microrna-30c-5p modulates neuropathic pain in rodents · vent the development of neuropathic pain...

SC I ENCE TRANS LAT IONAL MED I C I N E | R E S EARCH ART I C L E

PA IN

1Departamento de Fisiología y Farmacología, Universidad de Cantabria, E-39011Santander, Spain. 2Instituto de Investigación Valdecilla, E-39011 Santander, Spain.3Servicio de Anestesiología, Hospital Universitario Valdecilla, E-39008 Santander,Spain. 4Departamento de Ciencias Médicas y Quirúrgicas, Universidad de Cantabria,E-39011 Santander, Spain. 5CIBER de Epidemiología y Salud Pública, Spain.*These authors contributed equally to this work.†Corresponding author. Email: [email protected]

Tramullas et al., Sci. Transl. Med. 10, eaao6299 (2018) 8 August 2018

Copyright © 2018

The Authors, some

rights reserved;

exclusive licensee

American Association

for the Advancement

of Science. No claim

to original U.S.

Government Works

Dow

nloaded from

MicroRNA-30c-5p modulates neuropathicpain in rodentsMónica Tramullas1,2, Raquel Francés1,2*, Roberto de la Fuente2,3*, Sara Velategui1*,María Carcelén1,2, Raquel García1,2, Javier Llorca2,4,5, María A. Hurlé1,2†

Neuropathic pain is a debilitating chronic syndrome that is often refractory to currently available analgesics.Aberrant expression of several microRNAs (miRNAs) in nociception-related neural structures is associated withneuropathic pain in rodent models. We have exploited the antiallodynic phenotype of mice lacking the bonemorphogenetic protein and activin membrane-bound inhibitor (BAMBI), a transforming growth factor–b (TGF-b)pseudoreceptor. We used these mice to identify new miRNAs that might be useful for diagnosing, treating, orpredicting neuropathic pain. We show that, after sciatic nerve injury in rats, miR-30c-5p was up-regulated in thespinal cord, dorsal root ganglia, cerebrospinal fluid (CSF) and plasma and that the expression of miR-30c-5p positivelycorrelated with the severity of allodynia. The administration of a miR-30c-5p inhibitor into the cisterna magna of thebrain delayed neuropathic pain development and reversed fully established allodynia in rodents. Themechanismwasmediated by TGF-b and involved the endogenous opioid system. In patients with neuropathic pain associatedwith legischemia, the expression of miR-30c-5p was increased in plasma and CSF compared to control patients without pain.Logistic regression analysis in our cohort of patients showed that the expression of miR-30c-5p in plasma and CSF, incombination with other clinical variables, might be useful to help to predict neuropathic pain occurrence in patientswith chronic peripheral ischemia.

htt

by guest on August 5, 2020

p://stm.sciencem

ag.org/

INTRODUCTIONChronic pain is a common debilitating disease that poses a severe clin-ical and economic burden for patients and the health system (1). Often,patients with neuropathic pain that arises after injuries of the somato-sensory system do not respond to currently available treatments (2).

Our incomplete understanding of the mechanisms that sustain thedevelopment and chronification of neuropathic pain has hampered thedesign of new pharmacological approaches directed at the pathogenesisof the disease (3). Recent studies showed a link between deregulation ofmicroRNA (miRNA) activity within nociception-related networks andthe long-lasting changes in gene expression associated with aberrantprocessing of nociceptive inputs (4–6). miRNAs are small, noncodingRNAs involved in the posttranscriptional regulation of gene expression;they bind to complementary sequences of target mRNAs to induceeither translational repression ormRNAdegradation (7).ManymiRNAshave been described so far, and although in silico computational analysisidentified a high number of potential targets, only few have been un-equivocally validated by experimental approaches (8). miRNAs havebeen shown to play crucial roles in the fine tuning of physiological func-tions and in the pathogenesis of many diseases. miRNA-targeted ther-apeutics showed some promising preclinical results (9), and one miRNAtherapeutic entered clinical trial (10). Studies in rodent models revealedthat neuropathic pain development is associated with modulation of theexpression of several miRNAs in nociception-related neural structures(11–20).

miRNAs released from cells can access bodily fluids, where they canbe detected with high sensitivity and specificity (21). The value of cir-culating miRNAs for diagnostic, prognostic, and therapeutic stratifica-

tion purposes is a matter of growing interest in clinical medicine (21, 22).Objective and reliable biological indicators of chronic pain would benefitour understanding of pain pathophysiology and analgesia-related me-chanisms, improve diagnostic accuracy, and facilitate the developmentof novel analgesics (23).

Transforming growth factor–b (TGF-b) constitutes a family ofpleiotropic, contextually acting cytokines (24). Emergent evidence sup-ports a protective role for TGF-b signaling against the pathological neu-ral plasticity underlying neuropathic pain in animal models (25–29).We have demonstrated that mice deficient in bonemorphogenetic pro-tein and activin membrane-bound inhibitor (BAMBI), a TGF-b decoyreceptor, present TGF-b gain of function in the nervous system, whichprotects mice against the development of allodynia after a peripheralnerve injury (NI) (25, 28, 29). Here, we discovered a candidate miRNA,miR-30c-5p, with potential value as an etiologic agent and therapeutictarget for treating neuropathic pain.We also provided evidence that theinteraction between miR-30c-5p and its target TGF-b modulated theendogenous opioid system. In addition, our data in patients with criticalleg ischemia suggest thatmeasuringmiR-30c-5p concentration in plasmaand cerebrospinal fluid (CSF) might help to determine the likelihood todevelop neuropathic pain.

RESULTSmiRNA expression profiles in the spinal cord of wild-typeand BAMBI−/− mice depend on their respective neuropathicpain–related phenotypeOur previous work demonstrates that deficiency of BAMBI ampli-fies TGF-b–mediated signals and protects themice against neuropathicpain development after sciatic NI (29). Taking advantage of the anti-allodynic phenotype of BAMBI−/−mice, wemade it our first objective toidentify potential miRNA candidates that could be involved in neuro-pathic pain.We analyzed by next-generation sequencing the differentialexpressionprofilesofmiRNAs in the spinaldorsalhorn (SDH)ofBAMBI−/−

andwild-type (WT)mice 14 days after NI. At that time point,WTmice

1 of 13

http://stm.sciencemag.org/



http://stm.sciencem

ag.org/D

ownloaded from

(NI-WT) showedmechanical allodynia,determined with von Frey monofila-ments (30), whereas BAMBI−/− mice(NI-BAMBI−/−) still showed normalresponses to mechanical stimuli (Fig.1A). Compared with NI-WT, the SDHof NI-BAMBI−/− mice showed four sig-nificantly down-regulated miRNAs(miR-30c-5p, P < 0.05; miR-181a-5p,P < 0.01; miR-100-5p, P < 0.05; miR-148a-3p, P < 0.05) and one overex-pressed miRNA (miR-16-5p, P < 0.01;Table 1). The expression changes of thisset of miRNAs were validated by qPCRin another series of sham and NI mice(Fig. 1B). miR-30c-5p was the onlymiRNAwhose expression significant-ly increased in allodynic NI-WT butdid not in nonallodynic NI-BAMBI−/−

(repeated-measures ANOVA: “genotype ×nerve injury,” P < 0.001; Fig. 1B).

Sciatic NI in rats inducesneuropathic pain and miR-30c-5pup-regulation in nociception-related areas, CSF, and plasmaNI and sham rats were tested formechanical sensitivity. As expected,10 and 21 days after NI, rats showedmechanical allodynia (Fig. 2A). Plas-ma and CSF samples from the samerats were collected from the retro-orbital sinus and the cisterna magna,respectively, at baseline and on days10 and 21 after NI, when mechanicalallodynia was fully developed. At theindicated time points, the rats weresacrificed, and the expression ofmiR-30c-5p was determined in thelumbar SDH and dorsal root gangli-on (DRG) by qPCR and in situ hy-bridization. Compared with shamrats, NI rats exhibited a significant
up-regulation of miR-30c-5p in both the SDH (ANOVA, P < 0.01)and the DRGs (ANOVA, P < 0.05) on days 10 and 21 after NI. More-over, the expressions of miR-30c-5p in CSF (repeated-measuresANOVA, P < 0.001) and plasma (repeated-measures ANOVA, P <0.01) were significantly increased from the baseline values (Fig. 2B).
Peroxidase and fluorescence in situ hybridizations (Fig. 2, C and D)were performed to show the topographic and cellular distribution ofmiR-30c-5p in the SDH from sham and NI rats. Positive signals weredetected in the SDH fromNI rats. In situ hybridization, combined withimmunofluorescence staining of glialmarkers [glial fibrillary acidic pro-tein (GFAP) for astrocytes and Iba1 formicroglia], showed thatmiR-30c-5p in the SDH does not colocalize with glial markers (Fig. 2E),suggesting that miR-30c-5p expression was mostly neuronal. In con-trast, fluorescence in situ hybridization in squash preparations (31)of isolated DRG cells showed that miR-30c-5p is expressed in bothneurons and satellite glia (Fig. 2F).


In addition, our analysis revealed that the mechanical sensitivitythresholds after NI negatively correlated withmiR-30c-5p expression inthe SDH, DRG, CSF, and plasma (fig. S1, A to D). We found a signif-icant (P < 0.01) and positive correlation between miR-30c-5p expres-sion in CSF and plasma (fig. S1E), which suggests that miR-30c-5preleased by neural cells into the extracellular fluid would access theCSF and, subsequently, the bloodstream. To support a flux of miRNAsbetween nervous tissue, CSF, and bloodstream, we injected the exog-enousmiRNACaenorhabditis elegans–miR-39 (cel-miR-39) into thecisterna magna or in the tail vein on day 10 after NI. The expressionof cel-miR-39 inCSF, plasma, SDH, andDRGwas determined by qPCR(fig. S2). Cel-miR-39 administered into the cisterna magna was highlyexpressed in CSF at all examined time points after injection. The max-imal expression in plasma was detected 6 hours after the injection andwas detected in the SDH andDRG 12 hours after the injection (fig. S2,A to C, left). When administered into the tail vein, cel-miR-39 was

Fig. 1. The antiallodynic phenotype of BAMBI−/−mice is associatedwith differentialmiRNA expression profiles in theSDH. (A) Nocifensive responses to mechanical stimuli in WT and BAMBI−/− NI and sham mice (n = 8 to 10 per group). **P <0.01, ***P < 0.001 versus NI-BAMBI−/− [two-way repeated-measures analysis of variance (ANOVA) with Bonferroni correction].(B) miRNA relative expression (RE) validated by quantitative polymerase chain reaction (qPCR; n = 7 per group). **P < 0.01versus sham; #P < 0.05, ##P < 0.01, ###P < 0.001 versus WT (two-way ANOVA with Bonferroni correction).

