�-Glucanase Activity of the Oral Bacterium Tannerella forsythiaContributes to the Growth of a Partner Species, Fusobacteriumnucleatum, in Cobiofilms

Kiyonobu Honma,a Angela Ruscitto,a Ashu Sharmaa

aDepartment of Oral Biology, University at Buffalo, Buffalo, New York, United States

ABSTRACT Tannerella forsythia and Fusobacterium nucleatum are dental plaquebacteria implicated in the development of periodontitis. These two species havebeen shown to form synergistic biofilms and have been found to be closely associ-ated in dental plaque biofilms. A number of genetic loci for TonB-dependent mem-brane receptors (TDR) for glycan acquisition, with many existing in association withgenes coding for enzymes involved in the breakdown of complex glycans, havebeen identified in T. forsythia. In this study, we focused on a locus, BFO_0186-BFO_0188, that codes for a predicted TDR-SusD transporter along with a putative�-glucan hydrolyzing enzyme (BFO_0186). This operon is located immediately down-stream of a 2-gene operon that codes for a putative stress-responsive extracyto-plasmic function (ECF) sigma factor and an anti-sigma factor. Here, we show thatBFO_0186 expresses a �-glucanase that cleaves glucans with �-1,6 and �-1,3 linkages.Furthermore, the BFO_0186-BFO_0188 locus is upregulated, with an induction of�-glucanase activity, in cobiofilms of T. forsythia and F. nucleatum. The �-glucanase ac-tivity in mixed biofilms in turn leads to an enhanced hydrolysis of �-glucans and re-lease of glucose monomers and oligomers as nutrients for F. nucleatum. In summary,our study highlights the role of T. forsythia �-glucanase expressed by the asac-charolytic oral bacterium T. forsythia in the development of T. forsythia-F. nuclea-tum mixed species biofilms, and suggest that dietary �-glucans might contributein plaque development and periodontal disease pathogenesis.

IMPORTANCE The development of dental plaque biofilm is a complex process inwhich metabolic, chemical and physical interactions between bacteria take a centralrole. Previous studies have shown that the dental pathogens T. forsythia and F. nu-cleatum form synergistic biofilms and are closely associated in human dental plaque.In this study, we show that �-glucanase from the periodontal pathogen T. forsythiaplays a role in the formation of T. forsythia-F. nucleatum cobiofilms by hydrolyzing�-glucans to glucose as a nutrient. We also unveiled that the expression of T. for-sythia �-glucanase is induced in response to F. nucleatum sensing. This study high-lights the involvement of �-glucanase activity in the development of T. forsythia-F.nucleatum biofilms and suggests that intake of dietary �-glucans might be a contrib-uting risk factor in plaque development and periodontal disease pathogenesis.

KEYWORDS Tannerella forsythia, �-glucanase, biofilms, Fusobacterium nucleatum

Tannerella forsythia and Fusobacterium nucleatum are periodontal plaque bacteriaimplicated in the development of periodontitis, a chronic inflammatory disease of

the tooth-supporting tissues that often leads to tooth loss (1, 2). The disease developsfrom the damaging effects of the host response triggered against a subgingival biofilmcommunity comprising multiple bacteria species. While T. forsythia is strongly impli-cated in modulating inflammation associated with periodontitis, F. nucleatum is con-

Received 10 August 2017 Accepted 16October 2017

Accepted manuscript posted online 27October 2017

Citation Honma K, Ruscitto A, Sharma A. 2018.β-Glucanase activity of the oral bacteriumTannerella forsythia contributes to the growthof a partner species, Fusobacterium nucleatum,in cobiofilms. Appl Environ Microbiol84:e01759-17. https://doi.org/10.1128/AEM.01759-17.

Editor Andrew J. McBain, University ofManchester

Copyright © 2017 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Kiyonobu Honma,homma@buffalo.edu, or Ashu Sharma,sharmaa@buffalo.edu.

MICROBIAL ECOLOGY

crossm

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 1Applied and Environmental Microbiology

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

sidered a “bridge bacterium” that facilitates the development of subgingival plaquebiofilm due to its ability to coaggregate with both the early- and late-colonizing species(3). In particular, T. forsythia has been shown to coaggregate and form synergisticcobiofilms with F. nucleatum in vitro (4). In addition, in human dental plaque thesespecies coexist in close physical proximity (5), suggesting the existence of mutualisticinteraction between the two species.

A large number of TonB-dependent membrane receptors (TDRs) (TonB_dep_recPfam family) with associated lipoproteins (SusD, SusD-like, and SusE Pfam families) havebeen identified in T. forsythia (6). A total of 74 proteins matching the TonB_dep_RecPfam and 85 proteins matching the SusD-like Pfam families have been identified byproteomic analysis of the outer membrane (OM) and outer membrane vesicle (OMV)fractions (6, 7). The significance of these TDR-SusD complexes in T. forsythia remains tobe determined. However, it is reasonable to predict that through the acquisition ofscarcely available nutrients in the subgingival niche these TDRs provide a competitiveadvantage to the bacterium. Interestingly, many loci with TDR-SusD coding genes inthe bacterium exist in association with genes encoding putative glycosidases, indicat-ing that these loci may be involved in the breakdown and uptake of complex glycans.Intriguingly, however, T. forsythia is an asaccharolytic bacterium and relies primarily onproteolytic degradation of peptides to obtain energy. In Bacteroides spp. that thrive inthe human gut by feeding on complex carbohydrates, specific loci known as thepolysaccharide utilization loci (PUL) exist. A typical PUL locus is generally comprised ofcoregulated genes that code for a specific polysaccharide degradation enzyme (glyco-side hydrolases, GH) and SusC/D-like proteins involved in binding and transport ofdegraded products (8). In this study, we focused on a locus, BFO_0186-BFO_0188, thatcodes for a predicted TDR-SusD transporter along with a putative �-glucanase(BFO_0186). This operon is located immediately downstream of a 2-gene operon thatcodes for a putative stress-responsive extracytoplasmic function (ECF) sigma factor andan anti-sigma factor. Here we show that BFO_0186 is a �-glucanase that cleavesglucans with �-1,6 and �-1,3 linkages. Furthermore, the BFO_0186-BFO_0188 locus isupregulated, with enhanced expression of �-glucanase activity in cobiofilms of T.forsythia and F. nucleatum. Our data suggest that increased glucanase activity inmixed-species biofilms leads to enhanced hydrolysis of �-glucans and release ofglucose monomers and oligomers as a nutrient for F. nucleatum.

RESULTST. forsythia genome contains a putative locus for a TonB-dependent glycan

receptor with an associated glucanase. A locus (BFO_0186-BFO_0188) comprisinggenes coding for a putative �-glucanase (BFO_0186; �-glucanase Pfam family), aputative sugar-binding outer membrane lipoprotein (BFO_0187; SusD/RagB-like PfamPF12771 family), a TonB-dependent outer membrane receptor (BFO_0188; SusC/RagA-like with a beta barrel [Pfam PF00593], and a plug domain (Pfam PF07715) has beenidentified in the T. forsythia ATCC 43037 genome (Fig. 1). This locus is present imme-diately downstream of a set of genes coding for a putative regulatory system compris-ing an extracytoplasmic function (ECF) sigma factor (BFO_0190) and an anti-sigmafactor (BFO_0189) (Fig. 1A). The product encoded by BFO_0186 contains a glucosidasedomain characteristic of �-glucanases of the GH16_laminarinase_like glycosyl hydro-lase family (accession no. cd00413) and shows 63% and 76% identity with the�-glucanase of Bacteroidia bacterium strain 6E (GenBank accession no. GAP68488.1). Toinvestigate whether the BFO_0186-BFO_0188 locus forms a transcriptional unit, weperformed reverse transcription-PCR (RT-PCR) analysis as outlined in Fig. 1A. The resultsdemonstrated that BFO_0186, BFO_0187, and BFO_0188 were transcribed as a singleRNA transcript (Fig. 1B), since PCR products of the expected size were obtained withprimer pairs bridging the open reading frames (ORFs) of adjacent genes. In addition,the transcription start site for this operon was determined by 5= rapid amplification ofcDNA ends (5=-RACE), which was identified as the residue adenine (64 nt upstream ofthe initiation codon for the BFO_0188 protein). 5=-RACE PCR results also clarified the

Honma et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 2

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

transcription start sites of ORFs BFO_0189 and BFO_0190, identified respectively as theresidue thymine, 20 nt upstream of the initiation codon for BFO_0189, and as theresidue cytosine, 68 nt upstream of the initiation codon for BFO_0190 protein (see Fig.S1 in the supplemental material).

