS

Phenotypic characterization of a BL21(DE3)∆alr∆dadX strain and D-alanine

prototrophic revertants. To investigate whether a stable D-alanine auxotrophic E. coli strain

can be made, an alr/dadX deficient BL21(DE3) strain was obtained by sequential deletion of alr

and dadX genes using the λ-red recombinase mediated recombination (12,30). 5

The BL21(DE3)∆alr∆dadX strain displayed a strict dependence on D-alanine on LB

medium, indicating that disruption of both alr and dadX genes resulted in a D-alanine

auxotrophic phenotype (Table 2). However, upon characterization of the D-alanine dependence

of the BL21(DE3)∆alr∆dadX strain, prototrophic phenotypic revertants could be isolated from

cells growing without an exogenous source of D-alanine (100 µM) on LB medium. If assuming 10

that the plating efficiencies of BL21(DE3)∆alr∆dadX and the BL21(DE3)∆alr∆dadX phenotypic

revertant are identical, we estimated the frequency of mutation to 7×10-7

. During the 16 h

cultivation on LB medium, there were at least 20 generations. Thus, the mutation rate is less than

5×10-8

per generation.

On rich liquid medium, the doubling time of BL21(DE3)∆alr∆dadX phenotypic revertant 15

is almost the same as that of BL21(DE3)∆alr∆dadX growing with 100 µM D-alanine

supplementation in the medium, approximately 30 mins. In order to explain the phenotype

reversion of BL21(DE3)∆alr∆dadX, the morphology of BL21(DE3) wild type,

BL21(DE3)∆alr∆dadX and one representative prototrophic phenotypic revertant in the following

named BL21(DE3)∆alr∆dadXPR

(PR: Phenotypic revertant) were examined by TEM. 20

BL21(DE3)∆alr∆dadX growing with exogenous supply of D-alanine exhibits characteristic

abnormalities including increased roughness of the cell surface, collapse of the cell structure and

a ghost-like appearance in which the cells seem empty inside (Fig. 1). Thus, the D-alanine


.org/D

ownloaded from

http://jb.asm.org/

10/36

supplementation to the medium ensures the survival of the BL21(DE3)∆alr∆dadX, but with

visible impairments of cell wall integrity. In contrast, BL21(DE3)∆alr∆dadXPR

displays quite

similar morphology as wild type cells, typical of this E. coli strain (Fig. 1). This indicates that D-

alanine is still synthesized in the BL21(DE3)∆alr∆dadX revertant despite the knock-out of the

two known E. coli alanine racemase genes. 5

Comparative proteome and transcriptome analysis of BL21(DE3)∆alr∆dadX and

BL21(DE3)∆alr∆dadXPR

. Of 50 independently isolated phenotypic revertant colonies, 80%

showed significant overexpression of E. coli MetE as determind by SDS-PAGE and protein

identification by MALDI peptide mass fingerprinting (examplified in lane4, Fig. 2). To elucidate

the molecular mechanism behind the D-alanine prototrophy of the phenotypic revertant, a 10

comparative proteome investigation of the BL21(DE3)∆alr∆dadX and BL21(DE3)∆alr∆dadXPR

was performed (Fig. 3). By means of peptide mass fingerprinting (examplified in Fig. 3B), the

most significantly up-regulated proteins in the BL21(DE3)∆alr∆dadXPR

were identified as MetA,

MetB, MetE, MetF, MetK, Asd and GlyA. Thus, the expression of enzymes involved in

methionine synthesis is up-regulated in the BL21(DE3)∆alr∆dadXPR

(Fig. 3, Table 3). The 15

function of these genes are depicted in Fig. 5 and methionine regulation in E. coli is reviewed in

detail by Weissbach & Broth (49).

To verify whether any other genes are differentially expressed, the transcriptome profiles

at exponential growth phase of BL21(DE3)∆alr∆dadX and BL21(DE3)∆alr∆dadXPR

were

compared. Three individual experiments were scaled to a common, global average expression 20

level of 200 to correct for experimental variation. The gene was considered as up-regulated in


only when it received an Affymetrix call of “present” in both tested

(BL21(DE3)∆alr∆dadXPR

) and control (BL21(DE3)∆alr∆dadX) arrays, and showed a greater


.org/D

ownloaded from

http://jb.asm.org/

11/36

than 2-fold change in gene expression with a P value of <0.05 (Student’s t test) in all three

individual experiments. Using this cut-off, we were able to identify 21 genes which were

significantly up-regulated in the BL21(DE3)∆alr∆dadXPR

including all methionine genes, which

are responsible for the conversion of homoserine to L-methionine and other genes associated

with methionine metabolism (Table 3). MetL (aspartokinase II) is a bifunctional enzyme which 5

together with aspartate semi-aldehyde dehydrogenase (Asd) can convert L-aspartate to

homoserine, the substrate of MetA. metL and asd genes are repressed by excess L-methionine

(44) and are both up-regulated in BL21(DE3)∆alr∆dadXPR

. Taken together with the observed

up-regulation of Serine hydroxymethyl transferase (GlyA), which supplies 5,10-methylene-

tetrahydrofolate for MetF (Fig. 5) and GTP cyclohydrolase I (folE), our results revealed that all 10

genes responsible for linking L-aspartate, L-serine and the folate pathway to the methionine

pathway are up-regulated in the BL21(DE3)∆alr∆dadXPR

. With the exception of MetK and

GlyA, data from microarray analysis verified the results from proteome analysis.

