minion nanopore sequencing
TRANSCRIPT
![Page 1: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/1.jpg)
MinIONNanopore sequencing
1 Laboratory of Food Microbiology,
2 Department of Water Technology and environmental engineering
Sabina Purkrtová1, Dana Vejmelková2, Milada Suková1
PIGA projekt C1_VSCHT_2019_066
(Zavedení nanopórového sekvenování MinION do laboratorních prací a přednášek na ÚTVP a ÚBM)
![Page 2: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/2.jpg)
MinION sequencingOxford Nanopore Technologies
https://nanoporetech.com
![Page 3: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/3.jpg)
Basic information• nanopore sequencing
• 2014 launched
• the only portable device for real-time RNA and DNA sequencing
• measurement is performed on a flow cell (array with 512 sensors), which is inserted into the MinION before each sequencing
• Weight: 100 g, Dimensions: 105x23x33 mm
• each flow cell can generate up to 30 Gb of sequencing data
https://nanoporetech.com/products/minion
![Page 4: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/4.jpg)
Principle
• A: library preparation
• B: flow cell loading
• C: passage through the
nanopore
• D: data analysis
A.
D. C.
B.
![Page 5: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/5.jpg)
A. Library preparation
• various sets for library preparation
• DNA concentration measurement
• DNA fragmentation - optional
• repair of ends
• adapters ligation - interact with proteins on the nanopore (facilitate fiber capture), introduction of process enzyme at the 5‘ end of a single fiber
![Page 6: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/6.jpg)
DNA concentration measurement
Qubit Fluorometric Quantification
• touch screen devices
Advantages:
• for low nucleic acid samples
• specificity, sensitivity
• different sample volumes
Disadvantages:
• no information about purity
• time of preparation
• previous sample preparation with compatible reagents - higher costs
https://www.thermofisher.com/order/catalog/product/Q33227#/Q33227
![Page 7: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/7.jpg)
DNA concentration measurement
NanoDrop
• UV spektrophotometer
• slightly bigger than Qubit
• Advantages:
• ability to measure sample purity
• no sample preparation required (no use of standards and other reagents)
• Disadvantages:
• requires 1-2 µL of sample
• insufficient sensitivity
• absorbance measurement does not distinguish DNA, RNA or proteins (values easily influenced by other contaminants-salts, organic compounds)
https://www.selectscience.net/products/nanophotometer----the-complete-solution-for-submicroliter-and-
standard-volume-applications/?prodID=14073
![Page 8: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/8.jpg)
B. Passage through the nanopore
• nanopore (artificial protein) is built into an electrically resistant membrane made of synthetic polymer
• the membrane is immersed in the ionic solution and voltage is applied across
• by decoding the characteristic current changes it is possible to identify the molecule that interrupted the ion current, in this case the individual bases
https://lh3.googleusercontent.com/proxy/XcsbOqOEJDukSpNqjzYQVvDBXpLf9Am0fuMi6fz8lcO2IbmHV9rST9z4UG1PuFpPYwT2ZA8pZM9QLjO_0Ye1xO6zjmrelaI0Dtwdlh0vVO_BW4Xt4AU
![Page 9: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/9.jpg)
(i) open channel
(ii) dsDNA with leading adapter
(blue) coupled to molecular
motor (orange) and hairpin
adapter (red) are captured on
the nanopore
(iii) interception is followed by
translocation of the leading
adapter
(iv) the template fiber
(v) hairpin adapter
(vi) complementary fibers
(vii) end adapter
(viii) open channel
Jain, M., Olsen, H.E., Paten, B. et al. The Oxford Nanopore MinION: delivery of nanopore sequencing to
the genomics community. Genome Biol 17, 239 (2016). https://doi.org/10.1186/s13059-016-1103-0
![Page 10: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/10.jpg)
C. Flow cell loading
Filling
(priming) portWaste port 1
Waste port 2
Waste channel Sensor array
SpotON sample port cover
(SpotON sampling port)
![Page 11: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/11.jpg)
D. Data analysis• Software for data recording and processing: MinION
• Records raw sequencing data from individual nanopores
• Raw data has the format fast5
• Record current measurements in pA in individual nanopores(frequency about a thousand times per second)
• Raw sequencing data are subjected to basecalling• the respective bases are assigned to each current change
• Basecalling can take place in real time and then off-line
• data after basecalling have the format fastq
• fastq format is a text document which, in addition to the fast format document, contains, besides the sequence, the reading quality of each nucleotide (see example below - 4th row)
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
the lowest quality the lowest quality
Reading accuracy(Tyler et al., 2018)• 94%-1D experiment• 97%-2D
![Page 12: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/12.jpg)
D. Data analysis• Software for data analysis: EPI2ME• Different applications depending on the kits used and evaluation types• E.g. Custom Reference Alignment
Example:• linked to nanoporotech.com - graphical output• often output in bam format• bai format required for various software eg
Genome Workbench• conversion to bai format – e.g. samtools tools -
must be done in Linux• Win10 allows you to install the Ubuntu Linux
subsystem (you can run samtools)
![Page 13: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/13.jpg)
Advantages
• Mobility - Various environments, connect to a PC or laptop with Hi-Speed USB 3.0 cable
• real-time measurement - immediate access to results (pathogen identification, antibiotic resistance determination)
• no PCR amplification required (depending on kit used)
• long reads
• study of native DNA or RNA structure - mutation detection
• cheap - $ 1000 starter package
• flow cells can be reused
https://nanoporetech.com
![Page 14: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/14.jpg)
Application
• portable device - not limited to laboratory environment, used in mountains, jungle, arctic region and international space station
• whole genome sequencing
• targeted sequencing
• RNA sequencing
• metagenomics
• epigenetics
https://www.space.com/34108-nasa-astronaut-sequences-dna-first-time
![Page 15: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/15.jpg)
Oxford Nanopore Offer
Various kits
Flow cells
Device• for insertion of flow cell (cells)• individual types differ in number of flow cells (= number
of parallel sequencing)• possible device + computer
Oxford Nanopore Technologies Ltd.• private company based in Oxford (GB)• in Czechia does not have a commercial representation, all orders must
be communicated directly with the headquarters (registration required - different levels)
• www: https://nanoporetech.com/• The site contains experience sharing community, software, etc.