To determine if BFO_0186 expresses a functional �-glucanase, a glutathioneS-transferase (GST)-tagged recombinant BFO_0186 protein was expressed in Escherichiacoli and purified by glutathione-affinity chromatography. As expected, the purifiedrecombinant protein GST-rTfGlcA migrated as a protein band of 64 kDa on an SDS-PAGE gel (Fig. 2A), and yielded the expected size 37-kDa BFO_0186 and 27-kDa GSTprotein bands following thrombin digestion (Fig. 2A, lane 2 and 3). Importantly, thefusion proteins as well as the thrombin-released rBFO_0186 protein (rTfGlcA) testedpositive for glucanase activity by PAGE zymography (Fig. 2B). In addition, the results ofthe thin-layer chromatography (TLC)-based assay confirmed that the purified rTfGlcAprotein catalyzed the release of glucose from lichenin (Fig. 2C, panel 2). As shown,treatment of lichenin with the rTfGlcA protein and the commercially available gluca-nase used as a positive control caused release of glucose. These data confirmed that theBFO_0186 gene expresses a �-glucanase, which we label as the T. forsythia glcA gene.

Next, to confirm that BFO_0186 expresses a functional �-glucanase in T. forsythia,�-glucanase activities of the wild-type T. forsythia and its glcA-inactivated deletionmutant were tested. The results from both the plate and gel zymography-based assaysshowed that while the wild-type parental strain hydrolyzed lichenin, forming clearhalos around the bacterial colony, the glcA-inactivated mutant was unable to do so (Fig.3A and B). In addition, lichenin hydrolysis was observed at approximately 37-kDa sizerange in cell extracts from the wild type but not from the glcA-inactivated mutantstrain. Also importantly, F. nucleatum was unable to hydrolyze �-glucan (Fig. 3B). Takentogether, these data demonstrated that BFO_0186 is a bona fide �-glucanase.

FIG 1 Organization of T. forsythia �-glucanase locus (BFO_0186-BFO_0188). (A) The BFO_0186-BFO_0188genetic cluster codes for a putative �-glucanase, along with predicted SusC- and SusD-like proteins.BFO_0190 and BFO_0189 code for a predicted ECF sigma and anti-sigma regulatory proteins, respectively.RT-PCR analysis with primer sets spanning adjacent genes (fragments a, b, and c). (B) PCR products wereseparated on a 1.2% agarose gel. Lane 1, no reverse transcription (RNA only) controls; lane 2, cDNA as thetemplate; lane 3, genomic DNA as the template for each primer set (Table 3).

T. forsythia �-Glucanase Supports F. nucleatum Growth Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 3

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

F. nucleatum induces �-glucanase expression in T. forsythia. Studies have shownthat T. forsythia is present in close physical association with F. nucleatum in dentalplaque biofilms (9). In addition, the two species form synergistic biofilms in vitro. Sinceintergeneric cell-cell communication can modulate bacterial gene expression, impact-ing the growth and development of bacterial communities, we hypothesized that amutually beneficial interaction exists between F. nucleatum and T. forsythia. We inter-rogated whether the glucanase operon was regulated during T. forsythia-F. nucleatumcoexistence and if this regulation had a role in the growth of bacterial species. The datashowed that the BFO_0186-BFO_0188 operon was upregulated in the F. nucleatum-T.forsythia coculture condition in comparison to that in the T. forsythia culture alone; allthree genes associated with the operon were upregulated (Table 1). To assess whetherthis upregulation was due to the direct cell-cell contact or to the soluble bacterialfactors, the expression of BFO_0186 (the glucanase coding gene, the last gene in theoperon) was determined when T. forsythia and F. nucleatum were cultured in the samechamber (Table 2, Tf�Fn) or individual chambers separated by a 0.45-�m filter (Table2, Tf/Fn). The data showed that BFO_0186 was upregulated only in the Tf�Fn and notin the Tf/Fn condition. These data demonstrated that direct cell-cell contact is requiredfor the induction of intracellular signaling responsible for glucanase expression in T.forsythia. To further confirm that F. nucleatum-sensing by T. forsythia indeed results inincreased �-glucan hydrolysis, the �-glucanase activity of T. forsythia cells in responseto increasing concentrations of F. nucleatum crude extract was assayed. Briefly, celllysates from equal number of T. forsythia cells treated with F. nucleatum extract wereassayed by lichenin-agar microplate zymography. The data showed increasing licheninhydrolysis in extracts of T. forsythia cells prestimulated with increasing concentrationsof F. nucleatum cell extracts, as indicated by reduction in Congo red staining in adose-dependent manner (Fig. 4). As evident from the data (Fig. 4), T. forsythia extractsprepared from cells treated with 10 mg/ml and 5 mg/ml F. nucleatum extracts showedsignificantly higher �-glucanase activity compared to the basal activity present in thenontreated T. forsythia cells.

Hydrolyzed �-glucan released by T. forsythia �-glucanase supports F. nuclea-tum growth. The upregulation of the �-glucanase-associated operon in response tointerbacterial interaction suggested that the hydrolyzed glucan might have a growth-

FIG 2 Expression and confirmation of enzyme activity of the recombinant protein. (A) Coomassie-stained10% SDS-PAGE gel of purified protein fractions (10 �g total protein per lane). Lane 1, glutathione-agarose-purified GST-tagged rTfGlcA; lane 2, recombinant �-glucanase protein (rTfGlcA) after thrombintreatment of fusion protein and glutathione-agarose chromatography; lane 3, GST protein eluted fromglutathione agarose column. (B) Detection of glucanase activity by zymography on 10% SDS-PAGE gelscontaining 0.1% lichenin and stained with Congo red. Lane 1, GST-rTfGlcA; lane 2, GST-released rTfGlcA;lane 3, GST. (C) Detection of glucanase activity by TLC was performed for evaluation of �-glucanhydrolyzation by rTfGlcA. Plate 1, subjected to mobile phase comprising 1-propanol:2% boric acid: aceticacid, 40:5:1; plate 2, subjected to mobile phase comprising chloroform:acetic acid:water, 3:3.5:0.5. Lanes:G, 0.2% glucose; S, 0.2% sucrose; L, 0.2% lichenin; L�, commercial �-glucanase treated 0.2% lichenin;LrTfG, rTfGlcA treated with 0.2% lichenin.

Honma et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 4

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

promoting effect on the bacterial species. We reasoned that D-glucose monomers orsmaller oligomers might promote bacterial growth by serving as a carbon source. Totest this hypothesis, we first determined whether hydrolyzed glucan or D-glucosepromoted the growth of either species. The data showed that F. nucleatum growth wasenhanced when the growth media was supplemented with D-glucose in a dose-dependent manner (see Fig. S2A in the supplemental material). However, the plank-tonic growth of T. forsythia was adversely affected in the presence of increasingconcentration of glucose (Fig. S2B), which was not surprising, considering that high

FIG 3 Detection of �-glucanase activity in T. forsythia cells. (A) Lichenin plate zymography. Bacteriapatched on 0.2%-lichenin-containing agar plates were incubated anaerobically for 1 week. Plates werewashed with water to remove bacterial colonies and then stained with Congo red. Colony patch 1, T.forsythia wild type 43037; colony patch 2, T. forsythia glcA deletion mutant; colony patch 3, F. nucleatum25586. (B) Detection of �-glucanase activity in T. forsythia cells by gel zymography. Bacterial cell lysate(100 �g/lane) from each strain was separated on a 10% SDS-PAGE instrument with 0.1% lichenin gel,followed by Congo red staining. Lane 1, T. forsythia 43037; lane 2, T. forsythia glcA deletion mutant; lane3, F. nucleatum 25586.