We also observed up-regulations of the MetD methionine transporters (MetI, MetN,

MetQ), which actively transport L-methionine or D-methionine across the cell membrane (26), 15

and are regulated by MetJ (27,53). We did not observe up-regulation of MetH neither at the

protein nor at the transcriptional level in our study. MetH is the only Met gene that does not

contain MetJ recognition sequences (Met box) in its promoter and is regulated indirectly in a

complex interplay of MetR and Vitamin B12 (6,32).

The methionine aminotransferase, YbdL (16), is up-regulated in 20


. This confirms a previous prediction of MetJ binding sites in its

promoter (27). A hypothetical protein, YbdH, was also up-regulated and its coding gene is

located next to ybdL in the E. coli genome, but transcribed in the opposite direction.


.org/D

ownloaded from

http://jb.asm.org/

12/36

Besides from general up-regulation of genes involved in Methionine metabolism, all

genes encoded by the trpEDCBA operon involved in conversion of chorismate to L-tryptophan

were found up-regulated. This indicates that two major metabolic pathways are affected in


.

We specifically evaluated the expression level of MalY, a regulator of the maltose operon, 5

as it was previously shown to have alanine racemase activity in T. denticola (4). When 2D-gels

of a BL21(DE3)∆alr∆dadX and BL21(DE3)∆alr∆dadXPR

were compared, MalY was not found

up-regulated in BL21(DE3)∆alr∆dadXPR

(data not shown) as observed by transcriptome analysis.

Mutations in metJ or general derepression of Met genes is directly responsible for the

alanine racemase independent survival of the BL21(DE3)∆alr∆dadX strain. The proteome 10

and transcriptome data suggest that the phenotype of BL21(DE3)∆alr∆dadXPR

is caused by

mutations in either an enhancer or a repressor of Met genes, resulting in up-regulation of all Met

genes during normal growth with sufficient methionine. MetR and MetJ are the two general

regulators involved in the regulation of genes in methionine synthesis pathway. All known Met

genes, except MetH, but including the MetR transcriptional activator, are repressed by MetJ and 15

its cofactor SAM, the product of MetK (20-23). Thus, metR, metJ, and metK genes were

sequenced from independently isolated phenotypic revertants and compared to the wildtype

sequence from the D-alanine auxotrophic strain. We sequenced the metJ gene of 7 phenotypic

revertants which overexpressed Met E, and found that all of them had mutations in the metJ gene.

The BL21(DE3)∆alr∆dadXPR

strain had a single point mutation, which introduced a R42C 20

mutation in the MetJ protein. Five other phenotypic revertants had single point mutations

resulting in a MetJ protein with the following mutations: A12T, G15S, L36F, H50N and A60T.


.org/D

ownloaded from

http://jb.asm.org/

13/36

The last had a two base pair insertion, which results in a N-terminal truncated MetJ protein

comprising 45 amino acid. No mutation in metR and metK was identified.

To obtain direct evidence for a linkage between mutations in MetJ and D-alanine

prototrophy, a replacement of metJ[R42C] gene in BL21(DE3)∆alr∆dadXPR

genome by the wild

type metJ or the metJ[R42C] gene was carried out. A selection marker, KmR cassette, is 5

introduced in the genome together with the target gene by gene replacement. To rule out the

possibility that the effect introduced by metJ-KmR is due to any polar effect caused by insertion

of KmR cassette right after metJ loci, the metJ[R42C]-KmR was applied as a control. The D-

alanine auxotrophy was completely restored in the BL21(DE3)∆alr∆dadXPR

by introducing the

metJ-KmR, but not the metJ[R42C]-KmR (Table 2). In agreement with the phenotype change, 10

MetE expression was normalized by metJ-KmR, but not metJ[R42C]-KmR (Fig. 2), which

verified that the mutated MetJ[R42C] protein is not fully functional.

To rule out the possibility that mutations in other genes besides metJ contribute to the

phenotypes observed, the metJ[R42C]-KmR was introduced into the BL21(DE3)∆alr∆dadX

strain genome to replace the wild type metJ gene. The BL21(DE3)∆alr∆dadX strain carrying 15

metJ[R42C]-KmR could grow on LB medium without D-alanine supplementation (Table 2). To

verify that up-regulation of the Methionine pathway genes can directly compensate for the

absence of DadX and Alr alanine racemases, the growth of the D-alanine auxotroph was

analyzed on L-methionine deficient LB medium. Upon plating of the BL21(DE3)∆alr∆dadX

strain on L-methionine deficient LB medium, supplementation of D-alanine was no longer 20

required for growth (data not shown). With an increase of L-methionine concentration in medium,

the growth rate of BL21(DE3)∆alr∆dadX decreased. When the L-methionine concentration

reached 1 mM, complete growth inhibition of BL21(DE3)∆alr∆dadX (but not of the phenotypic


.org/D

ownloaded from

http://jb.asm.org/

14/36

revertant strain) was observed. This shows that the D-alanine auxotrophic strain becomes

prototrophic when L-methionine is depleted from the growth medium. Thus, all together these

data suggested that E. coli possesses another L-methionine repressible alanine racemase.