2 of 13




http://stm.sciencem

ag.org/D

ownloaded from

detected in plasma 3 hours after the injection and remained detectableat 12 hours; the maximal expression in CSF, SDH, and DRG was de-tected at 12 hours (fig. S2, A to C, right panels).

The recruitment of miR-30c-5p to the miRNA-inducedsilencing complexes is enhanced in the spinal cord after NIin ratsWe analyzed whether spinal overexpression of miR-30c-5p after NI isassociated with a parallel increase in miR-30c-5p bound to Argonaute2(Ago2) protein in the miRNA-induced silencing complexes (miRISCs),which would reflect the functional impact of miR-30c-5p overex-pression on the translation of its targeted mRNAs (7). To this end,Ago2 was immunoprecipitated with a specific antibody (Ab) in SDHlysates from NI and sham rats (32). As shown in fig. S3, no differencesbetween shamandNI rats were observed inAgo2mRNA (fig. S3A) andprotein (fig. S3B) expressions in total lysates (input) nor in Ago2 im-munoprecipitates (fig. S3C). However, the presence of miR-30c-5p inAgo2 immunoprecipitates was significantly higher (P < 0.05) inNI thanin sham rats (fig. S3D). These results indicate that the interaction ofmiR-30c-5p with Ago2 was enhanced in the SDH of neuropathic rats.

Pharmacological targeting of miR-30c-5p modulates painsensitivity after sciatic NI in ratsTo determine the functional role of miR-30c-5p on pain development,we assessed in vivo the consequences of miR-30c-5p pharmacologicalmodulation on pain sensitivity. NI rats received three injections ofmiR-30c-5p inhibitor (100 or 200 ng/10 ml) or mismatch inhibitor intothe cisterna magna at the time of NI or sham interventions and on days4 and 7 after surgery. The responses to mechanical stimuli weremonitored for a 2-month follow-up period. Spontaneous pain (33), coldallodynia (34), and thermal hyperalgesia (35) were assessed on day10 after NI. The lower dose of miR-30c-5p inhibitor significantly de-layed the onset ofmechanical allodynia from the 7th to the 21st day afterNI (two-way repeated-measures ANOVA, P < 0.01; Fig. 3A) and pre-vented miR-30c-5p up-regulation in the SDH, CSF, and plasma (Fig.3B). The rats were also protected against spontaneous pain, cold al-lodynia, and thermal hyperalgesia (Fig. 3C). The higher dose of miR-30c-5p inhibitor induced a long-lasting preemptive effect for the entire2-month follow-up period (Fig. 3A). The administration ofmiR-30c-5pinhibitor 11, 7, and 4 days before NI also delayed the onset of allodynia,


but the protective effect was shorter compared to the treatment startingthe day of NI (fig. S4, A and B). miR-30c-5p inhibitor injected to shamrats did notmodify their nocifensivemechanical and thermal responses(fig. S5, A and B).

We subsequently evaluated the effectiveness of miR-30c-5p inhibi-tor at suppressing already established neuropathic pain (Fig. 3D). Anearly cycle of miR-30c-5p inhibitor administered during the initialstages of allodynia (200ng/10ml; days 7, 9, 11, and 13 afterNI) produceda rapid, progressive, and long-lasting antinociceptive effect; the no-ciceptive threshold recovered baseline values after the third injection ofthe inhibitor and lasted for the 2-month follow-up period (Fig. 3D).Moreover, administration of a late cycle of miR-30c-5p inhibitor for2 weeks (days 22, 24, 26, and 28 after NI) to rats suffering from severeallodynia induced pain relief of rapid onset (48 hours after the firstadministration), and the analgesic effect lasted until the end of the ex-periment (5 weeks after the last injection; Fig. 3D).

Uptake of themiR-30c-5p inhibitor by spinal cells was evidenced byinjecting a fluorescent-labeled miRNA inhibitor (200 ng/10 ml) into thecisterna magna (Fig. 3E). miR-30c-5p inhibitor injected in the tail vein,at higher doses (three injections of 400 and 2000 ng each), did not pre-vent the development of neuropathic pain nor did it reverse theestablished allodynia (fig. S6, A to C).

To confirm the role of miR-30c-5p inmodulating neuropathic pain,we injected a syntheticmiR-30c-5pmimic (100ng/10ml; days 0, 1, and 3after NI) or a scrambled mimic (control) in the cisterna magna of NIrats (fig. S7A). The responses to mechanical stimuli were monitoredfor a 7-day follow-up period. miR-30c-5p mimic accelerated the onsetof allodynia from days 7 to 5 after NI (fig. S7, B and C). Neither miR-30c-5p mimic nor the scrambled mimic modified the nocifensive re-sponses of sham rats (fig. S7, B and C). The treatment with miRNAmimic increased the expression ofmiR-30c-5p in the SDH (fig. S7D).

TGF-b is involved in the effects of miR-30c-5p onneuropathic pain in rodentsThe antiallodynic phenotype of BAMBI−/− mice depends on anincreased TGF-b signaling (28, 29), and these mice did not overexpressmiR-30c-5p in the SDH after NI. Therefore, we assessed whether theprotective effect of TGF-b on neuropathic pain involves a modulatoryeffect on miR-30c-5p expression. WT mice received a 2-week sub-cutaneous infusion of recombinant TGF-b1 (rTGF-b1) or vehicle, starting

Table 1. miRNAs differentially expressed in the SDH from NI-WT and NI-BAMBI−/− mice. Next-generation sequencing. n = 3 per group. P withBenjamini-Hochberg correction.

miRNA miRBase(accession #)

Mature sequence
Mean expression NI-BAMBI+/+ Mean expression NI-BAMBI−/− Fold change Padj
Mmu-miR-181a-5pMIMAT0000660

AACAUUCAACGCUGUCGGUGAGU
392,017 229,396 0.59 <0.01
Mmu-miR-30c-5pMIMAT0000514

UGUAAACAUCCUACACUCUCAGC
64,825 37,516 0.59 <0.03
Mmu-miR-100-5pMIMAT0000655

AACCCGUAGAUCCGAACUUGUG
18,345 11,470 0.63 <0.03
Mmu-miR-148a-3pMIMAT0000516

UCAGUGCACUACAGAACUUUGU
17,661 11,133 0.63 <0.05
Mmu-miR-16-5pMIMAT0000527

UAGCAGCACGUAAAUAUUGGCG
9,897 16,875 1.71 <0.01
3 of 13




http://stm.sciencem

ag.org/D

ownloaded from

at the time of NI. Fourteen days after NI, control WT mice that receivedvehicle injection displayed allodynia. Conversely, WT mice treated withrTGF-b1 did not showmechanical allodynia (Fig. 4A). Moreover, controlWT mice treated with vehicle showed miR-30c-5p overexpression in theSDH 14 days after NI, whereas treatment with rTGF-b1 prevented miR-30c-5p up-regulation (Fig. 4B). The SDH expression values of miR-30c-5p negatively correlated with the mRNA expression of TGF-b1 (Fig.4C). Similar to the in vivo results, the administrationof rTGF-b1 (10ng/ml)


to the medium in cultured cells (SH-SY5Y neuroblasts, fibroblasts, andvascular smooth muscle cells) resulted in miR-30c-5p down-regulation(Fig. 4D).

To confirm the direct relationship between miR-30c-5p and TGF-b1 in the context of neuropathic pain, we showed that NI rats treatedwithmiR-30c-5pmimic exhibited a small but significant (ANOVA, P <0.05) down-regulationof TGF-b1mRNA in the SDH, as comparedwiththe scrambled mimic (Fig. 4E). Conversely, the miR-30c-5p inhibitor

Fig. 2. miR-30c-5p is overexpressed in nociception-related areas, CSF, and plasma of neuropathic rats. (A) Nocifensive responses to mechanical stimuli and thresholdforce (g) required to elicit responses 50% of the time in NI (n = 9) and sham rats (n = 4). *P < 0.05, **P < 0.01, ***P < 0.001 versus sham (one-way repeated-measures ANOVAwithBonferroni correction). (B) Top:miR-30c-5p relative expression in SDH andDRG inNI and Sham rats. *P<0.05, **P<0.01 versus sham (one-way ANOVAwith Bonferroni correction).Bottom: miR-30c-5p relative expression in CSF and plasma collected from the same rat before (basal) and after NI (10 and 21 days). *P < 0.05, **P < 0.01 versus basal (one-wayrepeated-measures ANOVAwith Bonferroni correction). (C) Peroxidase in situ hybridization ofmiR-30c-5p in spinal cord sections in sham andNI rats and in sham rats stainedwithscrambled miRNA probe (Scr; negative control). (D) Fluorescence in situ hybridization of miR-30c-5p (green) in SDH sections from sham and NI rats. (E) Combined miR-30c-5p(green) in situ hybridization and immunofluorescence for GFAP (top, red) or Iba1 (bottom, red) in SDH sections. (F) Fluorescence in situ hybridization ofmiR-30c-5p (green) in DRGcell dissociates in sham and NI rats.

4 of 13




http://stm.sciencem

ag.org/D

ownloaded from

inducedTGF-b1 overexpression comparedwith themismatch inhibitor(ANOVA, P < 0.001; Fig. 4F).