TABLE 1 Comparison of mRNA expression difference of the ORFs with T. forsythia alone and T. forsythia and F. nucleatum by qRT-PCRa

ORF Description Bacterial species Avg CT �CT � SD ��CT � SDFoldincrease P

BFO_0186 glcA �-glucanase Tf 23.73 20.74 � 0.16 0.00 � 0.16 1.0Tf�Fn 23.412 18.48 � 0.23 �2.26 � 0.23 4.79 3.4E�06

BFO_0187 SusD/RagB sugar-binding protein

Tf 27.520 24.53 � 0.28 0.000 � 0.28 1.0Tf�Fn 25.86 20.93 � 0.40 �3.60 � 0.40 12.16 6.1E�06

BFO_0188 SusC/RagA transporter Tf 22.39 19.40 � 0.38 0.00 � 0.38 1.0Tf�Fn 22.16 17.23 � 0.13 �2.17 � 0.13 4.50 3.5E�05

BFO_0189 Anti-sigma factor Tf 29.18 26.19 � 0.54 0.00 � 0.54 1.0Tf�Fn 31.89 26.96 � 0.40 0.77 � 0.40 0.58 0.06

BFO_0190 ECF sigma factor Tf 24.56 21.57 � 0.260 0.00 � 0.26 1.0Tf�Fn 26.60 21.67 � 0.201 0.10 � 0.21 0.93 0.57

aSignificant difference between T. forsythia only and T. forsythia � F. nucleatum. Tf, T. forsythia; Fn, F. nucleatum.

T. forsythia �-Glucanase Supports F. nucleatum Growth Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 5

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

glucose is known to be toxic to T. forsythia due to the bacterium’s ability to metabolizeglucose into a highly reactive compound, methylglyoxal (MGO) (10). Interestingly,D-glucose did not adversely impact the biofilm growth of T. forsythia, and F. nucleatumbiofilm growth was dose-dependently enhanced, as indicated by DAPI (4=,6-diamidino-2-phenylindole) and fluorescent in situ hybridization (FISH) staining of biofilms (See Fig.S3A and B in the supplemental material).

Next, the T. forsythia wild type and T. forsythia glcA deletion mutant were tested fortheir ability to form a biofilm in the presence of F. nucleatum. The data showed that inT medium supplemented with lichenin (T-L), T. forsythia wild type and F. nucleatumformed significantly greater cobiofilms than the glcA-inactivated mutant and F. nuclea-tum (Fig. 5), as estimated by DAPI staining. No significant differences were observedbetween the amounts of cobiofilms formed by the T. forsythia wild type or its glcA-mutant with F. nucleatum in T medium with �-glucanase-hydrolyzed lichenin (T-L�)(Fig. 5). To estimate the individual cell population of each species in cobiofilms, FISHstaining followed by confocal microscopic analysis was performed. The data showed asignificantly larger F. nucleatum population in cobiofilms of F. nucleatum with thewild-type T. forsythia compared to that with the glcA deletion mutant in T medium withlichenin (Tf WT�Fn, 3.546 �m3/�m2, versus Tf mutant�Fn, 1.940 �m3/�m2; Fig. 6A).

TABLE 2 T. forsythia glcA mRNA levels at different incubation conditionsa

aT. forsythia/F. nucleatum, each bacterial species incubated in separate chambers; T. forsythia � F. nucleatum, bothbacterial species coincubated in same chamber.

FIG 4 Induction of �-glucanase activity in T. forsythia in response to F. nucleatum. T. forsythia wild-typecells were incubated with increasing concentrations of F. nucleatum cell extracts (2.5, 5, and 10 mg/ml)and �-glucanase activity in cell lysates of T. forsythia was assayed by lichenin-agar zymography assay ina 96-well microplate. Untreated lichenin-agar wells were used as background and �-glucanase-enzyme-treated wells were used as positive controls. Bars represent mean � standard deviation (SD) from arepresentative experiment repeated 3 times, yielding similar results. *, P � 0.05.

Honma et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 6

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Under similar conditions the volume of T. forsythia cells did not change significantly(Tf WT�Fn, 1.876 �m3/�m2, versus Tf mutant�Fn, 1.768 �m3/�m2; Fig. 6B). To furthersubstantiate D-glucose and glucose polymers released from lichenin having a growth-promoting effect on F. nucleatum, we evaluated F. nucleatum biofilm formation in thepresence of D-glucose and hydrolyzed lichenin. We observed that the number of cells

FIG 5 T. forsythia glucanase activity promoted T. forsythia-F. nucleatum cobiofilm formation by hydro-lyzing lichenin. Monospecies (T. forsythia or F. nucleatum) and dual-species (T. forsythia wild-type or glcAdeletion mutant with F. nucleatum) biofilms were formed in black-well cell culture plate wells under threeculture conditions: T, T medium; T-L, T medium with 0.2% lichenin; and T-L�, T medium with 0.2%commercial �-glucanase (from Trichoderma longibrachiatum EC 3.2.1.6, Sigma)-treated lichenin. Totalbiofilm mass was estimated by DAPI staining. Tf WT, T. forsythia wild type; Fn, F. nucleatum. Bars representmean � SD. This experiment repeated 3 times yielded similar results. *, P � 0.05.

FIG 6 T. forsythia glucanase activity in T. forsythia-F. nucleatum cobiofilms specifically promoted F.nucleatum biomass (A and B) Biofilm biomass of T. forsythia and F. nucleatum in cobiofilms in T mediumwith 0.2% lichenin was calculated by in situ staining using bacterium-specific probes, followed byconfocal laser scanning microscopy. F. nucleatum and T. forsythia probes were labeled with Cy5 and FITC,respectively. F. nucleatum (A) and T. forsythia (B) biomass volumes (�m3/�m2) were estimated fromconfocal images with Comstat 2 software. Confocal images of Tf�Fn cobiofilm in the presence of 0.2%lichenin in T medium are shown in (C) and (D). (C) T. forsythia wild-type and F. nucleatum cobiofilm. (D)T. forsythia glcA-deficient strain with F. nucleatum cobiofilm. T. forsythia was stained with FITC-labeledspecific DNA probe (green) and F. nucleatum was stained with Cy5-labeled specific DNA probe (red). Bothconfocal images were taken at 200�. *, P � 0.05.

T. forsythia �-Glucanase Supports F. nucleatum Growth Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 7

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

in F. nucleatum biofilms increased significantly when T medium was supplemented withglucose (5.954 �m3/�m2; T-G in Fig. 7A) or lichenin prehydrolyzed with either thecommercially available glucanase (1.850 �m3/�m2; T-Lb in Fig. 7A) or with rTfGlcA(2.997 �m3/�m2; T-LrTfGlcA in Fig. 7A) compared to the biofilms formed in T medium(0.240 �m3/�m2; T in Fig. 7A) or T medium with nonhydrolyzed lichenin (0.325�m3/�m2; T-L in Fig. 7A). On the other hand, no significant differences were observedin the numbers of T. forsythia cells in the presence (T-G) or absence (T) of glucose, orthe presence of hydrolyzed lichenin (T-L�) (Fig. 7B). No significant differences in theproportions of live/dead cell populations among different conditions at day 2 of biofilmdevelopment were observed using live/dead staining; similar proportions of dead cellpopulations were observed under all conditions (see Fig. S7 in the supplementalmaterial). The growth-promoting effect of hydrolyzed glucan on F. nucleatum was thenassessed in planktonic condition. The data showed that the planktonic growth of F.nucleatum was significantly enhanced in T medium containing glucose or glucanase-hydrolyzed lichenin (Fig. 8).