Cystathionine beta-lyase (MetC) alone can complement the D-alanine requirement of the

BL21(DE3)∆alr∆dadX strain. To elucidate whether a single MetJ regulated gene could encode 5

a protein with previously unknown alanine racemase activity, that could alone complement the

alr/dadX deletion, candidates were chosen from the identified up-regulated proteins. As alanine

racemases belong to the large family of PLP (pyridoxal 5’-phosphate) co-factor enzymes, it was

anticipated that the target protein would also belong to this family. From the entire E.coli

proteome, 56 proteins were predicted to belong to this catagory of enzymes using the TagIdent 10

tool (18) of which several were found up-regulated in BL21(DE3)∆alr∆dadXPR

. Besides from

GlyA, which was previously reported to possess limited alanine racemase activity (10,11,37),

MetB, MetC, Asd, TrpB and YbdL were also annotated as PLP cofactor requiring enzymes.

Plasmids expressing these genes under the control of the T7 promoter were transformed into

BL21(DE3)∆alr∆dadX. The transformants were plated on LB medium with or without 0.1mM 15

D-alanine supplementation. Following overnight culturing at 37℃, only the MetC expressing

plasmid was able to completely reverse the D-alanine auxotrophic phenotype of

BL21(DE3)∆alr∆dadX (Fig. 4).

When the metC gene was deleted from the BL21(DE3)∆alr∆dadXPR

genome the strain

could no longer grow on LB plates without D-alanine (Table 2). This confirms that MetC is the 20

effector behind the D-alanine prototrophic phenotype. Furthermore, western blots of cells lysates

using anti-MetC polyclonal antibody demonstrated that MetC is highly up-regulated in the D-


.org/D

ownloaded from

http://jb.asm.org/

15/36

alanine prototrophic BL21(DE3)∆alr∆dadXPR

, but not in BL21(DE3)∆alr∆dadX (or the metC

deficient BL21(DE3)∆alr∆dadXPR

) (Fig. 4).

DISCUSSION

The genes involved in the biosynthesis of L-methionine from homoserine and 5

tetrahydrofolate (Fig. 5) are regulated by: i) repression of the Met genes by MetJ aporepressor

and its co-repressor S-adenosyl methionine (SAM), when E.coli is cultivated in the presence of

Methionine; ii) activation of specific Met genes mediated by the MetR transcriptional activator

and it’s co-activator homocysteine and iii) repression of specific Met genes by vitamin B12. The

MetJ aporepressor dimerizes upon binding to its target DNA sequences (34,38,39) in a fashion 10

that is greatly facilitated by co-binding of SAM, the product of MetK (35,36). Mutations in either

metJ or metK gene may result in similar phenotypes, which show constitutive expression of the

Met genes even in the presence of excess methionine as observed for the BL21(DE3)∆alr∆dadX

phenotopic revertant. The regulatory nucleotide regions controlling transcription of metA, metB,

metC, metF, metE and metK and the genes from the metD operon all share a tandemly repeated 15

eight base pair sequence, the so called “Met box” (3,13). In this study, all the genes involved in

the conversion of L-aspartate or L-serine to L-methionine and its catabolite SAM were found up-

regulated in the BL21(DE3)∆alr∆dadXPR

strain (see Fig. 5), as described in a similar study of a

metJ knock-out strain (29). The dependency of the Methionine regulon for disruption of the D-

alanine deficiency of the BL21(DE3)∆alr∆dadX strain was directly supported by our 20

observations of the effect of L-methionine concentration on growth. In minimal medium, the

BL21(DE3)∆alr∆dadX and BL21(DE3)∆alr∆dadXPR

strains grew equally well at conc. up to

100 µM L-Methionine, but only the BL21(DE3)∆alr∆dadXPR

strain was able to grow at conc. of


.org/D

ownloaded from

http://jb.asm.org/

16/36

1 mM L-Methionine or more. The rich LB medium used in our investigations contains a

concentration of free L-methionine of approximately 1 mM. At zero or low L-methionine

concentration, the derepression of the Met genes is sufficient to complement the D-alanine

auxotrophy of the BL21(DE3)∆alr∆dadX strain, whereas the BL21(DE3)∆alr∆dadXPR

strain is

much less sensitive to different intracellular amounts of L-methionine due to an impaired MetJ 5

repressor.

E. coli strains containing single point mutations in the metJ gene can display a significant

increase in the level of intracellular L-methionine and activity of key enzymes of the methionine

pathway (1,8,9,31). The position of the single MetJ mutations differed considerably among the

seven investigated BL21(DE3)∆alr∆dadX phenotypic revertants, but may all affect the 10

interaction of MetJ with the Met box, MetJ dimerization, and/or the important protein-protein

interactions with the corepressor SAM as judged from analysis of the structure of the MetJ

operator complex (40).

The knock-in of the wt metJ gene, but not of metJ[R42C] gene, restores D-alanine

auxotrophy in the BL21(DE3)∆alr∆dadXPR

strain, showing that the MetJ mutation is directly 15

responsible for the BL21(DE3)∆alr∆dadXPR

phenotype. 2D-gel analysis indicates, that MetE is

unstable or rapidly degraded by the cell (Fig. 3A), which might explain the absence of

overexpressed MetE for some of the BL21(DE3)∆alr∆dadX phenotypic revertant isolates.

Certain BL21(DE3)∆alr∆dadX phenotypic revertant isolates may be able to circumvent D-

alanine auxotrophy through up-regulation of proteins, other than MetC, with alanine racemase 20

co-activity (eg. MalY). However, our data suggest that the primary mechanism for development

of the revertant phenotype is a strong selectional pressure towards inactivation or functional

impairment of MetJ.