In addition, we transfected SH-SY5Y neuroblasts with miR-30c-5pmimic and miR-30c-5p inhibitor to respectively overexpress andknockdown miR-30c-5p (fig. S8). miR-30c-5p mimic significantly(ANOVA, P < 0.01) reduced the expression of TGF-b1, whereas miR-30c-5p inhibitor had the opposite effect (ANOVA, P < 0.01), increasingTGF-b1 expression (Fig. 4G).


The structure-based Probability of Interaction by Target Ac-cessibility (PITA) algorithm (http://genie.weizmann.ac.il/pubs/mir07/mir07_exe.html) (36) predicts the presence of binding sitesfor miR-30c-5p in the 3′ untranslated region (3′UTR) sequence ofTGF-b1. PITA’s notation (7.1.1) indicated that the seed region is a7-mer, with one mismatch and one guanine-uracile wobble.

To assess whether TGF-b1 is posttranscriptionally regulated by miR-30c-5p, we cotransfected SH-SY5Y neuroblasts with a pMIR-REPORT

Fig. 3. miR-30c-5p inhibitor prevents and reverses neuropathic pain in rats subjected to NI. (A) Top: Intracisternal administration protocol of miR-30c-5p inhibitor[100 ng/10 ml (n = 9) or 200 ng/10 ml (n = 5)] or mismatch inhibitor (n = 6). Bottom: Time course of the threshold force (g) required to elicit responses 50% of the time for thegroups indicated in legend. *P < 0.05, **P < 0.01, ***P < 0.001 versus NI + mismatch inhibitor (two-way repeated-measures ANOVA with Bonferroni correction). (B) miR-30c-5prelative expression in the SDH, CSF, and plasma in sham and NI rats ± miR-30c-5p inhibitor. *P < 0.05, **P < 0.01 versus sham; #P < 0.05, ###P < 0.001 versus NI + mismatchinhibitor (n = 6 per group; one-way ANOVA with Bonferroni correction). (C) Thermal hyperalgesia, cold allodynia, and spontaneous pain for the groups indicated in thelegend. *P < 0.05, versus sham; #P < 0.05, ##P < 0.01 versus NI + mismatch inhibitor (n = 4 to 6 per group; Kruskal-Wallis with Dunn correction). (D) Top: Intracisternaladministration protocol of miR-30c-5p inhibitor or mismatch inhibitor, starting (arrows) on day 7 (early) or on day 22 (late) after NI. Bottom: Time course of the thresholdforce (g).*P < 0.05, **P < 0.01, ***P < 0.001 versus NI + early mismatch inhibitor; ##P < 0.01, ###P < 0.001 versus NI + late mismatch inhibitor (n = 8 to 10 per group; two-wayrepeated-measures ANOVA with Bonferroni correction). (E) Fluorescence signals showing CY3-miRNA inhibitor within the spinal cord 12 hours after the injection into thecisterna magna. Bottom left: Lack of signal after vehicle.

5 of 13

http://genie.weizmann.ac.il/pubs/mir07/mir07_exe.html

http://genie.weizmann.ac.il/pubs/mir07/mir07_exe.html




http://stm.sciencem

ag.org/D

ownloaded from

Fig. 4. TGF-b1 is involved in the effects of miR-30c-5p on neuropathic pain in vivo and in vitro. (A) Nocifensive responses of sham and NI mice treated with a 14-daysubcutaneous infusion of rTGF-b1 or vehicle (n = 5 per group) to mechanical stimuli. *P < 0.05, **P < 0.01, ***P < 0.001 versus NI + rTGF-b1 (two-way repeated-measures ANOVAwith Bonferroni correction). (B) miR-30c-5p expression in the SDH from sham and NI mice ± rTGF-b1. *P < 0.05 versus sham; ##P < 0.01 versus NI (ANOVA with Bonferronicorrection). (C) Correlation between TGF-b1 mRNA and miR-30c-5p in the SDH from NI rats [Pearson’s coefficient (r); P < 0.001]. (D) miR-30c-5p expression changes inducedby rTGF-b1 (10 ng/ml) in cultured cells. *P<0.05, **P<0.01 versus respective control (Student’s t test). (E and F) Relative expressionof TGF-b1 in the SDHof shamandNI rats treatedwith miR-30c-5pmimic (E) or miR-30c-5p inhibitor (F). #P < 0.05, ###P < 0.001 versus NI (ANOVAwith Bonferroni correction). (G) TGF-b1 fold change induced bymiR-30c-5pmimicandmiR-30c-5p inhibitor in SH-SY5Y cells. *P < 0.05, **P < 0.01 versus scrambledmimic (Scr; purple bars) or mismatch inhibitor (Mism; red bars) (one-way ANOVAwith Bonferronicorrection). (H) Relative Luciferase activity (RLU) after cotransfection of SH-SY5Y cells with pMIR-luc containing the 3′UTR of TGF-b1 or the empty vector andmiR-30c-5pmimic(10 nM). **P<0.01 (Student’s t test). (I) Intracisternal administrationprotocol ofmiR-30c-5p inhibitor ormismatch inhibitor. Pretreated animals received an intracisternal injectionofa neutralizing Ab anti–TGF-b or an irrelevant immunoglobulin [sham+mismatch inhibitor + IgG1 (n = 3), NI +miR-30c-5p inhibitor + TGF-b Ab (n = 4), NI +miR-30c-5p inhibitor +IgG1 (n=3), NI +mismatch+ IgG1 (n=5)]. (J) Time course of the threshold force (g) required to elicit responses 50%of the time for thegroups indicated in the legend; arrow showsthe time of injection of anti–TGF-b (TGF-b Ab) or irrelevant immunoglobulin (IgG1). **P < 0.01, ***P < 0.001 versus NI + miR-30c-5p inhibitor + IgG1 (two-way repeated-measuresANOVAwithBonferroni correction). (K toM) Double immunofluorescence stainingof TGF-b (green) andGFAP (red) (K andL) or Iba1 (red) (M) in preparations of SDHcell dissociatesfromNI rats. (N) Immunofluorescence stainingof TGF-b (green) inDRG cell dissociates fromNI rats. (O) GFAP (red) andnonspecific TGF-b immunostaining (green) after neutralizingthe Ab with a specific blocking peptide.

Tramullas et al., Sci. Transl. Med. 10, eaao6299 (2018) 8 August 2018 6 of 13



http://sD

ownloaded from

luciferase vector containing the 3′UTR of TGF-b1 together with miR-30c-5p mimic (10 nM) or a scrambled mimic. Transfection of miR-30c-5p mimic, but not the scrambled mimic, resulted in a significant(P < 0.01) reduction of luciferase activity (Fig. 4H), suggesting thatTGF-b1 mRNA was targeted by miR-30c-5p in SH-SY5Y cells.

In a series of NI rats, we assessed the involvement of TGF-b inthe antiallodynic effect of miR-30c-5p inhibitor (200 ng; days 0, 4,and 7 after NI; Fig. 4, I and J). On day 10 after NI, when miR-30c-5pinhibitor–treated rats were fully protected against neuropathic pain,the animals received a single intracisternal injection of a neutraliz-ing monoclonal Ab anti–TGF-b (TGF-b Ab; 50 mg/10 ml) or an ir-relevant isotype-matched immunoglobulin [immunoglobulin G1(IgG1)]. TGF-b Ab antagonized the antiallodynic effect of miR-30c-5p inhibitor within 24 hours after injection, but IgG1 didnot. TGF-b Ab did not modify the mechanical sensitivity of shamrats (Fig. 4J).

To determine the regional distribution of TGF-b immuno-reactivity in the nervous system, we performed double immuno-fluorescence of TGF-b and glial markers [GFAP, astrocytes; ionizedcalcium-binding adapter molecule 1 (Iba1), microglia] in preparationsof dissociated neurons and glia from the SDH (30). Our results evi-denced that TGF-b was localized both in neurons and glial cells (Fig. 4,K to M). In DRG, TGF-b was detected in neurons and satellite glia(Fig. 4N). Pretreatment of the preparations with a specific blockingpeptide prevented TGF-b immunostaining (Fig. 4O).


The antiallodynic effect of miR-30c-5p inhibitor involves theendogenous opioid systemWe have previously demonstrated that the TGF-b–dependent anti-allodynic effect in mice depends on an increased activity of the en-dogenous opioid system (28, 29). Therefore, we postulated that theantiallodynic effect of miR-30c-5p was mediated by endogenousopioids. To test this hypothesis, NI rats treated with miR-30c-5p in-hibitor or mismatch inhibitor subsequently received the opioid an-tagonist naloxone (1 mg/kg, subcutaneously) on day 30 after NI (Fig. 5,A and B). Rats treated with miR-30c-5p inhibitor, which showednormal nocifensive responses at this time point, exhibited mechanicalallodynia immediately after the injection of naloxone, and mechano-sensitivity recovered normal values within 24 hours (Fig. 5C). Naloxonedid not modify mechanosensitivity in sham and NI rats treated withthe mismatch inhibitor.

To further support the relationship betweenmiR-30c-5p and the en-dogenous opioid system, we evaluated the effects of miR-30c-5p mimicin the acute restraint model of stress-induced analgesia, which isdependent on the activity of the endogenous opioid system (37). Ratswere treated with intracisternal miR-30c-5p mimic (100 ng/10 ml; days0, 1, and 4) or scrambledmimic and, 24 hours after, they were exposedto restraint stress for 30min. Thermal nociceptionwas assessed beforeand immediately after stress (Fig. 5D). The rats treated with scrambledmimic exhibited significantly higher paw withdraw latencies after stressthan at baseline (two-way repeated-measures ANOVA, P < 0.001).


tm.sciencem

ag.org/

Fig. 5. The antiallodynic effect of miR-30c-5p involves the endogenous opioid system. (A) Intracisternal administration protocol of miR-30c-5p inhibitor (n = 5) ormismatch inhibitor (n = 5). NI rats received naloxone on day 30. (B) Nocifensive responses to mechanical stimuli for the groups indicated in figure. *P < 0.05, **P < 0.01, ***P <0.001 versus NI +miR-30c-5p inhibitor (two-way repeated-measures ANOVAwith Bonferroni correction). (C) Threshold force (g) required to elicit responses 50% of the time inthe animal groups indicated in figure **P < 0.001 versus baseline (two-way repeated-measures ANOVAwith Bonferroni correction).(D) Rats treated with a cycle of miR-30c-5pmimic (n = 4) or scrambled mimic (n = 3) received an injection of naloxone or saline before restraint stress exposure. (E) Paw withdrawal latencies to thermal stimuli in theanimal groups indicated in figure. ***P < 0.001 versus respective baseline (white bars); ##P < 0.01 versus scrambled after stress (two-way repeated-measures ANOVA withBonferroni correction).