DISCUSSION

A large number of loci coding for TonB-dependent membrane receptors (TDRs)(TonB_dep_rec Pfam family) with accessory proteins (SusD, SusD-like, and SusE Pfamfamilies) have been identified in T. forsythia (6). Interestingly, a few of these TDR-expressing loci appear to also encode glycosyl hydrolases with putative roles in theutilization of glycans from glycoproteins and polysaccharides, such as a putative locuswith an �-glucosidase for starch utilization (11) and a well-characterized locus for sialicacid utilization with sialidase (12). Proteomic analyses have shown that many of theseTDRs are enriched in outer membrane and outer membrane vesicle fractions of T.forsythia (6). These TDRs with associated glycosidases could provide a selectiveadvantage to the bacterium and/or its cohabiting partners by facilitating the degra-dation and utilization of host glycoconjugates and dietary polysaccharides. In thisstudy, we characterized one such TDR loci, BFO_0186-BFO_0188. This locus is linked toa putative stress-responsive regulatory system comprising an extracytoplasmic function(ECF) sigma factor (BFO_0190) and an anti-Sigma factor (BFO_0189). The BFO_0186-BFO_0188 locus is cotranscribed as a single operon with a transcription start site 64 bpupstream of the start codon of the first ORF, BFO_0188. BFO_0186 was shown to codefor a functional �-glucanase, as judged from the activity of a recombinant protein andthe loss of glucanase activity in the bacterium following deletion of the gene.BFO_0186, annotated as T. forsythia �-glucanase (TfGlcA), hydrolyzed 1,3- and �-1,4-linked glucose residues in lichenin into glucose monomers and smaller saccharide

FIG 7 (A) Hydrolyzed �-glucan and free-D-glucose-promoted F. nucleatum biomass. F. nucleatum biofilmswere formed under different culture conditions and biomass was estimated by CSLM analysis. (B) T.forsythia biofilms were formed under different culture conditions and biomass was estimated by CSLManalysis. Culture conditions: T, T medium; T-G, T medium with 0.2% glucose; T-L, T medium with 0.2%lichenin; T-L�, T medium with commercial �-glucanase treated lichenin; T-L rGlcA T medium withrTfGlcA-treated lichenin. All experiments were repeated at least 5 times, yielding similar results. *, P �0.05.

Honma et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 8

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

polymers. It belongs to the GH16_laminarinase_like glycosyl hydrolase family (acces-sion no. cd00413), whose members hydrolyze 1,3-�-D-glycosidic linkages present in1,3-�-D-glucans, leading to the generation of mono-, di- or trisaccharide moieties (13).Furthermore, we sought to determine whether �-glucanase activity provided anyselective advantage to T. forsythia or its biofilm partner F. nucleatum, and predicted that�-glucanase activity might be regulated by external stimuli, based on the fact that the�-glucanase operon is present immediately downstream of a putative operon for anECF sigma/anti-sigma stress-responsive system (Fig. 1A). In the current study, weshowed that the mixed biofilm mass of GlcA-deficient mutant with F. nucleatum wassignificantly less than that of the T. forsythia wild type and F. nucleatum. In mixedbiofilms, F. nucleatum cell biomass increased in the wild-type T. forsythia-F. nucleatumcobiofilms compared to that in the T. forsythia GlcA deficient-F. nucleatum cobiofilms,and the numbers of T. forsythia cells did not change under these conditions (Fig. 6).These data demonstrated that T. forsythia GlcA activity contributed significantly duringthe development of mixed biofilms. Moreover, the expression of �-glucanase wasupregulated during coincubation of the bacterium with F. nucleatum. At this point, themechanism or components of F. nucleatum that might be involved in inducing�-glucanase expression in T. forsythia are not known. Moreover, while it is evident fromour data that the induction of �-glucanase in T. forsythia requires a physical contactwith the component(s) of F. nucleatum, whether components of other bacteria couldalso trigger �-glucanase expression remains to be determined.

Given that Fusobacterium spp. are able to utilize glucose as a carbon source (14),glucose availability due to T. forsythia GlcA hydrolysis of �-glucan in the mediumpromoted F. nucleatum growth in mixed F. nucleatum-T. forsythia biofilms. In mono-species cultures, free glucose supported the growth of F. nucleatum (Fig. S2A), butinhibited the growth of T. forsythia (Fig. S2B), which was not surprising, since T. forsythiahas been shown to metabolize glucose into methylglyoxal (MGO), a reactive dicarbonylcompound toxic to cells (10). It is likely that released glucose in mixed biofilms isimmediately taken up by F. nucleatum, relieving glucose toxicity on T. forsythia.Moreover, in the current study, while glucose was found not to provide any growth-promoting effect to T. forsythia and was rather toxic, glucose availability in vivo might

FIG 8 F. nucleatum planktonic growth was enhanced in the presence of hydrolyzed glucan and freeglucose. F. nucleatum planktonic growth was monitored in different culture conditions to assess theeffect of glucose as a carbon source: T, T medium; T-G, T medium with 0.2% D-glucose; T-L, T mediumwith 0.2% lichenin; T-L�, T medium with commercial �-glucanase-treated lichenin; T-LrTfGlcA, T mediumwith rTfGlcA-treated lichenin. An asterisk (*) indicates statistical significance with T and T-G, T-L�, orT-LrTfGlcA, P � 0.05.

T. forsythia �-Glucanase Supports F. nucleatum Growth Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 9

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

be beneficial to the organism by promoting its virulence. Given that glucose canincrease MGO production from T. forsythia, glucose is expected to contribute toinflammation. MGO can induce inflammation via its direct effects on immune cells andthrough the generation of inflammatory advanced glycation end products, known asAGEs (15). Moreover, increased availability due to inflammatory destruction of host-derived nutrients, such as heme and peptides, might benefit T. forsythia and otherspecies. Overall, glucose availability is expected to increase total biomass of F.nucleatum-T. forsythia mixed biofilm and act as a catalyst for periodontal inflammationand alveolar bone loss, the hallmarks of periodontal disease (summarized in a model inFig. 9). While the underlying mechanisms of this regulation are not known, intriguingly,the ECF sigma factor (BFO_0190) and anti-sigma factor (BFO_0189) ORFs are locatedimmediately in front of the glucanase operon. 5=-RACE PCR data showed that bothBFO_0189 and BFO_0190 are transcribed independently of the �-glucanase operon(Fig. 1A; see also Fig. S1). However, the transcription levels of BFO_0189 and BFO_0190remained constant in the presence or absence of F. nucleatum (Table 1), suggesting thatthese regulators would have to be activated at the protein level following cell-to-cellcontact to regulate the expression of �-glucanase operon. To support this notion, ECFsigma factors are involved in sensing environmental stress from antibiotics (16), heavymetals (17), oxidative stress (18), osmolytes (19), and temperature (20) in both Gram-positive and -negative bacteria.

Our data demonstrated that T. forsythia �-glucanase plays a contributory role in T.forsythia-F. nucleatum cobiofilm development when �-glucans are available as a carbonsource. �-1,3 glucan is widely found in plant cell walls and the source of �-1,3 glucanin the oral cavity might be dietary fiber, including wheat and vegetables (21). Glucosederived from �-glucans helps to support the biomass of F. nucleatum in mixed biofilms.While T. forsythia glucanase activity is beneficial to its cohabiting partner F. nucleatum,it is unclear as to what benefit this glucanase activity provides to T. forsythia. However,we envisage that the Sus-like TonB-dependent transporters (BFO_0187/BFO_0188)might be involved in the uptake of nutrients (yet to be identified) in vivo. In addition,it is tempting to speculate that the presence of oral yeast, Candida albicans, whosecell wall consists of �-glucans (21), might contribute to the growth of T. forsythia-F.nucleatum cobiofilms, thereby exacerbating the disease. While it has been known for along time that dental plaque bacteria do express glucanases (22), their roles in bacterialphysiology and/or virulence has not been determined to date. Since �-glucan is a keycomponent of plant and yeast cell walls, it is reasonable to envision that dental bacteriacould utilize dietary glucans for nutrition. Interspecies metabolic interactions are wellknown in different ecological settings, especially in biofilms. In the case of oral bacteria,the existence of nutritional and mutualistic relationships among bacterial species hasbeen revealed via in vitro coculturing experiments. For example, Treponema denticolaand Porphyromonas gingivalis have been shown to not only interact with one another

FIG 9 Schematic model depicting the potential role of F. nucleatum-induced T. forsythia �-glucanaseactivity in cobiofilm development and induction of inflammation.