.org/D

ownloaded from

http://jb.asm.org/

17/36

Alanine racemases belong to the diverse group of PLP (vitamin B6) dependent

enzymes (11,33), catalyzing the formation of an aldimine intermediate, which is the basis for

decarboxylation, transamination, β-elimination and racemization reactions. Different PLP

enzymes may share the same common fold comprising PLP and similar catalytic mechanisms

despite low sequence similarity (14). We therefore evaluated up-regulated candidates, which 5

belonged to this group, for alanine racemase activity.

Serine hydroxylmethyl transferase (GlyA) transaminates both L-alanine and D-alanine

and also catalyzes an alanine racemase reaction (10,11,37). However, the reported GlyA

racemase coactivity is not sufficient to fully compensate for the alr/dadX deletions in our study.

Cystathione gamma synthetase (MetB) catalyzes the formation of cystathione, which is 10

subsequently used by MetC for the formation of homocysteine (Fig. 5). MetB and MetC are

evolutionarily related enzymes, which share 36% sequence similarity (3) and belongs to the same

branch of PLP dependent enzymes (2). Only the plasmid expressing MetC could abolish the D-

alanine auxotrophy of the BL21(DE3)∆alr∆dadX strain. We observed a strong up-regulation of

MetC in the BL21(DE3)∆alr∆dadXPR

and the D-alanine prototrophy could be abolished by 15

removal of metC from the BL21(DE3)∆alr∆dadXPR

genome. We have also found that purified

recombinant E. coli MetC, exhibits in vitro alanine racemase activity (to be published).

Taken together, we therefore conclude that MetC, due to a significant alanine racemase

co-activity, is the effector protein behind D-alanine prototrophic revertant phenotype. To our

knowledge this is the first time that a protein directly involved in synthesis of L-methionine has 20

been shown to have alanine racemase activity.

It was reported that E. coli MalY, a regulator of the maltose operon, can abolish the

methionine requirement of a MetC mutant. This proves that both MetC and MalY have


.org/D

ownloaded from

http://jb.asm.org/

18/36

cystathionine beta-lyase activity (52) and thus potentially similar catalytic mechanisms.

Furthermore, it was recently reported that Cystalysin from Treponema denticola possesses

alanine racemase activity (4,7). E. coli MalY shows 51% sequence similarity to Treponema

denticola Cystalysin and we found that a plasmid expressing E. coli MalY was indeed able to

complement the alr/dadX deletion (data not shown). However, there is no significant sequence 5

similarity between E. coli MalY (or Treponema denticola cystalysin) and E. coli MetC, which

clearly illustrates the broad functional overlap among different PLP dependent enzymes. In

contrast to metC, malY is not regulated by MetJ and both proteome and microarray analysis from

this study rules out the possibility that MalY is causing the D-alanine prototrophic phenotype of

the BL21(DE3)∆alr∆dadXPR

strain. Thus, our findings show that two E. coli cystathionine beta-10

lyases connected to very different metabolic pathways can both catalyze the racemization

between L-alanine and D-alanine.

ACKNOWLEGEMENT

15

We thank Dr. Baoping Wang for continuous advice, and lab-technicians Malene Dahl,

Qinfen Wang and Junhua Wang for excellent technical assistance.

Note: Microarray data can be accessed through http://www.ebi.ac.uk/miamexpress/login.html

Login Name: lshk_array_2005; Password: lshk_array_2005


.org/D

ownloaded from

http://jb.asm.org/

19/36

REFERENCES

1. Ahmed A. 1973. Mechanism of repression of Methionine Biosynthesis in Escherichia

coli I. The Role of Methionine, S-Adenosylmethionine and Methionyl-Transfer

Ribonucleic Acid in Repression. Molec. Gen. Genet 123:299-324.

2. Alexander, F. W., E. Sandmeier, P. K. Mehta, and P. Christen. 1994. Evolutionary

relationships among pyridoxal-5'-phosphate-dependent enzymes. Regio-specific alpha,

beta and gamma families. Eur. J. Biochem. 219:953-960.

3. Belfaiza, J., C. Parsot, A. Martel, C. B. de la Tour, D. Margarita, G. N. Cohen, and I.

Saint-Girons. 1986. Evolution in biosynthetic pathways: two enzymes catalyzing

consecutive steps in methionine biosynthesis originate from a common ancestor and

possess a similar regulatory region. Proc. Natl. Acad. Sci. U. S. A 83:867-871.

4. Bertoldi, M., B. Cellini, A. Paiardini, M. Di Salvo, and V. C. Borri. 2003. Treponema

denticola cystalysin exhibits significant alanine racemase activity accompanied by

transamination: mechanistic implications. Biochem. J. 371:473-483.

5. Bron, P. A., M. G. Benchimol, J. Lambert, E. Palumbo, M. Deghorain, J. Delcour,

W. M. De Vos, M. Kleerebezem, and P. Hols. 2002. Use of the alr gene as a food-grade

selection marker in lactic acid bacteria. Appl. Environ. Microbiol. 68:5663-5670.


.org/D

ownloaded from

http://jb.asm.org/

20/36

6. Cai, X. Y., M. E. Maxon, B. Redfield, R. Glass, N. Brot, and H. Weissbach. 1989.

Methionine synthesis in Escherichia coli: effect of the MetR protein on metE and metH

expression. Proc. Natl. Acad. Sci. U. S. A 86:4407-4411.