7 of 13




http://stm.sciencem

ag.org/D

ownloaded from

Naloxone prevented the stress-induced analgesia. Consistent with amodulatory role of miR-30c-5p on the endogenous opioid activity,the animals treated with miR-30c-5p mimic did not exhibit stress-induced analgesia (Fig. 5E).

Patients suffering from ischemic neuropathic pain presentelevated miR-30c-5p expression values in plasma and CSFThe potential translation of the experimental data into humans wasassessed in a small cohort of patients suffering from severe leg ischemiaassociated with pain with neuropathic characteristics [n = 25; DouleurNeuropathique 4 (DN4) score ≥ 4] that lasted more than 4 months.Patients with no evidence of neuropathic pain, either with leg ischemiaor without ischemia, served as controls (n = 35). The characteristics ofthe patients are depicted in Table 2.

Circulating miR-30c-5p was determined by relative expression andnumber of copies per microliter (38). Patients affected by neuropathicpain presented significantly higher plasma (P < 0.001) and CSF (P <0.01) expression of miR-30c-5p than patients without pain. Thishigher expression was unrelated to the ischemic condition, diabetes,or gender (Fig. 6). miR-30c-5p could be detected in T lymphocytes(CD3+), B lymphocytes (CD19+), monocytes (CD14+), and granulo-cytes (CD15+), with monocytes and T lymphocytes showing thehighest expression (fig. S9).

Circulating miR-30c-5p values in either plasma or CSFpredict neuropathic pain in patients with criticallimb ischemiaThe capability of circulating miR-30c-5p in plasma and/or in CSF,either alone or in conjunction with clinical parameters (age, sex, di-abetes, hypertension, and obesity), to estimate the likelihood of sufferingfrom neuropathic pain was assessed by logistic regression analysis. Inour small cohort, when analyzed individually, miR-30c-5p expressionin plasma and CSF, diabetes mellitus, and age behaved as significantindependent positive predictors of neuropathic pain occurrence (Table 3,models #1 to #4). The model obtained if diabetes and age were combinedwithmiR-30c-5p in plasma [Table 3 (model #9) and Fig. 7A] presentedthe highest area under the receiver operator characteristic (ROC) curve(0.93), with a sensitivity of 80% and a specificity of 94%. When thesame analysis was performed using miR‐30c-5p in CSF [Table 3(model #10) and Fig. 7B], the area under the ROC curve was 0.90, witha sensitivity of 83% and a specificity of 90%. The relative goodness of fit


of the candidatemodels was further assessed by the Akaike informationcriteria (AIC; Table 3) (39). AIC reflects the amount of information lostwhen a given model is used to represent reality; therefore, the preferredmodel is the one that has the lowest AIC value. The best AICwas shownbymodel #9 (age, diabetes, andmiR-30c-5p in plasma). The second bestmodel (Table 3, model #7) has 0.19 times as high a probability as thebest model of minimizing the information loss.

DISCUSSIONHere, we have exploited the antiallodynic phenotype ofmice lacking theTGF-b decoy receptor BAMBI (25, 28, 29) to identify potentially relevantmiRNAs involved in neuropathic pain establishment. Next-generationsequencing and qPCR showed that miR-30c-5p was up-regulated inthe SDH of neuropathic WT mice but remained unchanged in allodynia-resistant BAMBI−/−mice. In rats, neuropathic pain was associated withmiR-30c-5p overexpression in the SDH and DRGs. The functional sig-nificance of miR-30c-5p up-regulation was supported by the directcorrelation between the intensity of allodynia and the expression of

Table 2. Clinical and demographic characteristics of the patients.

Neuropathic pain(n = 25)

No pain(n = 35)

Age (mean ± SD)
75.4 ± 10.1 68.5 ± 1.6
Ischemia*
n = 25 (100%) n = 10 (28.6%)
Gender*
n = 14 men (56%)n = 11 women (44%)
n = 28 men (80%)n = 7 women (20%)

Diabetes mellitus*
n = 11 (44%) n = 5 (15%)
Obesity
n = 12 (48%) n = 17 (49%)
Hypertension
n = 19 (76%) n = 25 (71%)
*Significant differences between groups (*P < 0.05, c2 test).

Fig. 6. Patients suffering from neuropathic pain exhibited increased expressionvalues of miR-30c-5p in plasma and CSF. (A) miR-30c-5p values in CSF (left) andplasma (right) in patients with neuropathic pain (n = 35) and in pain-free controls(n = 25). **P < 0.01, ***P < 0.001 versus controls (Student’s t test). (B to D) Influence ofischemia (B), diabetes (C), and gender (D) on CSF (left) and plasma (right) miR-30c-5p(one- or two-way ANOVA with Bonferroni correction).

8 of 13



miR-30c-5p in nociception-related areas. Moreover, the enrichmentof miR-30c-5p bound to Ago2 in themiRISC obtained from SDHs ofneuropathic rats suggests that the posttranscriptional modulation ofmRNAs targeted by miR-30c-5p is increased under the neuropathicpain condition. Our results point to a relevant contribution ofmiR-30c-5p to allodynia development andmake it a promising target for treatingneuropathic pain states.

Here, intracisternal administration of miR-30c-5p inhibitor pre-vented the development of neuropathic pain in NI rats in a dose-dependent manner. The lower dose delayed the onset of mechanicalallodynia for about 2 weeks, and the higher dose prevented allodyniadevelopment throughout the 2-month follow-up period (duration ofthe experiment).

miR-30c-5p inhibitor also exerted long-lasting pain relief whenadministered either in the early stages of allodynia or after a long


period of maximally intense neuropathic pain. Time course experimentsshowed that both early- and late-treated rats recovered normal mech-anical sensitivity within the first week of treatment and remained freeof allodynia for the complete follow-up period (2 months). Such along-lasting effect raises the possibility that those animals, if followed-up longer, would never have regained the neuropathic condition.From a clinical point of view, this finding is particularly relevant be-cause, in real-life patients, the neurological origin of pain is oftenmissed initially, and the administration of specific treatments is sig-nificantly delayed (40).

The present study and others (25–29) support a protective role forTGF-b against neuropathic pain development. Although we cannotexclude relevant roles for other miR-30c-5p targets, our results suggestthat TGF-b1 is a target of miR-30c-5p under neuropathic pain condi-tions; this hypothesis is based on the following results: (i) TGF-b1 exerted

Dow

nl

Table 3. Diagnostic in silico models. The models include the following as independent variables: circulating miR-30c-5p in plasma and CSF, diabetes mellitus,and age analyzed individually or combined. AUC, area under the ROC curve; CI, confidence intervals; OR, odds ratio.

oade
Model
d

miR-30c-5p plasmaOR (95% CI)

miR-30c-5p CSFOR (95% CI)

AgeOR (95% CI)

DiabetesOR (95% CI)

AUC
AIC Relativelikelihood
from
1 4.0 (1.4–11.8) 0.86 49.7 0.025
h
ttp 2 1.7 (1.1–2.6) 0.74 62.0 5.3 × 10−5
:/
/stm 3 1.1 (1.0–1.2) 0.70 76.3 4.2 × 10−8
.
sci 4 4.6 (1.3–15.7) 0.65 78.1 1.7 × 10−8
e
nce 5 3.8 (1.3–10.7) 1.1 (1.0–1.2) 0.91 48.2 0.054
m
ag 6 1.8 (1.2–2.8) 1.1 (1.0–1.2) 0.83 56.7 0.0007
.o
rg/ 7 5.2 (1.5–18.0) 7.8 (1.4–43.0) 0.91 45.7 0.19
b
y g 8 1.8 (1.1–2.8) 7.2 (1.6–32.6) 0.84 56.8 0.0007
u
est 9 4.7 (1.4–15.2) 1.1 (1.0–1.2) 13.9 (1.8–105) 0.93 42.3 1 on A 10 2.0 (1.2–3.2) 1.2 (1.0–1.3) 20.5 (2.6–163) 0.90 47.4 0.077
ug
ust 5, 2020
Fig. 7. Multiple logistic regression models predictive of neuropathic pain occurrence in patients. (A) Diagnostic in silico models: The models include thefollowing as independent variables: circulating miR-30c-5p in plasma and CSF, diabetes mellitus, and age analyzed individually or combined. (B) ROC curves of themodels including different variables (as shown in figure).

9 of 13




http://stm.sciencem

ag.org/D

ownloaded from

antiallodynic effects in rats. (ii) TGF-b1 mRNA was down-regulated bymiR-30c-5p mimic and up-regulated by miR-30c-5p inhibitor. In addi-tion, the mRNA expression of TGF-b1 in the SDH of NImice correlatedinversely with the expression of miR-30c-5p. (iii) miR-30c-5p has a seed-matching sequence in the 3′UTR region of TGF-b1, and TGF-bs havebeen predicted in silico to be targeted by miR-30c-5p (8). Using a lucif-erase reporter construct containing the 3′UTR sequence of TGF-b1 (41),we confirmed that miR-30c-5p mimic inhibited the expression of the re-porter gene in SH-SY5Y neuroblasts.