Honma et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 10

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

physically (coaggregate) but also to form a mutualistic relationship that helps promotethe growth of both bacteria in laboratory growth media. In this mutualistic interaction,the growth-promoting factors are thought to be isobutyric acid secreted by P. gingivalisand succinic acid secreted by T. denticola (23). Other examples where mutualisticinteractions are thought to occur include metabolic interaction between Wolinellarecta, an asaccharolytic formate-oxidizing periodontal pathogen, and the major peri-odontal pathogen P. gingivalis. In these interactions, W. recta is thought to produce aheme-like substance that can promote the growth of P. gingivalis, which in turnproduces formate to support the growth of W. recta (24). Mutualistic relationship hasalso been proposed between streptococci and veillonellae during early dental plaqueformation. This notion is based on in vitro studies that suggested that lactate producedby the oral streptococcus bacteria Streptococcus gordonii can serve as a source ofcarbon for Veillonella spp., which in turn can secrete the quorum-sensing molecule AI-2to support the development of S. gordonii biofilm (25). Furthermore, the interactionbetween Veillonella species and S. gordonii has been shown to induce the expression of�-amylase in S. gordonii (26), which would ultimately lead to increased hydrolysis ofstarch and glycogen to yield glucose.

In conclusion, T. forsythia �-glucanase GlcA expression is enhanced in response to F.nucleatum sensing in cobiofilms, and glucose monomers and smaller polymers releasedfrom GlcA-hydrolyzed �-glucans might serve as nutrients for F. nucleatum and precur-sors for driving inflammation (Fig. 9).

MATERIALS AND METHODSBacterial strains and plasmids used in this study. T. forsythia strains were maintained in BF broth

or agar plate (27) and F. nucleatum ATCC 25586 was maintained in Trypticase soy agar or broth (TS agaror TSB) (BD Difco, Franklin Lakes, NJ) containing 5% horse blood. E. coli strains were cultured in LB-Millermedium or agar plate (BD Difco, Franklin Lakes, NJ) with appropriate antibiotics. For gene cloning,pGEM-T TA cloning vector (Promega, Madison, WI) was employed and pGEX-2T (GE Healthcare LifeScience, Pittsburgh, PA) was used for recombinant protein expression.

Gene expression profiling by qRT-PCR. Fold change in gene expression in cobiofilms versus singlespecies was determined by reverse transcription-quantitative PCR (qRT-PCR) using the double delta cyclethreshold (ΔΔCT) method as described previously (28). Briefly, early log-phase T. forsythia ATCC 43037 andF. nucleatum cells were washed in TSB and each adjusted to a density of 1 � 109 cells/ml using aPetroff-Hausser 3900 cell-counting chamber (Hauser Scientific, Horsham, PA). Five ml of T. forsythia cellsuspension was mixed with 0.2 ml of F. nucleatum cell suspension (20:1 ratio of T. forsythia to F.nucleatum) and coaggregated mixed cells were incubated anaerobically for 6 h. In parallel, each specieswas incubated alone for comparison. In some experiments, T. forsythia and F. nucleatum were separatedby 0.45-�m pore cell filters using cell culture inserts (Nalgene Nunc International, Rochester, NY) to assesswhether soluble bacterial factors such as quorum-sensing molecules are involved in gene regulation.Total RNA was isolated from cells with the TRIzol reagent (Invitrogen, Thermo-Fisher) and after treatmentwith DNase, RNA was purified with the RNAeasy kit (Qiagen). The cDNA samples were prepared frompurified RNA samples with a GoScript Reverse Transcriptase kit (Promega) and quantitative PCR wasperformed with the16S rRNA- and operon-specific primers listed in Table 3 using iQ SYBR green reagent

TABLE 3 PCR primers used in this study

Assay and gene target

Sequence (5=–3=)a

ReferenceSense Antisense

qRT-PCRBFO_0186 TATCTGGATGCTCCCGACTC AAAGCGGTCGAATTCGTTGGBFO_0187 TTTTAAACAAGTGCTGGAAG TGTTTCACCATTCCAGAACGBFO_0188 ATGCCGTAATGCGTGAATTA ACTTCCAAAGTAAACGCACCGTBFO_0189 CTCGTATGAGGCGGATCAAGA TTATGAAAATAAAGGCTTCCTTBFO_0190 TCTTTTCTATCTGTCTTCTAT GACAACATCCAGAAAAAGAAGT. forsythia 16S rRNA gcgtatgtaacctgcccgca tgcttcagtgtcagttatacct 41

RT-PCRBFO_0187 RT-F ATACGAAAGAGCATGTACACBFO_0186 RT-R GCCAGTCTCCTTTTTCTTTCGBFO_0188 RT-F TTATAAGCAGGCAATGCAGBFO_0187 RT-R AGTAAGAGTAGAAATATTGTGCpGEX-rTfGlcA ggttccgcgtggatccTACCTGTTTACCATTGCATTCCTG gaattcccggggatccTTTGCTTGAGGAGACCGAGTT

apGEX-2T overlap regions are shown in lowercase letters.

T. forsythia �-Glucanase Supports F. nucleatum Growth Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 11

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

(Bio-Rad) and a real-time PCR detection system (CFX96 Touch real-time PCR detection system; Bio-RadHercules, CA) per the manufacturer’s recommendations. Relative expression levels of gene-specifictranscripts were normalized to the levels of16S rRNA and the relative fold changes in the samples werecalculated using the �ΔΔCT method as described previously (28).

Reverse transcription-PCR. Total RNA from T. forsythia ATCC 43037 was used to synthesize cDNA asdescribed above and RT-PCR was carried out to confirm whether ORFs BFO_0186, BFO_0187, andBFO_0188 are cotranscribed and present as an operon. Briefly, the synthesized cDNA was amplifiedby PCR with primer sets spanning target genes BFO_0186BFO_0188 (Fig. 1). The BFO_0186BFO_0187region was amplified with the PCR primers BFO_0186-0187 sense and antisense, and the BFO_0187-0188 region was amplified with PCR primers BFO_0187-188 sense and antisense. Primer sequencesare listed in Table 3.

5= rapid amplification of complementary DNA ends (5=-RACE). To identify the transcription startsite, 5=-RACE was performed on purified total RNA as described above with the FirstChoice RLM-RACE kit(Ambion, Thermo-Fisher) and PCR fragments were cloned into pGEM-T vector for detection of the 5= endsof sequences. The specific PCR primers used to define the transcription start site are listed in Table 4.

Production of recombinant BFO_0186 protein (rTfGlcA). An expression plasmid, pGEX-rTfGlcA,was generated by cloning the BFO_0186 ORF in-frame with the glutathione S-transferase (GST) codingsequence in the pGEX-2T expression vector. Briefly, a PCR fragment amplified with rTfGlcA sense andrTfGlcA antisense primers (Table 3) from T. forsythia ATCC 43037 genomic DNA was cloned into theBamHI site of pGEX-2T vector via the inFusion cloning strategy (Clontech TaKaRa Bio, Mountain View, CA)to obtain the plasmid pGEX-rTfGlcA with the correct in-frame sequence. For protein expression, the E. coliBL21(DE3)pLysS strain carrying pGEX-rTfGlcA was grown in LB medium with ampicillin (100 �g/ml) at37°C to an optical density at 600 nm (OD600) of 0.3. Protein expression was induced with isopropyl�-D-1-thiogalactopyranoside (IPTG; final concentration of 1 mM) for an additional 3 h at 37°C. Bacteriawere collected by centrifugation at 7,000 � g for 10 min, washed with phosphate-buffered saline (PBS)twice, and homogenized by French Press G-M (Glen Mills, Clifton NJ) at 2,500 lb/in2. E. coli lysate wascentrifuged at 10,000 � g for 20 min and supernatants were loaded onto a prepacked glutathione-coupled Sepharose affinity column (GSTrap, GE Health Science) prewashed with Tris-buffered saline (TBS;50 mM Tris-HCl at pH 8.0) containing 0.5% Triton X-100. The column was then washed with TBScontaining 0.1 mM CaCl2 and the bound fusion protein was eluted with 10 mM reduced glutathione(Sigma). To obtain rTfGlcA without the GST tag, eluted GST-rTfGlcA protein was treated with human�-thrombin (Hematologic Technologies International Inc., Essex Junction VT) and reloaded onto theaffinity column, and the unbounded fraction was collected as rTfGlcA. Bound GST was eluted with 10 mMreduced glutathione. rTfGlcA protein was dialyzed extensively against phosphate-buffered saline (pH 7.2)at 4°C and analyzed by SDS-PAGE on 10% gels stained with Coomassie brilliant blue R250 and by 0.1%lichenin PAGE zymography described below.