7. Cellini, B., M. Bertoldi, A. Paiardini, S. D'Aguanno, and C. B. Voltattorni. 2004.

Site-directed mutagenesis provides insight into racemization and transamination of

alanine catalyzed by Treponema denticola cystalysin. J. Biol. Chem. 279:36898-36905.

8. Clandinin, M. T. and A. Ahmed. 1973. Mechanism of Repression of Methionine

Biosynthesis in Escherichia coli II The effect of metJ mutations on the Free Amino acid

Pool. Molec. Gen, Genet 123:325-331.

9. Collier, C. D. and J. R. Johnson. 1990. The Escherichia coli K-12 metJ193 allele

contains a point mutation which alters the hydrophobic pocket responsible for in vitro

binding of S-adenosylmethionine: effects on cell growth and induction of met regulon

expression. J. Bacteriol. 172:3918-3924.

10. Contestabile, R., S. Angelaccio, F. Bossa, H. T. Wright, N. Scarsdale, G. Kazanina,

and V. Schirch. 2000. Role of tyrosine 65 in the mechanism of serine

hydroxymethyltransferase. Biochemistry 39:7492-7500.

11. Contestabile, R., A. Paiardini, S. Pascarella, M. L. di Salvo, S. D'Aguanno, and F.

Bossa. 2001. l-Threonine aldolase, serine hydroxymethyltransferase and fungal alanine

racemase. A subgroup of strictly related enzymes specialized for different functions. Eur.

J. Biochem. 268:6508-6525.


.org/D

ownloaded from

http://jb.asm.org/

21/36

12. Datsenko, K. A. and B. L. Wanner. 2000. One-step inactivation of chromosomal genes

in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640-6645.

13. Davidson, B. E. and I. Saint-Girons. 1989. The Escherichia coli regulatory protein

MetJ binds to a tandemly repeated 8 bp palindrome. Mol Microbiol. 3:1639-1648.

14. Denessiouk, K. A., A. I. Denesyuk, J. V. Lehtonen, T. Korpela, and M. S. Johnson.

1999. Common structural elements in the architecture of the cofactor-binding domains in

unrelated families of pyridoxal phosphate-dependent enzymes. Proteins 35:250-261.

15. Diderichsen, B. 1986. A genetics system for stabilization of cloned genes in Bacillus

subtilis., p. 35-46. In A. Gansean and J. A. Hoch (ed.), Bacillus Molecular Genetics and

Biotechnology Applications. Academic press, New York.

16. Dolzan, M., K. Johansson, V. Roig-Zamboni, V. Campanacci, M. Tegoni, G.

Schneider, and C. Cambillau. 2004. Crystal structure and reactivity of YbdL from

Escherichia coli identify a methionine aminotransferase function. FEBS Lett. 571:141-

146.

17. Ferrari, E., D. J. Henner, and M. Y. Yang. 1985. Isolation of an alanine racemase gene

from Bacillus subtilis and its use for palsmid maintenance in B. subtilis. Bio/Technology

3:1003-1007.

18. Gasteiger, E., C. Hoogland, A. Gattiker, S. Duvaud, M. R. Wilkins, R. D. Appel, and

A. Bairoch. 2005. Protein Identification and Analysis Tools on the ExPASy Server, p.

571-607. In J. M. Walker (ed.), The Proteomics Protocols Handbook. Humana Press.


.org/D

ownloaded from

http://jb.asm.org/

22/36

19. Gharahdaghi, F., C. R. Weinberg, D. A. Meagher, B. S. Imai, and S. M. Mische.

1999. Mass spectrometric identification of proteins from silver-stained polyacrylamide

gel: a method for the removal of silver ions to enhance sensitivity. Electrophoresis

20:601-605.

20. Greene, R. C. 1996. Biosynthesis of methionine. In Escherichia coli and Salmonella

typhmurium, p. 542-560. In F.Neidhardt and others (ed.), Cellular and Molecular Biology.

21. Greene, R. C., J. S. Hunter, and E. H. Coch. 1973. Properties of metK mutants of

Escherichia coli K-12. J. Bacteriol. 115:57-67.

22. Greene, R. C., C. H. Su, and C. T. Holloway. 1970. S-Adenosylmethionine synthetase

deficient mutants of Escherichia coli K-12 with impaired control of methionine

biosynthesis. Biochem. Biophys. Res. Commun. 38:1120-1126.

23. Hobson, A. C. and D. A. Smith. 1973. S-adenosylmethionine synthetase in methionine

regulatory mutants of Salmonella typhimurium. Mol. Gen. Genet. 126:7-18.

24. Hols, P., C. Defrenne, T. Ferain, S. Derzelle, B. Delplace, and J. Delcour. 1997. The

alanine racemase gene is essential for growth of Lactobacillus plantarum. J. Bacteriol.

179:3804-3807.

25. Jensen, O. N., M. R. Larsen, and P. Roepstorff. 1998. Mass spectrometric

identification and microcharacterization of proteins from electrophoretic gels: strategies

and applications. Proteins Suppl 2:74-89.


.org/D

ownloaded from

http://jb.asm.org/

23/36

26. Kadner, R. J. 1975. Regulation of methionine transport activity in Escherichia coli. J.

Bacteriol. 122:110-119.

27. Liu, R., T. W. Blackwell, and D. J. States. 2001. Conformational model for binding site

recognition by the E.coli MetJ transcription factor. Bioinformatics. 17:622-633.