![Page 16: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/16.jpg)
Oxford Nanopore OfferDevice – to insert a flow cell
MinION-1 flow cell-1000 $ (included in the starter pack)
GridION-5 flow cells- $ 49,955
PromethION-24/48 flow cells- $165 000/$285 000
Flongle-Flow Fongle Cell Adapter (lowerprice)-1860 $ (starterpack)
Flow cells
512 nanopore channels900 $ (48 h of operation and/or as long as the pores are sufficiently permeable)
Flow Fongle Cell126 nanopore channels90 $ (24 h of operation and/or as long as the pores are sufficiently permeable)
MinION and GridION Flow Cell
PromethION Flow Cell
3000 nanopore channels
![Page 17: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/17.jpg)
Oxford Nanopore OfferVolTRAX v2
Automatic sample and librarypreparation
$8,150
Various kits
• kits do not contain reagentsneeded to repair or amplify fragments - must be purchased separately
Laboratory equipment and reagents needed
Hula mixer – for DNA fragmentation
Magnetic separator
Agencourt AMPure XP beads
Covaris g tube-recommended for DNA fragmentation in bead-beater (not necessary)
LoBind plastics (eppendorfs, PCR tubes)
![Page 18: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/18.jpg)
Sequencing kits
Consumables: not included in the kit
DNA fragmentation
DNA repair and ends preparation (35 min)
Adapters ligation and clean-up (30 min)
The protocols for using kits on the Oxford Nanoporewebsite are very well and properly designed, user-friendly
![Page 19: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/19.jpg)
Chemikálie potřebné pro Ligation Sequencing kit
Firma (jméno, adresa, kontakt) Produkt Kat.čísloPočet reakcí
Objem (ml)
Počet ks
Doba užití (h)
Cena za balení (bez
DPH)
Cena 1 sekv. reakce
Poznámka
Výsledná cena
Biotech (New England Biolabs)
NEBNext FFPE DNA Repair Mix M6630S 24 5660 236
1170
NEBNext Ultra II End Repair/dA-Tailing Module
E7546S 24 8560 357
NEBNext Quick Ligation Module
E6056S 20 10000 500
Beckman Coulter Agencourt AMPure XP beads A63880 5 5100 61
ThermoFisher ScientificNuclease-free water (e.g.