Generation of BFO_0186 (TfglcA) inactivated mutant. The BFO_0186 deletion mutant was con-structed by allelic replacement of the BFO_0186 ORF with an erythromycin cassette as describedpreviously (29). Briefly, a DNA fragment containing the ermF gene flanked by upstream and downstreamDNA regions of BFO_0186 was generated by overlap extension PCR. DNA sequences of all PCR primersused for the construction are listed in Table 4. The 5= and 3= regions of BFO_0186 were amplified fromgenomic DNA with primer sets TfglcA1F/TfglcA3R and TfglcA6F/TfglcA2R, respectively. The ermF frag-ment was amplified by PCR with primers TfglcA4F/TfglcA5R from pVA2198 plasmid (30). All three DNA

TABLE 4 Additional PCR primers and probes used in this study

Primers and probes DNA sequence (5=–3=)a Reference

BFO_0186 inactivationTfglcA 1F GAATCTAACGGCGGATCGAATfglcA 2R TGAACCAGAATCCGGATCAGTfglcA 3R aaaaatttcatccttcgtagTAATCTGAAATGTTTTGGACGAATfglcA 4F TTCGTCCAAAACATTTCAGATTActacgaaggatgaaatttttTfglcA 5R TCCATGGTATTTAAAATGAAGATAGATTAGatgacaaaaaagaaattgccTfglcA 6F ggcaatttcttttttgtcatCTAATCTATCTTCATTTTAAATACCATGGA

5=-RACE PCRBFO_0190 5=RACE inner TGATTACCATGCGAAAGCGTGATABFO_0190 5=RACE outer TCCCATAGCTTAACAAATGTGGCTBFO_0189 5=RACE inner TGAATAGCATGTTCGGTTTBFO_0189 5=RACE outer GACCGTCTTCCGACATGAABFO_0187 5=RACE inner GTCGCAAAGGTACATTTTGTBFO_0187 5=RACE outer TGATTCAATACGGTTAATGATT

DNA probes for FISH hybridizationFUS664_Fn JMM04b CTTGTAGTTCCGCTTACCTC 38TAFO_Tf_MB03c CGTATCTCATTTTATTCCCCTGTA 39

aLowercase letters indicate an overlap region with ermF; underlined lowercase letters indicate an overlap region with T. forsythia (Tf) genomic DNA.bF. nucleatum probe, Cy3 or Cy5 labeled.cT. forsythia probe, FITC labeled.

Honma et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 12

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

fragments were combined and an overlap PCR was carried out with primer set TfglcA1F/TfglcA2R to yielda 3,757-bp fragment, which was gel purified and used for transformation of T. forsythia ATCC 43037 byelectroporation (31). Transformants were plated onto BF agar plates containing 5 �g/ml of erythro-mycin and incubated at 37°C under anaerobic condition for 10 to 14 days. Erythromycin (ERY)resistance colonies were screened by PCR and DNA sequence around the ermF gene insertion site.Eight positive clones were identified as BFO_0186 gene-inactivated clones, which were furthersubjected to �-glucanase analysis.

Detection of �-glucanase activity. �-Glucanase activity of recombinant T. forsythia GlcA protein, T.forsythia, and F. nucleatum strains were assessed by agar plate zymography, microplate zymography, andPAGE zymography, using lichenin as the substrate as described previously (32), with minor modifications.Briefly, for agar plate zymography, 10 �l of cell suspension from early-log-phase cultures of E. coli, T.forsythia, and F. nucleatum were spotted on LB agar (for E. coli) or BF agar (for T. forsythia and F.nucleatum) plates containing 0.1% lichenin (rich in �-1,3 with few �-1,4 glycosidic bonds; MP Bio, SantaAna, CA). Plates were incubated aerobically overnight at 37°C for E. coli harboring pGEX-rTfGlcA andanaerobically for 1 week for T. forsythia and F. nucleatum strains. After incubation, plates were stainedwith 0.1% Congo red solution (Sigma-Aldrich, St. Louis, MO) and then sprayed with water followed bydestaining in 50 mM NaOH/1 M NaCl solution.

Congo red staining was also carried out for �-glucanase microplate assay in 96-well plates. Briefly,aliquots of 0.1% lichenin solution dissolved and melted in 80°C 50 mM sodium acetate buffer (pH 5.5)were mixed with molten 1.5% agarose (100 �l each) in wells of a 96-well plate and cooled down to roomtemperature. Cells from T. forsythia 43037 culture grown in BF broth to full growth were washed twicewith PBS and adjusted to an OD600 of 2.0. In parallel, F. nucleatum cell extracts were prepared byultrasonic disruption (26 W for 3 min on ice) followed by centrifugation (15,000 � g for 10 min at 4°C)of the lysate and filtration through 0.45 �m filters. Lysates were saved at �20°C until needed. Forinduction, 3-ml cell suspensions of the T. forsythia prepared above were incubated anaerobically with F.nucleatum cell extracts (10, 5, and 2.5 mg/ml) for 18 h at 37°C. After incubation, T. forsythia cells wereretrieved by centrifugation and washed twice with PBS and bacterial suspension was adjusted to anOD600 of 2.0. Cells from 2 ml of cell suspension collected by centrifugation were lysed in 300 �l of 5%Triton X-100 at 25°C for 10 min. Lysate collected by centrifugation at 13,000 � g for 15 min at 4°C wereassayed for glucanase activity by adding 10-�l samples (noninduced or F. nucleatum-induced T. forsythiacell lysates) in quadruplicates to lichenin-agarose-containing wells prepared above. Wells with onlylichenin in agarose were used as untreated background controls. Plates were incubated overnightat 37°C and wells were washed twice with 200 �l of distilled water, followed by staining with 20 �lof 0.1% Congo red dye solution for 20 min at room temperature. Staining solution was removed andwells were washed twice with 100 �l of water and destained in 100 �l of 1 M NaCl for 30 min at roomtemperature. Lichenin hydrolysis due to �-glucanase activity was assessed by measuring absorbanceat 500 nm (33).

PAGE zymography was carried out by a previously described protocol (34), with minor modifications.Briefly, T. forsythia or F. nucleatum cells harvested from mid-log-phase cultures and washed with PBSwere lysed in 5% Triton X-100/PBS on ice for 30 min. Cell supernatants were collected by centrifugationat 12,000 � g for 10 min at 4°C and subjected to SDS-PAGE on 10% acrylamide gels (10 � 7.5 cm)containing 0.1% lichenin after mixing with equal amount of 2� SDS-PAGE Laemmli sample bufferwithout reducing agent (50 �g total protein per well). After electrophoresis, gels were incubated withrocking in 100 mM sodium phosphate (pH 5.5) containing 20% isopropanol for 20 min at roomtemperature. This step was repeated one more time to remove SDS and gels were then incubated in 100mM sodium phosphate (pH 5.5) buffer containing 10 mM 2-mercaptoethanol (2-ME) and 1 mM EDTA for60 min at room temperature. Finally, gels were placed in a fresh phosphate (pH 6.0)/10 mM 2-ME/1 mMEDTA buffer for 45 min at 37°C to promote enzyme activity. Lichenin hydrolysis was visualized by stainingwith 0.1% Congo red as described above for agar plate assays. This PAGE-lichenin zymography was alsoused to confirm �-glucanase activities of E. coli pGEX-rTfGlcA and purified GST-fused or thrombin-cleavedrTfGlcA protein.

Detection of �-glucanase activity by thin layer chromatography. To confirm �-glucan-hydrolyzing activity of rTfGlcA, a thin-layer chromatograph (TLC)-based assay was carried out addition-ally as follows. Briefly, 300 �l of 0.2% lichenin solution (obtained by dissolving lichenin in 50 mM sodiumacetate [pH 5.0] at 95°C for 5 min and cooling to room temperature was incubated with 5 �g each ofcommercial �-glucanase or purified rTfGlcA at 37°C for 16 h. After treatment, 15 �l of lichenin and 3 �lof positive controls (0.2% glucose or sucrose solutions) were spotted onto a silica-coated TLC plate(Sigma-Aldrich, St. Louis, MO) and carbohydrates were migrated in mobile phase 1 (2-propanol:2% boricacid:acetic acid, 40:5:1) (35) or 2 (chloroform:acetic acid:distilled water, 3:3.5:0.5) (36). Reduced saccharidespots were visualized by spraying with TLC staining reagent, which contained 1.23 g of p-anisidine(Sigma) and 1.66 g phthalic acid (Sigma) in 100 ml of ethanol. Plates were dried and heated at 95°C untilspots developed (37).