Our results also support bidirectionalmodulatory networks betweenTGF-b1 and miR-30c-5p, as previously reported in models of hepaticfibrosis (42). TGF-b gain of function produced by either genetic (BAMBIdeficiency) or pharmacological (administration of rTGF-b1) tools pre-vented miR-30c-5p up-regulation and neuropathic pain development.In addition, the administration of rTGF-b1 to SH-SY5Y neuroblasts in-duced miR-30c-5p down-regulation. The reversion of the antiallodyniceffect of miR-30c-5p inhibitor by a neutralizing Ab to TGF-b stronglysuggests that the antagonistic relationship between miR-30c-5p andTGF-b signaling is a relevant pathophysiologicalmechanisms underlyingneuropathic pain.

Disruption of the homeostatic balance in the descending pain reg-ulatory systems, toward descending facilitation, contributes to painchronification after injury (43). In particular, several studies showedassociation between chronic pain states and dysfunction of the de-scending inhibitory opioid system (44). Our previous findings (28, 29)and present results show that the endogenous opioid system is a down-stream effector of the TGF-b–induced antiallodynic effect. BAMBI−/−

mice, which present TGF-b gain of function, and mice treated withrTGF-b did not develop allodynia and do not show miR-30c-5pup-regulation after NI. Moreover, the antiallodynic effect of miR-30c-5p inhibitor was reversed by the opioid antagonist naloxone. We pro-pose that, under neuropathic pain conditions, TGF-b1 down-regulationsubsequent to miR-30c-5p overexpression in nociception-related areascould result in less efficient pain modulation by the descending opioidsystem. According to this hypothesis, miR-30c-5p inhibitor wouldprevent the expression of signs of enhanced pain by amplifying TGF-b1 signaling in pain modulatory circuits. Therefore, the effect of miR-30c-5pmodulation is displayed onlywhen the activity of the descendingpain control plays a critical role in pain modulation, as occurs in NIanimals (43). In addition, our results showed that acute stress-inducedanalgesia, which ismediated by endogenous opioids (37), was preventedby miR-30c-5p mimic.

In the clinic, determining accurately whether chronic pain statesare of neuropathic origin is a challenge (40). The diagnosis is basedon anamnesis and clinical evaluation of highly subjective symptoms(allodynia, hyperalgesia, and dysesthesia) that are suggestive, but notpathognomonic, of neural damage. There are currently no objectiveindicators that can be used to identify individuals who suffer or are atrisk of developing neuropathic pain (23).

Despite the great deal of interest in the study of circulating miRNAsas minimally invasive biomarkers in human diseases (21), little atten-tion has been paid to chronic pain (45, 46), and very few studies havedealt with neuropathic pain (16, 47–49). Herein, circulatingmiR-30c-5pin CSF and plasma increased after the establishment of the neuropathicstate in rats. Moreover, the nocifensive responses to mechanical stimulicorrelated directly with the expression of miR-30c-5p in both CSF andplasma. Our results thus suggest that analysis of circulatingmiR-30c-5pin pain states might provide useful information on pain assessment andmanagement.


Patients suffering from neuropathic pain in the context of severechronic leg ischemia exhibited elevated expression of miR-30c-5p inplasma and CSF. Ischemia can be discarded as a confounding factorbecause the circulating values of miR-30c-5p in pain-free patients weresimilar regardless of their ischemic condition. These findings suggestthat miR-30c-5p expression in human biofluids is differentially regu-lated according to the painful condition of the neuropathy. Moreover,univariate logistic regression analyses showed that circulatingmiR-30c-5p, either in plasma or in CSF, correlated with neuropathic pain severity.However, further analysis in multiple large independent cohorts ofpatients suffering from pain of different etiology is necessary to deter-mine the diagnostic value of miR-30c-5p. Although the CSF miRNAprofile should better reflect that of the brain tissue and yield insights intodisease pathophysiology, in terms of clinical applicability, blood is pref-erable over CSF because it is accessible by performing a safer and lessinvasive procedure.

Consistently, with a previous report showing that age, diabetes, andperipheral arterial disease are themain contributors to an increased riskof suffering neuropathic pain in the general population (50), inclusionof age and diabetes together with circulating miR-30c-5p, either inplasma or in CSF, in a multiple logistic regression framework, sub-stantially improved the diagnostic power in our small cohort of ischemicpatients. On the basis of the area under the ROC curve and the AIC,the model including miR-30c-5p in plasma, age, and diabetes asindependent variableswas the best of the candidate set for neuropathicpain risk assessment. Although the prediction model was internallyvalidated by the bootstrapping method, further studies are warrantedto validate our findings in independent cohort of patients and to assessthe usefulness of circulating miR-30c-5p to predict individuals athigher risk for developing postamputation phantom limb pain, whichis a complication extremely challenging to treat (51).

An important mode of intercellular communication in the nervoussystem is mediated by miRNAs released by cells into the extracellularspace, incorporated in extracellular vesicles, or bound to high-densitylipoproteins or Argonaute (52). The CSF contains specific signaturesofmiRNA expression for various central nervous system (CNS) pathol-ogies (53). In addition, neuron-derived miRNAs have been detected inthe bloodstream of patients with neurological and psychiatric disordersand brain tumors (53). Here, we found a positive correlation betweencirculating miR-30c-5p in plasma and CSF in NI rats. This finding sug-gests thatmiR-30c-5p released by neural cells into the extracellular fluidwould access the CSF and, subsequently, the systemic bloodstream.In support of this hypothesis, our results showed that administrationof miR-30c-5p inhibitor into the cisterna magna resulted in a reduc-tion of miR-30c-5p expression in the nervous system, as well as in CSFand plasma. In addition, the exogenous-miRNA cel-miR-39, which hasno homologous sequences in rats (53), was detected in the SDH, DRG,CSF, and plasma after its injection into either the cisterna magna orthe tail vein in NI rats. These results suggest a bidirectional traffic ofmiRNAs, in a stable form, between nervous system, CSF, and blood-stream. Thus, in rats, miR-30c-5p released by neural cells could reachthe CSF and, subsequently, the systemic circulation through thephysiological CSF reabsorption into venous sinuses. However, wecannot discard a contribution from peripheral sources to circulatingmiR-30c-5p.

In contrast with rats, patients showed no relationship betweencirculating miR-30c-5p in plasma and CSF. Moreover, miR-30c-5pin plasmawasmore effective than its expression in theCSF at predictingneuropathic pain in our cohort of ischemic patients. These findings

10 of 13



Dow

nload

raise the possibility that, under the ischemic condition, peripheralsources of miR-30c-5p contributing to neuropathic pain might exist.The access of miR-30c-5p from the bloodstream to the CNS wouldbe facilitated by the disruption of the blood-brain barrier that occursduring the neuropathic pain condition (54). The ubiquitous expressionofmiR-30c-5p in almost all tissues, includingwhite blood cells, platelets,and vascular endothelial cells (55–57), makes it difficult to ascertain theactual source of peripheral miR-30c-5p in our patient’s cohort.

There are a number of limitations in this study. Although sciaticinjury in rodents is a widely usedmodel of peripheral neuropathic pain,there are many differences with the clinical scenario (etiology and timecourse of the painful neuropathy, comorbidities, age and sex of theaffected subjects, pharmacological treatments, etc.) that prompt to cau-tionwhen tempted to extrapolate directly experimental results into clin-ical practice. For example, diabetes mellitus, which affects 44% of ourcohort, underlies an increased susceptibility to neuropathic pain (1). Inaddition, the chronic inflammation state, yielded by impaired vascularfunction, age, and diabetes, can dysregulate the balance of miRNA ex-pression (58).Therefore, the impact of a number of confounders in ourobservations is unavoidable.


http://stm.sciencem

ag.org/ed from
MATERIALS AND METHODSStudy designHere, we assessed the potential value of miR-30c-5p as etiologic agentand therapeutic target in neuropathic pain. We performed studies inpatients with critical leg ischemia suffering from neuropathic pain, inrodent models of allodynia induced by peripheral NI, and in culturedcells. The following experimental studies were designed: (i) BAMBI-deficient mice subjected to sciatic nerve crush injury served to identify,by next-generation sequencing and qPCR, the relationship betweenmiR-30c-5p up-regulation in the SDH and the neuropathic pain state.(ii) The cellular localization of miR-30c-5p in DRG and SDH wasdetermined in rats subjected to the sparedNImodel of neuropathic pain(NI rats) by in situ hybridization combined with immunofluorescence.In addition, we assessed the relationship between pain severity andmiR-30c-5p expression, determined by qPCR, in neural tissues andbodily fluids. (iii) The functional consequences of miR-30c-5pmodula-tion on allodynia establishment and recovery were assessed in NI ratstreated with a miR-30c-5p mimic and a miR-30c-5p inhibitor. (iv) Theinhibitory role on TGF-b1 by miR-30c-5p under neuropathic painconditions was assessed using pharmacological tools (rTGF-b andTGF-b Ab) both in vivo (NI rodents) and in vitro (luciferase reporterexperiments in SH-SY5Y neuroblasts). (v) The administration of theopioid antagonist naloxone and the restrain stress-induced analgesiamodel were used to assess the regulatory role of miR-30c-5p onthe endogenous opioid system. (vi) The dysregulation of miR-30c-5pin CSF and plasma and the capability of circulating miR-30c-5p toestimate the likelihood of suffering neuropathic pain were assessed byqPCR and logistic regression analysis in a cohort of patients with lowerlimb critical ischemia, suffering from neuropathic pain, and controlpatients without pain.
In each experimental series, the surgical intervention and theadministration of treatments were performed by an operator that wasnot involved in the subsequent behavioral evaluation of the animals.Each animal was coded with a microchip, and the researcher whocarried out the rest of the experiment was not aware of their groupallocation. The investigators that performed surgery/treatments andbehavioral assessing were rotated. The investigator that analyzed the


nocifensive behavioral data did know which animals were groupedtogether but not what treatment these groups received.

Studies in patientsThe study followed the Declaration of Helsinki guidelines for investiga-tion on human subjects. The Cantabria Institutional Ethics and ClinicalResearch Committee approved the study, and all patients gave writteninformed consent.