28. Lobocka, M., J. Hennig, J. Wild, and T. Klopotowski. 1994. Organization and

expression of the Escherichia coli K-12 dad operon encoding the smaller subunit of D-

amino acid dehydrogenase and the catabolic alanine racemase. J. Bacteriol. 176:1500-

1510.

29. Marincs, F., I. W. Manfield, J. A. Stead, K. J. McDowall, and P. G. Stockley. 2006.

Transcript analysis reveals an extended regulon and the importance of protein-protein co-

operativity for the Escherichia coli methionine repressor. Biochem J 396:227-234.

30. Murphy, K. C., K. G. Campellone, and A. R. Poteete. 2000. PCR-mediated gene

replacement in Escherichia coli. Gene 246:321-330.

31. Nakamori, S., S. Kobayashi, T. Nishimura, and H. Takagi. 1999. Mechanism of L-

methionine overproduction by Escherichia coli: the replacement of Ser-54 by Asn in the

MetJ protein causes the derepression of L-methionine biosynthetic enzymes. Appl.

Microbiol. Biotechnol. 52:179-185.

32. Old, I. G., D. Margarita, R. E. Glass, and I. Saint-Girons. 1990. Nucleotide sequence

of the metH gene of Escherichia coli K12 and comparison with that of Salmonella

typhimurium LT2. Gene 87:15-21.


.org/D

ownloaded from

http://jb.asm.org/

24/36

33. Paiardini, A., R. Contestabile, S. D'Aguanno, S. Pascarella, and F. Bossa. 2003.

Threonine aldolase and alanine racemase: novel examples of convergent evolution in the

superfamily of vitamin B6-dependent enzymes. Biochim. Biophys. Acta 1647:214-219.

34. Phillips, S. E., I. Manfield, I. Parsons, B. E. Davidson, J. B. Rafferty, W. S. Somers,

D. Margarita, G. N. Cohen, I. Saint-Girons, and P. G. Stockley. 1989. Cooperative

tandem binding of met repressor of Escherichia coli. Nature 341:711-715.

35. Saint-Girons, I., J. Belfaiza, Y. Guillou, D. Perrin, N. Guiso, O. Barzu, and G. N.

Cohen. 1986. Interactions of the Escherichia coli methionine repressor with the metF

operator and with its corepressor, S-adenosylmethionine. J Biol Chem. 261:10936-10940.

36. Shoeman, R., T. Coleman, B. Redfield, R. C. Greene, A. A. Smith, I. Saint-Girons, N.

Brot, and H. Weissbach. 1985. Regulation of methionine synthesis in Escherichia coli:

effect of metJ gene product and S-adenosylmethionine on the in vitro expression of the

metB, metL and metJ genes. Biochem. Biophys. Res. Commun. 133:731-739.

37. Shostak, K. and V. Schirch. 1988. Serine hydroxymethyltransferase: mechanism of the

racemization and transamination of D- and L-alanine. Biochemistry 27:8007-8014.

38. Smith, A. A. and R. C. Greene. 1984. Cloning of the methionine regulatory gene, metJ,

of Escherichia coli K12 and identification of its product. J Biol Chem. 259:14279-14281.

39. Smith, A. A., R. C. Greene, T. W. Kirby, and B. R. Hindenach. 1985. Isolation and

characterization of the product of the methionine-regulatory gene metJ of Escherichia

coli K-12. Proc. Natl. Acad. Sci. U. S. A 82:6104-6108.


.org/D

ownloaded from

http://jb.asm.org/

25/36

40. Somers, W. S. and S. E. Phillips. 1992. Crystal structure of the met repressor-operator

complex at 2.8 A resolution reveals DNA recognition by beta-strands. Nature 359:387-

393.

41. Strych, U., H. C. Huang, K. L. Krause, and M. J. Benedik. 2000. Characterization of

the alanine racemases from Pseudomonas aeruginosa PAO1. Curr. Microbiol. 41:290-

294.

42. Strych, U., R. L. Penland, M. Jimenez, K. L. Krause, and M. J. Benedik. 2001.

Characterization of the alanine racemases from two mycobacteria. FEMS Microbiol. Lett.

196:93-98.

43. Tauch, A., S. Gotker, A. Puhler, J. Kalinowski, and G. Thierbach. 2002. The alanine

racemase gene alr is an alternative to antibiotic resistance genes in cloning systems for

industrial Corynebacterium glutamicum strains. J. Biotechnol. 99:79-91.

44. Theze, J., D. Margarita, G. N. Cohen, F. Borne, and J. C. Patte. 1974. Mapping of the

structural genes of the three aspartokinases and of the two homoserine dehydrogenases of

Escherichia coli K-12. J Bacteriol. 117:133-143.

45. Thompson, R. J., H. G. Bouwer, D. A. Portnoy, and F. R. Frankel. 1998.

Pathogenicity and immunogenicity of a Listeria monocytogenes strain that requires D-

alanine for growth. Infect. Immun. 66:3552-3561.


.org/D

ownloaded from

http://jb.asm.org/

26/36

46. Verch, T., Z. K. Pan, and Y. Paterson. 2004. Listeria monocytogenes-based antibiotic

resistance gene-free antigen delivery system applicable to other bacterial vectors and

DNA vaccines. Infect. Immun. 72:6418-6425.