Biofilm formation of T. forsythia strains with F. nucleatum in the presence of �-glucan. Theimpact of �-glucan hydrolysis due to T. forsythia �-glucanase on single and dual species biofilms wasassessed by fluorescent in situ hybridization (FISH) protocol described previously (38), with slightmodifications. Briefly, bacterial cells from late-log-phase cultures were harvested, washed with PBS twice,and resuspended to an OD600 of 0.1 in T medium (1.7% tryptone, 0.5% sodium chloride, and 0.25%dipotassium phosphate) with N-acetylmuramic acid (NAM, 5 �g/ml; Chem-Impex International Inc.,Wood Dale, IL) or various concentrations of D-glucose (0.05, 0.1, and 0.2%) in 96-well black-wall cellculture plates (Greiner Bio-One, Monroe, NC) in octuplicates (100 �l/well). Plates were incubated

T. forsythia �-Glucanase Supports F. nucleatum Growth Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 13

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

anaerobically at 37°C for 48 h, wells were washed twice with distilled water to remove unbound cells, andbiofilm cells were fixed in 4% paraformaldehyde (PFA) for 30 min at room temperature. Fixed biofilmswere treated with 100 �l/well of hybridization buffer (0.9 M NaCl, 20 mM Tris-HCl [pH 7.5], 0.01% SDS,and 20% formamide) at 46°C for 20 min for prehybridization blocking. Biofilms were then incubated with100 �l/well of 0.1 nM (each) fluorescein isothiocyanate (FITC)-labeled T. forsythia (39) or Cy3-labeled F.nucleatum-specific (38) DNA probes (Table 4) in hybridization buffer for 3 h at 46°C. After hybridization,wells were washed with 100 �l/well of wash buffer (20 mM Tris-HCl [pH 7.5], 5 mM EDTA, 0.01% SDS, and200 mM NaCl) for 20 min at 49°C followed by two washes with 200 �l/well of distilled water, and thenstained with 100 �l/well of DAPI (500 ng/ml) at 37°C for 15 min. Well fluorescence was measured byfluorescent microplate reader (Flex Station 3; Molecular Devices, Sunnyvale, CA) at excitation wavelength(Ex) 358 nm/emission wavelength (Em) 461 nm (DAPI), Ex 494 nm/Em 522 nm (FITC), and Ex 550 nm/Em570 nm (Cy3).

T. forsythia and F. nucleatum samples that were prepared for biofilm formation assay were also usedfor tracking their growth curves in the presence of different concentration of D-glucose measured atOD600 for 5 days.

For calculation of a T. forsythia/F. nucleatum ratio in biofilms, confocal scanning laser microscope(CSLM) analysis was performed with the Zeiss LSM 510 Meta NLO confocal microscope attached to theZeiss Axioimager Z1 and Axiovert 200M. Briefly, T. forsythia 43037, the T. forsythia glcA-inactivated strain(TfΔglcA), and F. nucleatum cells were resuspended in T medium with NAM containing either 0.2%glucose (T-G), 0.2% lichenin (T-L), �-glucanase (0.5 mg/ml; from Trichoderma longibrachiatum EC 3.2.1.6,Sigma)-treated 0.2% lichenin (T-L�) or rTfGlcA (0.5 mg/ml)-treated 0.2% lichenin (T-LrTfglcA) to an OD600

of 0.1. To form cobiofilms, T. forsythia and F. nucleatum were mixed at a 20:1 ratio and then loaded intoa chambered cell culture slide (1 ml/well, BD Falcon; Thermo Fisher) and incubated at 37°C for 48 hanaerobically. Biofilm in each chamber was stained by the FISH protocol described above and biofilmpictures were taken at 200� magnification on CSLM and analyzed with Zeiss Zen 2 core software.Biofilms were also stained with the Live/Dead BacLight bacterial viability kit (Thermo Fisher, Eugene, OR,USA) using two fluorochromes, SYTO9 and propidium iodide. These fluorochromes distinguish livebacteria (green emitted light) from dead bacteria (red emitted light), respectively, and the proportion oflive and dead bacteria was calculated. T. forsythia (FITC), F. nucleatum (Cy5 Ex 649 nm/Em 665 nm), orSYTO9 (live cell, Ex 485 nm/Em 498 nm)/propidium iodide (dead cell, Ex 535 nm/Em 617 nm) fluorescentintensities were calculated and exported to Comstat 2 software (http://www.comstat.dk/) (40) to deter-mine the biofilm mass of each species.

Statistical analysis. Comparison of biofilm biomass between two groups was made using aStudent’s t test and comparison between multiple groups was made using ANOVA, with statisticalsignificance defined as P � 0.05. Data were analyzed with Microsoft Excel and Prism 5 (GraphPad,La Jolla, CA).

SUPPLEMENTAL MATERIAL

Supplemental material for this article may be found at https://doi.org/10.1128/AEM.01759-17.

SUPPLEMENTAL FILE 1, PDF file, 5.3 MB.

ACKNOWLEDGMENTThis work was supported in part by U.S. Public Health grants DE14749 and DE22870

(both to A.S.).

REFERENCES1. Teles R, Teles F, Frias-Lopez J, Paster B, Haffajee A. 2013. Lessons learned

and unlearned in periodontal microbiology. Periodontol 2000 62:95–162. https://doi.org/10.1111/prd.12010.

2. Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RL, Jr. 1998. Microbialcomplexes in subgingival plaque. J Clin Periodontol 25:134–144. https://doi.org/10.1111/j.1600-051X.1998.tb02419.x.

3. Kolenbrander PE. 2011. Multispecies communities: interspecies interac-tions influence growth on saliva as sole nutritional source. Int J Oral Sci3:49 –54. https://doi.org/10.4248/IJOS11025.

4. Sharma A, Inagaki S, Sigurdson W, Kuramitsu HK. 2005. Synergy betweenTannerella forsythia and Fusobacterium nucleatum in biofilm formation.Oral Microbiol Immunol 20:39 – 42. https://doi.org/10.1111/j.1399-302X.2004.00175.x.

5. Zijnge V, van Leeuwen MB, Degener JE, Abbas F, Thurnheer T, Gmur R,Harmsen HJ. 2010. Oral biofilm architecture on natural teeth. PLoS One5:e9321. https://doi.org/10.1371/journal.pone.0009321.

6. Veith PD, Chen YY, Chen D, O’Brien-Simpson NM, Cecil JD, Holden JA,Lenzo JC, Reynolds EC. 2015. Tannerella forsythia outer membrane ves-icles are enriched with substrates of the type IX secretion system and

TonB-dependent receptors. J Proteome Res 14:5355–5366. https://doi.org/10.1021/acs.jproteome.5b00878.

7. Veith PD, O’Brien-Simpson NM, Tan Y, Djatmiko DC, Dashper SG, ReynoldsEC. 2009. Outer membrane proteome and antigens of Tannerella forsythia.J Proteome Res 8:4279–4292. https://doi.org/10.1021/pr900372c.

8. Martens EC, Koropatkin NM, Smith TJ, Gordon JI. 2009. Complex glycancatabolism by the human gut microbiota: the Bacteroidetes Sus-likeparadigm. J Biol Chem 284:24673–24677. https://doi.org/10.1074/jbc.R109.022848.

9. Kuboniwa M, Lamont RJ. 2010. Subgingival biofilm formation. Periodon-tol 2000 52:38 –52. https://doi.org/10.1111/j.1600-0757.2009.00311.x.

10. Maiden MF, Pham C, Kashket S. 2004. Glucose toxicity effect and accumu-lation of methylglyoxal by the periodontal anaerobe Bacteroides forsythus.Anaerobe 10:27–32. https://doi.org/10.1016/j.anaerobe.2003.12.001.