We prospectively studied 25 patients with chronic peripheral ische-mia who suffered from persistent neuropathic pain symptoms of morethan 4 months duration and underwent surgery for lower extremity re-vascularization or amputation under regional anesthesia in theCardiovascular Surgery Unit at the University Hospital Valdecilla inSantander, Spain. The control group consisted of patients who lackedpainful pathologies and underwent elective surgery under regionalanesthesia (n = 35). Demographic and clinical characteristics of thepatients and their preoperative pharmacological treatments are shownin Table 2.

The neuropathic pain condition was assessed using the well-validated questionnaire,DN4 (59). Tominimize interobserver variability,all patients were uniformly examined and interviewed by the same phy-sician. The questionnaire has components of how the pain feels tothe patient and assesses the occurrence of hypoesthesia and allodynia.

During the spinal anesthesia procedure, a CSF sample (100 ml) wascollected. A peripheral venous blood sample (10ml) was collected froman antecubital vein 24 hours preoperatively. To minimize platelet de-granulation and hemolysis, we drew the blood without a tourniquet,using a syringe with a wide-gauge needle, and the blood was then gentlytransferred to a collection tube containing EDTA. Within 30 min ofcollection, the plasma was separated by centrifugation at 1500g for15 min, and platelet-poor plasma was obtained by recentrifuging theplasma for another 10 min at 1500g, all at room temperature. CSFand plasma aliquots were immediately frozen on dry ice and storedat −80°C until assayed.

Studies in rodentsThe experiments were performed in 8-week-old male WT (C57BL/6)and BAMBI knockout (BAMBI−/−) mice (in a C57BL/6 genetic back-ground) and in 8-week-old (250 to 300 g) male Sprague-Dawley rats.The study was approved by the University of Cantabria InstitutionalLaboratory Animal Care and Use Committee (reference IP0415) andconducted in accordance with the guidelines from directive 2010/63/EU of the European Parliament and the International Association forthe Study of Pain.

Two different models of neuropathic pain were used. In mice,the sciatic nerve crush injury model was used as previously de-scribed (28, 29, 60). Briefly, mice were anesthetized with isoflurane(1.5 to 2%), and the left common sciatic nerve was exposed, isolatedfrom surrounding connective tissue and crushed for 7 s using smoothforceps. Sham-operated mice underwent the same surgical procedure,but the nerve was exposed and left intact. In rats, the spared NI model(61) was used. The left common sciatic nerve was exposed under iso-flurane anesthesia, and the tibial and common peroneal branches ofthe nerve were sectioned. Sham-operated rats underwent the sameprocedure, but the sciatic and its branches were left intact. The devel-opment of neuropathic pain was assessed.

The following treatments were administered: miR-30c-5p mimicandmiR-30c-5p inhibitor (mirVana, Thermo Fisher Scientific) were di-luted in a mixture of Lipofectamine and artificial CSF or saline and

11 of 13




http://stm.sciencem

ag.org/D

ownloaded from

injected into the cisterna magna (100 to 200 ng/10 ml) or in the tail vein(400 ng/100 ml). CY3-labeledmiRNA inhibitor (Thermo Fisher Scientific)diluted in a mixture of Lipofectamine and artificial CSF was injectedinto the cisterna magna (200 ng/10 ml). Cel-miR-39 (Qiagen) dilutedin a mixture of Lipofectamine and artificial CSF or saline was injectedinto the cisternamagna (300 ng/10 ml) or in the tail vein (300 ng/100 ml).The opioid antagonist naloxone (Sigma-Aldrich) was diluted in salineand injected (100 ml; 1 mg/kg, subcutaneously). Recombinant TGF-b1 (R&D Systems) diluted in 4 nMhydrochloric acid (HCl) plus albumin(2 mg/ml) in phosphate-buffered saline was administered using osmoticminipumps (6.2 ng/hour, 14 days; Alzet 1002). Amonoclonal neutraliz-ingTGF-bAb [1D11.16.8 clone (62)] diluted in artificial CSF (50 mg/10 ml)was administered into the cisterna magna.

Statistical analysisGraphPad Prism 5.01, Predictive Analytics SoftWare (PASW) 22 [Statisti-cal Package for theSocial Sciences (SPSS) Inc.], andStata 14/SE (StataCorp)packages were used. Data from mice and rats were expressed as means ±SEM.Differences between two independent groupswere assessedusing thetwo-tailed Student’s t test. Differences between multiple groups were ana-lyzed by one- or two-way repeated-measures ANOVA followed by Bon-ferroni post hoc test. Correlations between mRNA, miRNA expressionvalues, and themechanical threshold were performed using Pearson’s cor-relation analysis. Next-generation sequencing analysis was performedusing Mann-Whitney test with Benjamini-Hochberg’s correction.

Patient’s data sets were assessed with the D’Agostino and Pearsonomnibus normality test. Continuous variables were expressed asthe mean ± SD if Gaussian and as median (25th and 75th interquar-tile range) if non‐Gaussian. To assess statistical dependence betweenquantitative variables, we used the Spearman’s rank correlation co-efficient (rho).

Predictors of neuropathic pain in patients were identified via logisticregression analysis: All models combining age, diabetes, and miR-30c-5p plasma/miR-30c-5p CSF were estimated. The Hosmer‐Lemeshowtest was used to evaluate goodness of fit of themodel. A post hoc assess-ment of the regression model was performed with the bootstrappingmethod, with 1000 iterations. The ROC curve was calculated to assessthe capability of the model to discriminate patients with neuropathicpain symptoms from pain-free patients. To assess the best modelamong candidates, we applied the AIC, which can be interpreted asthe amount of information loss by each model (39). We also estimatedtheir relative likelihood as eðAICmin�AICiÞ=2 , where AICi is the AIC formodel i, and AICmin is the minimum of the AIC obtained. The relativelikelihood reflects the probability of each model to minimize theinformation loss versus the best model. Raw data are shown in table S1.

SUPPLEMENTARY MATERIALSwww.sciencetranslationalmedicine.org/cgi/content/full/10/453/eaao6299/DC1MethodsFig. S1. Correlation of miR-30c-5p expression with allodynia severity after sciatic NI in rats.Fig. S2. qPCR amplification curves of cel-miR-39.Fig. S3. Recruitment of miR-30c-5p by Ago2 to miRISCs in the spinal cord after NI in rats.Fig. S4. Preinjury administration of miR-30c-5p inhibitor delays neuropathic pain developmentafter sciatic NI in rats.Fig. S5. Administration of miR-30c-5p inhibitor into the cisterna magna neither influenced thebaseline response to mechanical nor thermal stimuli in sham-operated rats.Fig. S6. Administration of miR-30c-5p inhibitor into the tail vein do not prevent thedevelopment of neuropathic pain neither reverse the established allodynia after sciatic NI.Fig. S7. miR-30c-5p mimic accelerates allodynia development after sciatic NI in rats.Fig. S8. Modulation of miR-30c-5p expression in SH-SY5Y neuroblastoma cells.


Fig. S9. Relative miR-30c-5p expression in peripheral white cells from control patients.Table S1. Raw data.

REFERENCES AND NOTES1. O. van Hecke, S. K. Austin, R. A. Khan, B. H. Smith, N. Torrance, Neuropathic pain

in the general population: A systematic review of epidemiological studies. Pain 155,654–662 (2014).

2. L. Colloca, T. Ludman, D. Bouhassira, R. Baron, A. H. Dickenson, D. Yarnitsky, R. Freeman,A. Truini, N. Attal, N. B. Finnerup, C. Eccleston, E. Kalso, D. L. Bennett, R. H. Dworkin,S. N. Raja, Neuropathic pain. Nat. Rev. Dis. Primers. 3, 17002 (2017).

3. P. M. Grace, M. R. Hutchinson, S. F. Maier, L. R. Watkins, Pathological pain and theneuroimmune interface. Nat. Rev. Immunol. 14, 217–231 (2014).

4. J. Lötsch, E. Niederberger, A. Ultsch, Computational functional genomics based analysisof pain-relevant micro-RNAs. Hum. Genet. 134, 1221–1238 (2015).

5. K. K. Bali, M. Hackenberg, A. Lubin, R. Kuner, M. Devor, Sources of individualvariability: miRNAs that predispose to neuropathic pain identified using genome-widesequencing. Mol. Pain 10, 22 (2014).

6. M. J. López-González, M. Landry, A. Favereaux, MicroRNA and chronic pain: Frommechanisms to therapeutic potential. Pharmacol. Ther. 180, 1–15 (2017).

7. O. Hobert, Gene regulation by transcription factors and microRNAs. Science 319,1785–1786 (2008).

8. A. Krek, D. Grün, M. N. Poy, R. Wolf, L. Rosenberg, E. J. Epstein, P. MacMenamin,I. da Piedade, K. C. Gunsalus, M. Stoffel, N. Rajewsky, Combinatorial microRNA targetpredictions. Nat. Genet. 37, 495–500 (2005).

9. R. Rupaimoole, F. J. Slack, MicroRNA therapeutics: Towards a new era for themanagement of cancer and other diseases. Nat. Rev. Drug Discov. 16, 203–222 (2017).

10. C. Chakraborty, A. R. Sharma, G. Sharma, C. G. P. Doss, S.-S. Lee, TherapeuticmiRNA and siRNA: Moving from bench to clinic as next generation medicine.Mol. Ther. Nucleic Acids 8, 132–143 (2017).

11. A. Favereaux, O. Thoumine, R. Bouali-Benazzouz, V. Roques, M.-A. Papon,S. A. Salam, G. Drutel, C. Leger, A. Calas, F. Nagy, M. Landry, Bidirectional integrativeregulation of Cav1.2 calcium channel by microRNA miR-103: Role in pain. EMBO J30, 3830–3841 (2011).

12. S. Imai, M. Saeki, M. Yanase, H. Horiuchi, M. Abe, M. Narita, N. Kuzumaki, T. Suzuki,M. Narita, Change in microRNAs associated with neuronal adaptive responses in thenucleus accumbens under neuropathic pain. J. Neurosci. 31, 15294–15299 (2011).