47. Wasserman, S. A., E. Daub, P. Grisafi, D. Botstein, and C. T. Walsh. 1984. Catabolic

alanine racemase from Salmonella typhimurium: DNA sequence, enzyme purification,

and characterization. Biochemistry 23:5182-5187.

48. Wasserman, S. A., C. T. Walsh, and D. Botstein. 1983. Two alanine racemase genes in

Salmonella typhimurium that differ in structure and function. J. Bacteriol. 153:1439-1450.

49. Weissbach, H. and N. Brot. 1991. Regulation of methionine synthesis in Escherichia

coli. Mol. Microbiol. 5:1593-1597.

50. Wijsman, H. J. 1972. The characterization of an alanine racemase mutant of Escherichia

coli. Genet. Res. 20:269-277.

51. Wild, J., J. Hennig, M. Lobocka, W. Walczak, and T. Klopotowski. 1985.

Identification of the dadX gene coding for the predominant isozyme of alanine racemase

in Escherichia coli K12. Mol. Gen. Genet. 198:315-322.

52. Zdych, E., R. Peist, J. Reidl, and W. Boos. 1995. MalY of Escherichia coli is an

enzyme with the activity of a beta C-S lyase (cystathionase). J. Bacteriol. 177:5035-5039.

53. Zhang, Z., J. N. Feige, A. B. Chang, I. J. Anderson, V. M. Brodianski, A. G.

Vitreschak, M. S. Gelfand, and M. H. Saier, Jr. 2003. A transporter of Escherichia


.org/D

ownloaded from

http://jb.asm.org/

27/36

coli specific for L- and D-methionine is the prototype for a new family within the ABC

superfamily. Arch. Microbiol. 180:88-100.


.org/D

ownloaded from

http://jb.asm.org/

28/36

TABLE 1. Sequence of primers used in this study

Primer Oligonucleotide sequence (5' to 3')

a Enzyme Amplicon

b

FalrLA acgcgtcgacGCGTTCCCGCGCACGCCGTA SalI

RalrLA cccaagcttGCGGTTAATCACAACAGTTG HindIII

alr upstream region

FalrRA cccaagcttAACTTATTACGCGCCTGACT HindIII

RalrRA cgggatccCCGGATGGTCCGCACCAAAC BamHI

alr downstream region

FdadXLA AACCGGAGACTGTCAGCTATTT

RdadXLA ACGGGTCATCTCGTTTCCTT

dadX upstream region

FdadXRA catatgCGGTTGTGACGGTGTAACTTGTTGT NdeI RdadXRA gagctcGGATCCAATTGGTCGGGAACGCGA

TCTTCCG SacI

dadX downstream region

FmetJL gaagatctACGCGTCATGTGATGAAG Bgl II

RmetJL cgccatatgTTAGTATTCCCACGTCTCCGG NdeI

metJ coding region

c

FmetJR cactgcagAGCAAAAAAGAGCGGCGCGG PstI

RmetJR cgagctcGCCGACTGCTTCAAAAACG SacI

metJ downstream region

a Sequence complementary to the amplified regions are represented by capital letters, and newly

added sequences are represented by lowercase letters. Incorporated cutting sites for restriction

enzymes are underlined.

b Flanking regions of individual genes for complementary recombination.

c metJ coding region is used as left complementary region for recombination.


.org/D

ownloaded from

http://jb.asm.org/

29/36

TABLE 2. D-alanine requirements of different alr/dadX deficient strains

Growth on selective LB medium Strain

Km+/

D-ala-

Km+/

D-ala+

Km-/

D-ala-

Km-/

D-ala+

BL21(DE3) ∆alr∆dadX N N N V BL21(DE3) ∆alr∆dadX metJ[R42C] KmR V V V V BL21(DE3) ∆alr∆dadX

PR N N V V

BL21(DE3) ∆alr∆dadXPR

metJ[R42C] KmR V V V V BL21(DE3) ∆alr∆dadX

PR metJ KmR N V N V

BL21(DE3) ∆alr∆dadX∆metC N N N V BL21(DE3) ∆alr∆dadX

PR∆metC N N N V

KmR: kanamycin resistant gene, Km: kanamycin, D-ala: D-alanine, V: viable, N: not viable, +: in

the presence of reagent, -: in the absence of reagent.


.org/D

ownloaded from

http://jb.asm.org/

30/36

TABLE 3. Up-regulated genes in BL21(DE3)∆alr∆dadXPR

.

SLRa (log2)

Genename 2D-gel spots Function

Meanb SD

asd P9,P10 aspartate-semialdehyde dehydrogenase 1.43 0.12 folE GTP cyclohydrolase I 1.63 0.21 glyA P3 serine hydroxymethyltransferase n.d. n.d. metA P11 homoserine transsuccinylase 2.43 0.31 metB P13 cystathionine gamma-synthase 2.20 0.56 metC cystathionine beta-lyase (beta-cystathionase) 2.27 0.40 metE P1,P2,P15 tetrahydropteroyltriglutamate methyltransferase 2.77 0.15 metF P6,P7 5,10-methylenetetrahydrofolate reductase 2.83 0.21

metI D- and L-methionine transport protein (ABC superfamily, membrane)

1.73 0.35

metK P4 S-adenosylmethionine synthetase n.d. n.d.

metL aspartokinase II and homoserine dehydrogenase II

2.27 0.75

metN D- and L-methionine transport protein (ABC superfamily, atp_bind)

2.00 0.53

metQ D-methionine transport protein (ABC superfamily, peri_bind)