11. Sharma A. 2011. Genome functions of Tannerella forsythia in bacterialcommunities, p 135–148. In Kolenbrander P (ed), Oral microbialcommunities: genomic inquiry and interspecies communication, 1st ed.ASM Press, Washington, DC.

12. Roy S, Douglas CW, Stafford GP. 2010. A novel sialic acid utilization and

Honma et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 14

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

uptake system in the periodontal pathogen Tannerella forsythia. J Bac-teriol 192:2285–2293. https://doi.org/10.1128/JB.00079-10.

13. Planas A. 2000. Bacterial 1,3-1,4-beta-glucanases: structure, function andprotein engineering. Biochim Biophys Acta 1543:361–382. https://doi.org/10.1016/S0167-4838(00)00231-4.

14. Gharbia SE, Shah HN. 1988. Glucose utilization and growth response toprotein hydrolysates by Fusobacterium species. Curr Microbiol 17:229 –234. https://doi.org/10.1007/BF01589457.

15. Ramasamy R, Yan SF, Schmidt AM. 2006. Methylglyoxal comes of AGE.Cell 124:258 –260. https://doi.org/10.1016/j.cell.2006.01.002.

16. Tettmann B, Dotsch A, Armant O, Fjell CD, Overhage J. 2014. Knockoutof extracytoplasmic function sigma factor ECF-10 affects stress resis-tance and biofilm formation in Pseudomonas putida KT2440. Appl Envi-ron Microbiol 80:4911– 4919. https://doi.org/10.1128/AEM.01291-14.

17. Kohler C, Lourenco RF, Avelar GM, Gomes SL. 2012. Extracytoplasmicfunction (ECF) sigma factor sigmaF is involved in Caulobacter crescentusresponse to heavy metal stress. BMC Microbiol 12:210. https://doi.org/10.1186/1471-2180-12-210.

18. Yanamandra SS, Sarrafee SS, Anaya-Bergman C, Jones K, Lewis JP. 2012.Role of the Porphyromonas gingivalis extracytoplasmic function sigmafactor, SigH. Mol Oral Microbiol 27:202–219. https://doi.org/10.1111/j.2041-1014.2012.00643.x.

19. Bouffartigues E, Gicquel G, Bazire A, Bains M, Maillot O, Vieillard J, FeuilloleyMG, Orange N, Hancock RE, Dufour A, Chevalier S. 2012. Transcription ofthe oprF gene of Pseudomonas aeruginosa is dependent mainly on theSigX sigma factor and is sucrose induced. J Bacteriol 194:4301– 4311.https://doi.org/10.1128/JB.00509-12.

20. Manganelli R, Voskuil MI, Schoolnik GK, Smith I. 2001. The Mycobacte-rium tuberculosis ECF sigma factor sigmaE: role in global gene expressionand survival in macrophages. Mol Microbiol 41:423– 437. https://doi.org/10.1046/j.1365-2958.2001.02525.x.

21. Sonck E, Stuyven E, Goddeeris B, Cox E. 2010. The effect of beta-glucanson porcine leukocytes. Vet Immunol Immunopathol 135:199–207. https://doi.org/10.1016/j.vetimm.2009.11.014.

22. Johnson IH. 1990. Glucanase-producing organisms in human dentalplaques. Microbios 61:89 –98.

23. Grenier D. 1992. Nutritional interactions between two suspected peri-odontopathogens, Treponema denticola and Porphyromonas gingivalis.Infect Immun 60:5298 –5301.

24. Grenier D, Mayrand D. 1986. Nutritional relationships between oralbacteria. Infect Immun 53:616 – 620.

25. Mashima I, Nakazawa F. 2015. The interaction between Streptococcus spp.and Veillonella tobetsuensis in the early stages of oral biofilm formation. JBacteriol 197:2104–2111. https://doi.org/10.1128/JB.02512-14.

26. Egland PG, Palmer RJ, Jr, Kolenbrander PE. 2004. Interspecies commu-nication in Streptococcus gordonii-Veillonella atypica biofilms: signalingin flow conditions requires juxtaposition. Proc Natl Acad Sci U S A101:16917–16922. https://doi.org/10.1073/pnas.0407457101.

27. Honma K, Kuramitsu HK, Genco RJ, Sharma A. 2001. Development of agene inactivation system for Bacteroides forsythus: construction and

characterization of a BspA mutant. Infect Immun 69:4686 – 4690. https://doi.org/10.1128/IAI.69.7.4686-4690.2001.

28. Honma K, Mishima E, Inagaki S, Sharma A. 2009. The OxyR homologuein Tannerella forsythia regulates expression of oxidative stress responsesand biofilm formation. Microbiology 155:1912–1922. https://doi.org/10.1099/mic.0.027920-0.

29. Honma K, Mishima E, Sharma A. 2011. Role of Tannerella forsythia NanHsialidase in epithelial cell attachment. Infect Immun 79:393– 401. https://doi.org/10.1128/IAI.00629-10.

30. Fletcher HM, Schenkein HA, Morgan RM, Bailey KA, Berry CR, Macrina FL.1995. Virulence of a Porphyromonas gingivalis W83 mutant defective inthe prtH gene. Infect Immun 63:1521–1528.

31. Honma K, Inagaki S, Okuda K, Kuramitsu HK, Sharma A. 2007. Role of aTannerella forsythia exopolysaccharide synthesis operon in biofilm develop-ment. Microb Pathog 42:156–166. https://doi.org/10.1016/j.micpath.2007.01.003.

32. Walter J, Mangold M, Tannock GW. 2005. Construction, analysis, andbeta-glucanase screening of a bacterial artificial chromosome libraryfrom the large-bowel microbiota of mice. Appl Environ Microbiol 71:2347–2354. https://doi.org/10.1128/AEM.71.5.2347-2354.2005.

33. Han R, Ding D, Xu Y, Zou W, Wang Y, Li Y, Zou L. 2008. Use of rice huskfor the adsorption of Congo red from aqueous solution in column mode.Bioresour Technol 99:2938–2946. https://doi.org/10.1016/j.biortech.2007.06.027.

34. Asan M, Özcan N. 2007. Expression of the �-(1,3-1,4)-glucanase gene inStreptococcus salivarius subsp. thermophilus. Turk J Vet Anim Sci 31:319 –324.

35. Jork H, Funk W, Fischer WR, Wimmer H. 1989. Thin-layer chromatography:reagents and detection methods, p 199–201. Wiley-VCH, Weinheim, Ger-many.

36. Farag S. 1979. Separation and analysis of some sugars by using thin-layerchromatography. JASSBT 20:251–254.

37. Santiago M, Strobel S. 2013. Thin layer chromatography. Methods Enzy-mol 533:303–324. https://doi.org/10.1016/B978-0-12-420067-8.00024-6.

38. Thurnheer T, Gmur R, Guggenheim B. 2004. Multiplex FISH analysis of asix-species bacterial biofilm. J Microbiol Methods 56:37– 47. https://doi.org/10.1016/j.mimet.2003.09.003.

39. Sunde PT, Olsen I, Gobel UB, Theegarten D, Winter S, Debelian GJ,Tronstad L, Moter A. 2003. Fluorescence in situ hybridization (FISH) fordirect visualization of bacteria in periapical lesions of asymptomaticroot-filled teeth. Microbiology 149:1095–1102. https://doi.org/10.1099/mic.0.26077-0.

40. Heydorn A, Nielsen AT, Hentzer M, Sternberg C, Givskov M, Ersboll BK,Molin S. 2000. Quantification of biofilm structures by the novel com-puter program COMSTAT. Microbiology 146:2395–2407. https://doi.org/10.1099/00221287-146-10-2395.

41. Ashimoto A, Chen C, Bakker I, Slots J. 1996. Polymerase chain reactiondetection of 8 putative periodontal pathogens in subgingival plaque ofgingivitis and advanced periodontitis lesions. Oral Microbiol Immunol11:266 –273. https://doi.org/10.1111/j.1399-302X.1996.tb00180.x.

T. forsythia �-Glucanase Supports F. nucleatum Growth Applied and Environmental Microbiology

January 2018 Volume 84 Issue 1 e01759-17 aem.asm.org 15

on June 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from