13. H. L. D. M. Willemen, X.-J. Huo, Q.-L. Mao-Ying, J. Zijlstra, C. J. Heijnen, A. Kavelaars,MicroRNA-124 as a novel treatment for persistent hyperalgesia. J. Neuroinflammation 9,143 (2012).

14. G. Shi, J. Shi, K. Liu, N. Liu, Y. Wang, Z. Fu, J. Ding, L. Jia, W. Yuan, Increased miR-195aggravates neuropathic pain by inhibiting autophagy following peripheral nerve injury.Glia 61, 504–512 (2013).

15. H.-P. Chen, W. Zhou, L.-M. Kang, H. Yan, L. Zhang, B.-H. Xu, W.-H. Cai, Intrathecal miR-96inhibits Nav1.3 expression and alleviates neuropathic pain in rat following chronicconstruction injury. Neurochem. Res. 39, 76–83 (2014).

16. M. Leinders, N. Üceyler, R. A. Pritchard, C. Sommer, L. S. Sorkin, Increased miR-132-3pexpression is associated with chronic neuropathic pain. Exp. Neurol. 283, 276–286 (2016).

17. L. Jiang, D. Zang, S. Yi, X. Li, C. Yang, X. Dong, C. Zhao, X. Lan, X. Chen, S. Liu, N. Liu,H. Huang, X. Shi, X. Wang, J. Liu, A microRNA-mediated decrease in eukaryotic initiationfactor 2a promotes cell survival during PS-341 treatment. Sci. Rep. 6, 21565 (2016).

18. N. Ito, A. Sakai, N. Miyake, M. Maruyama, H. Iwasaki, K. Miyake, T. Okada, A. Sakamoto,H. Suzuki, miR-15b mediates oxaliplatin-induced chronic neuropathic pain throughBACE1 down-regulation. Br. J. Pharmacol. 174, 386–395 (2017).

19. A. Sakai, F. Saitow, M. Maruyama, N. Miyake, K. Miyake, T. Shimada, T. Okada, H. Suzuki,MicroRNA cluster miR-17-92 regulates multiple functionally related voltage-gatedpotassium channels in chronic neuropathic pain. Nat. Commun. 8, 16079 (2017).

20. C. Peng, L. Li, M.-D. Zhang, C. Bengtsson Gonzales, M. Parisien, I. Belfer, D. Usoskin,H. Abdo, A. Furlan, M. Häring, F. Lallemend, T. Harkany, L. Diatchenko, T. Hökfelt,J. Hjerling-Leffler, P. Ernfors, miR-183 cluster scales mechanical pain sensitivity byregulating basal and neuropathic pain genes. Science 356, 1168–1171 (2017).

21. X.-F. Jin, N. Wu, L. Wang, J. Li, Circulating microRNAs: A novel class of potentialbiomarkers for diagnosing and prognosing central nervous system diseases.Cell. Mol. Neurobiol. 33, 601–613 (2013).

22. R. Garcia, A. V. Villar, M. Cobo, M. Llano, R. Martin-Duran, M. A. Hurlé, J. F. Nistal,Circulating levels of miR-133a predict the regression potential of left ventricularhypertrophy after valve replacement surgery in patients with aortic stenosis.J. Am. Heart. Assoc. 2, e000211 (2013).

23. D. Borsook, L. Becerra, R. Hargreaves, Biomarkers for chronic pain and analgesia. Part 1:The need, reality, challenges, and solutions. Discov. Med. 11, 197–207 (2011).

24. J. Massagué, TGFb signalling in context. Nat. Rev. Mol. Cell Biol. 13, 616–630 (2012).

12 of 13

http://www.sciencetranslationalmedicine.org/cgi/content/full/10/453/eaao6299/DC1




http://stm.sciencem

ag.org/D

ownloaded from

25. A. Lantero, M. Tramullas, A. Díaz, M. A. Hurlé, Transforming growth factor-b innormal nociceptive processing and pathological pain models. Mol. Neurobiol. 45, 76–86(2012).

26. G. Chen, C.-K. Park, R.-G. Xie, R.-R. Ji, Intrathecal bone marrow stromal cells inhibitneuropathic pain via TGF-b secretion. J. Clin. Invest. 125, 3226–3240 (2015).

27. S. Echeverry, X. Q. Shi, A. Haw, H. Liu, Z.-W. Zhang, J. Zhang, Transforming growthfactor-b1 impairs neuropathic pain through pleiotropic effects. Mol. Pain 5, 16(2009).

28. A. Lantero, M. Tramullas, F. Pílar-Cuellar, E. Valdizán, R. Santillán, B. P. Roques, M. A. Hurlé,TGF-b and opioid receptor signaling crosstalk results in improvement of endogenous andexogenous opioid analgesia under pathological pain conditions. J. Neurosci. 34,5385–5395 (2014).

29. M. Tramullas, A. Lantero, A. Díaz, N. Morchón, D. Merino, A. Villar, D. Buscher, R. Merino,J. M. Hurlé, J. C. Izpisúa-Belmonte, M. A. Hurlé, BAMBI (bone morphogenetic proteinand activin membrane-bound inhibitor) reveals the involvement of the transforminggrowth factor-b family in pain modulation. J. Neurosci. 30, 1502–1511 (2010).

30. S. R. Chaplan, F. W. Bach, J. W. Pogrel, J. M. Chung, T. L. Yaksh, Quantitative assessment oftactile allodynia in the rat paw. J. Neurosci. Methods 53, 55–63 (1994).

31. E. Pena, M. T. Berciano, R. Fernandez, J. L. Ojeda, M. Lafarga, Neuronal body sizecorrelates with the number of nucleoli and Cajal bodies, and with the organization ofthe splicing machinery in rat trigeminal ganglion neurons. J. Comp. Neurol. 430,250–263 (2001).

32. B. Pai, T. Siripornmongcolchai, B. Berentsen, A. Pakzad, C. Vieuille, S. Pallesen, M. Pajak,T. I. Simpson, J. D. Armstrong, K. Wibrand, C. R. Bramham, NMDA receptor-dependentregulation of miRNA expression and association with Argonaute during LTP in vivo.Front. Cell. Neurosci. 7, 285 (2014).

33. L. Djouhri, S. Koutsikou, X. Fang, S. McMullan, S. N. Lawson, Spontaneous pain, bothneuropathic and inflammatory, is related to frequency of spontaneous firing in intactC-fiber nociceptors. J. Neurosci. 26, 1281–1292 (2006).

34. Y. Choi, Y. W. Yoon, H. S. Na, S. H. Kim, J. M. Chung, Behavioral signs of ongoing pain andcold allodynia in a rat model of neuropathic pain. Pain 59, 369–376 (1994).

35. K. Hargreaves, R. Dubner, F. Brown, C. Flores, J. Joris, A new and sensitive method formeasuring thermal nociception in cutaneous hyperalgesia. Pain 32, 77–88 (1988).

36. M. Kertesz, N. Iovino, U. Unnerstall, U. Gaul, E. Segal, The role of site accessibility inmicroRNA target recognition. Nat. Genet. 39, 1278–1284 (2007).

37. R. K. Butler, D. P. Finn, Stress-induced analgesia. Prog. Neurobiol. 88, 184–202 (2009).38. E. M. Kroh, R. K. Parkin, P. S. Mitchell, M. Tewari, Analysis of circulating microRNA

biomarkers in plasma and serum using quantitative reverse transcription-PCR (qRT-PCR).Methods 50, 298–301 (2010).

39. H. Akaike, A New Look at Statistical-Model Identification. IEEE Trans. Automat. Contr.Ac19, 716–723 (1974).

40. N. B. Finnerup, N. Attal, S. Haroutounian, E. McNicol, R. Baron, R. H. Dworkin, I. Gilron,M. Haanpaa, P. Hansson, T. S. Jensen, P. R. Kamerman, K. Lund, A. Moore, S. N. Raja,A. S. C. Rice, M. Rowbotham, E. Sena, P. Siddall, B. H. Smith, M. Wallace, Pharmacotherapyfor neuropathic pain in adults: A systematic review and meta-analysis. Lancet Neurol. 14,162–173 (2015).

41. R. Garcia, J. F. Nistal, D. Merino, N. L. Price, C. Fernández-Hernando, J. Beaumont,A. González, M. A. Hurlé, A. V. Villar, p-SMAD2/3 and DICER promote pre-miR-21processing during pressure overload-associated myocardial remodeling. Biochim.Biophys. Acta 1852, 1520–1530 (2015).

42. S. Roy, F. Benz, D. Vargas Cardenas, M. Vucur, J. Gautheron, A. Schneider, C. Hellerbrand,N. Pottier, J. Alder, F. Tacke, C. Trautwein, C. Roderburg, T. Luedde, miR-30c and miR-193are a part of the TGF-b-dependent regulatory network controlling extracellular matrixgenes in liver fibrosis. J. Dig. Dis. 16, 513–524 (2015).

43. K. Bannister, A. H. Dickenson, The plasticity of descending controls in pain: Translationalprobing. J. Physiol. 595, 4159–4166 (2017).

44. S. Bruehl, O. Y. Chung, P. Ward, B. Johnson, Endogenous opioids and chronic painintensity: Interactions with level of disability. Clin. J. Pain 20, 283–292 (2004).

45. H. H. Andersen, M. Duroux, P. Gazerani, Serum microRNA signatures in migraineursduring attacks and in pain-free periods. Mol. Neurobiol. 53, 1494–1500 (2016).

46. B. Luchting, J. Heyn, L. C. Hinske, S. C. Azad, Expression of miRNA-124a in CD4 cellsreflects response to a multidisciplinary treatment program in patients with chronic lowback pain. Spine 42, E226–E233 (2017).

47. S. R. Douglas, B. B. Shenoda, R. A. Qureshi, A. Sacan, G. M. Alexander, M. Perreault,J. E. Barrett, E. Aradillas-Lopez, R. J. Schwartzman, S. K. Ajit, Analgesic response tointravenous ketamine is linked to a circulating microRNA signature in female patientswith complex regional pain syndrome. J. Pain 16, 814–824 (2015).