1.57 0.32

rplJ P14 ribosomal protein L10 n.d. n.d. spf Spot 42 RNA 1.63 0.31 trpA tryptophan synthase, alpha protein 1.23 0.23 trpB tryptophan synthase, beta protein 1.33 0.21

trpC N-(5-phosphoribosyl) anthranilate isomerase and indole-3-glycerolphosphate synthetase

1.20 0.10

trpD anthranilate synthase component II, glutamine amido-transferase and phosphoribosylanthranilate transferase

1.60 0.10

trpE anthranilate synthase component I 1.63 0.15 trpL trp operon leader peptide 1.47 0.32 ybdH putative oxidoreductase 1.83 0.15 ybdL putative aminotransferase 1.30 0.17 yfcF orf, hypothetical protein 1.53 0.35

P numbers denote proteins spots up-regulated on 2D gels and identified by peptidemass

fingerprinting (See Fig. 3B for examples).

a SLR (Signal Log Ratio) is applied to reflect the change (n-fold) between

BL21(DE3)∆alr∆dadX cell and its revertant. SLR was calculated by taking the ratio of the signal

intensity (difference of the log2 value) between the two cells. Genes that showed at least a 2-fold

increase in mRNA abundance relative to the control and had a present call by the Affymetrix

algorithm were considered upregulated.

b An average from three individual experiemnts.


.org/D

ownloaded from

http://jb.asm.org/

31/36

FIG. 1. Morphology analysis of BL21(DE3)∆alr∆dadX and BL21(DE3)∆alr∆dadXPR

.

Transmission electron microscopy shows the cell membrane structure of BL21(DE3) cell

growing on LB medium (A), BL21(DE3)∆alr∆dadX cell growing on LB medium supplemented

with 0.1 mM D-alanine (B) and BL21(DE3)∆alr∆dadXPR

cell growing on LB medium (C).


.org/D

ownloaded from

http://jb.asm.org/

32/36

FIG. 2. SDS-PAGE showing the effect of knock-in of metJ-KmR and metJ[R42C]-KmR. MetE of


is down-regulated after metJ-KmR knock-in. Lane 1, Molecular weight

marker; Lanes 2-6, BL21(DE3), BL21(DE3)∆alr∆dadX, BL21(DE3)∆alr∆dadXPR

,


with metJ-KmR knock-in, BL21(DE3)∆alr∆dadXPR

with metJ[R42C]-

KmR knock-in.


.org/D

ownloaded from

http://jb.asm.org/

33/36

FIG. 3. Comparative proteome analysis of the BL21(DE3)∆alr∆dadX and


. (A) Silverstained 2D-gel of the BL21(DE3)∆alr∆dadXPR

. The identity

of the marked spots are shown in table 3. Solid-circle points at a degradation product of MetE.

Enlargements a, c, e, g (D-alanine auxotrophy) and b, d, f, h (revertant strain) are examplifying

regions comprising identified proteins that were up-regulated in the revertant strain compared to


.org/D

ownloaded from

http://jb.asm.org/

34/36

the D-alanine auxotrophy. Differently regulated spots are encircled; a/b: GlyA and MetB. White

solid circle in a/b indicates up-regulated spot, which were identified as degradation product of

MetE; c/d:Two isoforms of MetF; e/f:Two isoforms of Asd; g/h: Two isoforms of full length

MetE. (B) Peptide mass spectrum of P13 spot. Mass peaks matching MetB are indicated by

numbered arrows corresponding to experimentially determined peptides shown in upper right

corner. 10 out of 11 peptides matched the theoretical tryptic peptides derived from the MetB

sequence with a mass accuracy less than 10 ppm. 26 % of the MetB sequence was covered by the

peptides. “T”-arrows point at peptides coming from auto-digestion of trypsin.


.org/D

ownloaded from

http://jb.asm.org/

35/36

FIG. 4. BL21(DE3)∆alr∆dadX cells were transformed with expression plasmids encoding

different potential alanine racemases(A and B). Cells were grown on LB medium supplemented

with 100 µM D-alanine (A) or without D-alanine (B) but with 0.1 mM IPTG induction of

pET11a (1), alr (2), asd (3), glyA (4), metB (5), metC (6), trpB (7) and ybdL (8). MetC has in

vivo alanine racemase activity and results in the phenotypic conversion of

BL21(DE3)∆alr∆dadX from D-alanine auxotroph to D-alanine prototroph. (C) Western blot

using anti-E. coli MetC polyclonal antibody. Lane 1-3: 5, 10 and 20 ng of purifed recombinat

MetC. Lane 4-6: Cell extracts from BL21(DE3)∆alr∆dadXPR

, BL21(DE3)∆alr∆dadX and

BL21(DE3)∆alr∆dadXPR∆metC. Note: the band above MetC band in the lysates is due to an

unspecific detection by the polyclonal antibody.


.org/D

ownloaded from

http://jb.asm.org/

36/36

FIG. 5. Schematic representation of the main conclusions of this paper. The Methionine pathway

showing the relations between the Met repressor (MetJ) and MetJ responsive genes and the novel

link to D-alanine and peptidoglycan synthesis via MetC. Stippled arrows indicate activator action

and abrupted stippled lines indicate repressor action.


.org/D

ownloaded from

http://jb.asm.org/


.org/D

ownloaded from

http://jb.asm.org/

metc is essential for d -alanine independent growth of an · methionine synthesis was detected in...

Documents