48. M. K. McDonald, Y. Tian, R. A. Qureshi, M. Gormley, A. Ertel, R. Gao, E. Aradillas Lopez,G. M. Alexander, A. Sacan, P. Fortina, S. K. Ajit, Functional significance of macrophage-derived exosomes in inflammation and pain. Pain 155, 1527–1539 (2014).

49. Y. Huang, X. Li, G. Tao, T. Zhu, J. Lin, Comparing serum microRNA levels of acuteherpes zosterpatientswith those of postherpetic neuralgia patients.Medicine96, e5997 (2017).

50. D. Ziegler, W. Rathmann, T. Dickhaus, C. Meisinger, A. Mielck, Prevalence ofpolyneuropathy in pre-diabetes and diabetes is associated with abdominal obesity andmacroangiopathy: The MONICA/KORA Augsburg Surveys S2 and S3. Diabetes Care 31,464–469 (2008).

51. E. Hsu, S. P. Cohen, Postamputation pain: Epidemiology, mechanisms, and treatment.J. Pain Res. 6, 121–136 (2013).

52. V. Zappulli, K. P. Friis, Z. Fitzpatrick, C. A. Maguire, X. O. Breakefield, Extracellular vesiclesand intercellular communication within the nervous system. J. Clin. Invest. 126,1198–1207 (2016).

53. N. Stoicea, A. Du, D. C. Lakis, C. Tipton, C. E. Arias-Morales, S. D. Bergese, The MiRNAjourney from theory to practice as a CNS biomarker. Front. Genet. 7, 11 (2016).

54. S. Echeverry, Y. Wu, J. Zhang, Selectively reducing cytokine/chemokine expressingmacrophages in injured nerves impairs the development of neuropathic pain. Exp.Neurol. 240, 205–218 (2013).

55. J. A. F. Balderman, H.-Y. Lee, C. E. Mahoney, D. E. Handy, K. White, S. Annis,D. Lebeche, R. J. Hajjar, J. Loscalzo, J. A. Leopold, Bone morphogenetic protein-2decreases microRNA-30b and microRNA-30c to promote vascular smooth muscle cellcalcification. J. Am. Heart. Assoc. 1, e003905 (2012).

56. R. F. Duisters, A. J. Tijsen, B. Schroen, J. J. Leenders, V. Lentink, I. van der Made, V. Herias,R. E. van Leeuwen, M. W. Schellings, P. Barenbrug, J. G. Maessen, S. Heymans, Y. M. Pinto,E. E. Creemers, miR-133 and miR-30 regulate connective tissue growth factor:Implications for a role of microRNAs in myocardial matrix remodeling. Circ. Res. 104,170–178 (2009).

57. G. Bridge, R. Monteiro, S. Henderson, V. Emuss, D. Lagos, D. Georgopoulou, R. Patient,C. Boshoff, The microRNA-30 family targets DLL4 to modulate endothelial cell behaviorduring angiogenesis. Blood 120, 5063–5072 (2012).

58. M. E. Assar, J. Angulo, L. Rodriguez-Mañas, Diabetes and ageing-induced vascularinflammation. J. Physiol. 594, 2125–2146 (2016).

59. D. Bouhassira, N. Attal, H. Alchaar, F. Boureau, B. Brochet, J. Bruxelle, G. Cunin,J. Fermanian, P. Ginies, A. Grun-Overdyking, H. Jafari-Schluep, M. Lanteri-Minet, B. Laurent,G. Mick, A. Serrie, D. Valade, E. Vicaut, Comparison of pain syndromes associated withnervous or somatic lesions and development of a new neuropathic pain diagnosticquestionnaire (DN4). Pain 114, 29–36 (2005).

60. H. Bester, S. Beggs, C. J. Woolf, Changes in tactile stimuli-induced behavior and c-Fosexpression in the superficial dorsal horn and in parabrachial nuclei after sciatic nervecrush. J. Comp. Neurol. 428, 45–61 (2000).

61. I. Decosterd, C. J. Woolf, Spared nerve injury: An animal model of persistent peripheralneuropathic pain. Pain 87, 149–158 (2000).

62. C. Montalvo, A. V Villar, D. Merino, R. Garcia, M. Ares, M. Llano, M. Cobo, M. A. Hurlé,J. F. Nistal, Androgens contribute to sex differences in myocardial remodeling underpressure overload by a mechanism involving TGF-b. PLOS ONE 7, e35635 (2012).

Acknowledgments: We thank A. Cayón, N. García, R. Moreta, M. Navarro, M. T. Berciano, andJ. F. Cryan. Funding: This work was supported by Ministerio de Economía y Competitividadof Spain (SAF2013-47434-R and SAF2016-77732-R), Fondo Europeo de Desarrollo Regional,Sociedad Española del Dolor, and Fundación Tatiana Pérez de Guzmán el Bueno (R.F.). Authorcontributions: M.T. and M.A.H. designed the study, interpreted data, and wrote themanuscript. R.d.l.F. was responsible for the study of patients. R.F., S.V., R.G., R.d.l.F., and M.C.performed the experiments in animals and contributed to data analysis and interpretation. J.L.provided statistical support and contributed to data analysis. Competing interests: Theauthors declare that they have no competing interests. Data and materials availability: Allthe data are included in the manuscript or in the Supplementary Materials.

Submitted 15 August 2017Resubmitted 21 February 2018Accepted 20 July 2018Published 8 August 201810.1126/scitranslmed.aao6299

Citation: M. Tramullas, R. Francés, R. de la Fuente, S. Velategui, M. Carcelén, R. García, J. Llorca,M. A. Hurlé, MicroRNA-30c-5p modulates neuropathic pain in rodents. Sci. Transl. Med. 10,eaao6299 (2018).

13 of 13


MicroRNA-30c-5p modulates neuropathic pain in rodents

Llorca and María A. HurléMónica Tramullas, Raquel Francés, Roberto de la Fuente, Sara Velategui, María Carcelén, Raquel García, Javier

DOI: 10.1126/scitranslmed.aao6299, eaao6299.10Sci Transl Med

suggest that targeting miR-30c-5p might be an effective strategy for treating neuropathic pain.induced pain. Inhibiting this microRNA in the rodent model produced analgesic effects. The results−ischemia

plasma. In addition, miR-30c-5p was up-regulated in plasma and cerebrospinal fluid from patients with peripheral was associated with increased expression of the microRNA miR-30c-5p in the brain, cerebrospinal fluid, and

. show that neuropathic pain in rodentset alpain could help to identify more effective therapies. Now, Tramullas pain relief with currently available therapies. A better understanding of the mechanisms mediating neuropathic

Neuropathic pain is a debilitating condition resulting from nerve damage. Often, patients do not achieveTargeting a microRNA for neuropathic pain

ARTICLE TOOLS http://stm.sciencemag.org/content/10/453/eaao6299

MATERIALSSUPPLEMENTARY http://stm.sciencemag.org/content/suppl/2018/08/06/10.453.eaao6299.DC1

CONTENTRELATED

http://stm.sciencemag.org/content/scitransmed/12/551/eaax4846.fullhttp://stm.sciencemag.org/content/scitransmed/12/531/eaaw6471.fullhttp://stm.sciencemag.org/content/scitransmed/11/519/eaaw8434.fullhttp://science.sciencemag.org/content/sci/365/6454/695.fullhttp://science.sciencemag.org/content/sci/365/6454/641.fullhttp://stm.sciencemag.org/content/scitransmed/11/504/eaav4176.fullhttp://science.sciencemag.org/content/sci/363/6424/276.fullhttp://stm.sciencemag.org/content/scitransmed/10/462/eaat9892.fullhttp://stm.sciencemag.org/content/scitransmed/10/462/eaat9897.fullhttp://science.sciencemag.org/content/sci/361/6405/831.fullhttp://stm.sciencemag.org/content/scitransmed/10/456/eaar3483.fullhttp://stm.sciencemag.org/content/scitransmed/9/409/eaam6072.fullhttp://stm.sciencemag.org/content/scitransmed/10/447/eaao4953.fullhttp://stm.sciencemag.org/content/scitransmed/10/450/eaar7384.full

REFERENCES

http://stm.sciencemag.org/content/10/453/eaao6299#BIBLThis article cites 62 articles, 12 of which you can access for free

PERMISSIONS http://www.sciencemag.org/help/reprints-and-permissions

Terms of ServiceUse of this article is subject to the

registered trademark of AAAS. is aScience Translational MedicineScience, 1200 New York Avenue NW, Washington, DC 20005. The title

(ISSN 1946-6242) is published by the American Association for the Advancement ofScience Translational Medicine

of Science. No claim to original U.S. Government WorksCopyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement


http://stm.sciencem

ag.org/D

ownloaded from

http://stm.sciencemag.org/content/10/453/eaao6299

http://stm.sciencemag.org/content/suppl/2018/08/06/10.453.eaao6299.DC1

http://stm.sciencemag.org/content/scitransmed/10/450/eaar7384.full

http://stm.sciencemag.org/content/scitransmed/10/447/eaao4953.full

http://stm.sciencemag.org/content/scitransmed/9/409/eaam6072.full

http://stm.sciencemag.org/content/scitransmed/10/456/eaar3483.full

http://science.sciencemag.org/content/sci/361/6405/831.full

http://stm.sciencemag.org/content/scitransmed/10/462/eaat9897.full

http://stm.sciencemag.org/content/scitransmed/10/462/eaat9892.full


http://stm.sciencemag.org/content/scitransmed/11/504/eaav4176.full



http://stm.sciencemag.org/content/scitransmed/11/519/eaaw8434.full

http://stm.sciencemag.org/content/scitransmed/12/531/eaaw6471.full

http://stm.sciencemag.org/content/scitransmed/12/551/eaax4846.full

http://stm.sciencemag.org/content/10/453/eaao6299#BIBL

http://www.sciencemag.org/help/reprints-and-permissions

http://www.sciencemag.org/about/terms-service


microrna-30c-5p modulates neuropathic pain in rodents · vent the development of neuropathic pain...

Documents