ThermoFisher)AM9938 100 1612 2
Merck1.5 ml Eppendorf DNA LoBind
tubesZ666548-
250EA250 466 9
P-LAB 0.2 ml thin-walled PCR tubes U322510 1000 1076 5
Oxford Nanopore Technologies
Ligation Sequencing Kit SQK-LSK109 6 $599.00
4845 6015Při samostatném zakoupení LSK a průtokové cely
Ligation Sequencing Kit SQK-LSK109 6 13667 2278
Single Flow Cell R9.4.1 8 48 $900
Single Flow Cell R9.4.1 8 48 205352567
(pro 6 hodin)Starter Pack - MinION Starter
Pack*Starter Pack 6 $1000
3803 4973Při použití Starter Pack
(obsahuje též 2 flowcell)
Starter Pack - MinION Starter Pack*
Starter Pack 6 22817 3803
Starter Pack - MinION Starter Pack
1x MinION Sequencing Device2x Starter Pack Flow Cell (R9.4.1)
1x Control Expansion 1x Flow Cell Wash Kit 1x Ligation Sequencing Kit (kit dle výběru)
1 x Flow Cell Priming Kit
Oxford Nanopore – ke každé zásilce 50$ poštovné (1141 Kč) 1 $ = 23 Kč
Sequencing kits-price calculation
![Page 20: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/20.jpg)
Sequencing kits-price calculationChemikálie potřebné pro 16S Barcoding Kit/16S Barcoding Kit 1-24
Firma (jméno, adresa, kontakt) Produkt Kat.číslo BaleníCena za balení (bez
DPH)Použití též v:
New England Biolabs LongAmp Hot Start Taq 2X Master Mix M0533S 1 (100 reakcí) 5400PCR Barcoding
kit
Merck 1M Tris-HCl T3038-1L 1 (1l) 2530PCR Barcoding
KitBeckman Coulter Agencourt AMPure XP beads A63880 1 (5 ml) 5100
Lig.-Seq.+ PCR Barcoding Kit
Merck 1.5 ml Eppendorf DNA LoBind tubes Z666548-250EA 2 (5x 50 ks) 466P-LAB 0.2 ml thin-walled PCR tubes U322510 1 (1000 ks) 1076
ThermoFisher Scientific Nuclease-free water (e.g. ThermoFisher) AM9938 1 (1x100 ml) 1612Oxford Nanopore Technologies 16S Barcoding Kit (6 reakcí – každá reakce 12 barcoding) SQK-RAB204 $650.00
Chemikálie potřebné pro PCR Barcoding Kit
Firma (jméno, adresa, kontakt) Produkt Kat.číslo BaleníCena za balení (bez
DPH)Použití též v:
New England BiolabsNEBNext FFPE DNA Repair Mix- 24 rxns M6630S 1 5660
Lig.-Seq.kitNEBNext Ultra II End Repair/dA-Tailing Module E7546S 1 8 560NEBNext Quick Ligation Module E6056S 1 10 000
New England Biolabs LongAmp Hot Start Taq 2X Master Mix M0533S 1 (100 reakcí) 540016S Barcoding
KitNew England Biolabs Exonukleasa I (NEB, M0293) M0293S 1 (3000 U) 2290
Beckman Coulter Agencourt AMPure XP beads A63880 1 (5 ml) 5100 Lig.-Seq.+ PCR Barcoding KitMerck 1.5 ml Eppendorf DNA LoBind tubes Z666548-250EA 1 (5x 50 ks) 466
Merck 1M Tris-HCl T3038-1L 1 (1l) 253016S Barcoding
KitP-LAB 0.2 ml thin-walled PCR tubes U322510 1 (1000 ks) 1076
ThermoFisher Scientific Nuclease-free water (e.g. ThermoFisher) AM9938 1 (1x100 ml) 1612
Oxford Nanopore Technologies PCR Barcoding Kit (6 reakcí – každá reakce 12 barcoding) SQK-PBK004 $650.00
![Page 21: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/21.jpg)
Sequencing kits
According to sample type
Sample: gDNA (or PCR amplicons, cDNA) Sample: RNA
Sequencing includingPCR amplification
Enough DNA
Low DNA-amplification of DNA presentSequencing of only selected region (16S rRNA gene)
According to barcoding use
Purpose: identification of fragments from different samples - these samples are applied together (saving for flow cell) -during sample preparation, a specific sequence is attached to the fragments of a given sample to distinguish individual samples (this barcoding sequence is included in the obtained sequence)
According to time or experimentalconditions
Direct RNA sequencing or cDNA transcription and cDNA sequencing
„Slow“-60 min and more
Transposasecomplex
Direct sequencing without PCR
amplification included
NEBNext FFPE DNA Repair Mix
NEBNext Ultra II End Repair/dA-Tailing Module
NEBNext Quick Ligation Module
„Fast“-10-15 min
Individual steps-fragmentation, ends repair, ligation
All steps in one
![Page 22: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/22.jpg)
Kits without PCR amplification during sequencingLigation
Optimised for throughput
Rapid
Simple and rapid library
preparation
Ligation 1D2
Highest raw read accuracy
Ligation Sequencing Kit Rapid Sequencing Kit Ligation Sequencing Kit 1D2
Preparation time 60 min 10 min 80 min
Input recommendation
1000 ng dsDNA
(1000 ng high molecular weight dsDNA
100+ ng DNA if performing fragmentation or
PCR), gDNA / amplicon / cDNA
400 ng HMW gDNA (>30 kb) 1000 ng dsDNA
FragmentationOptional, recommended for inputs of 100-
500 ngTransposase based Optional
Read Length Equal to fragment lengthRandom distribution, dependent on input
fragment lengthEqual to fragment length
Read type produced 1D 1D 1D2
Typical throughput +++ ++ ++
Compatible with
Premium whole genome amplification
Amplicon sequencing
Size selection using BluePippin
Target enrichment by sequence capture
Rapid whole genome amplification
Amplicon sequencing
Size selection using BluePippin
Target enrichment by sequence capture
Ligation Sequencing Kit SQK-LSK109
$599.00=6 reakcí
Field Sequencing Kit SQK-LRK001
$599.00= x reakcí
Rapid Sequencing Kit SQK-RAD004
$599.00
1D2 Adapter allows the pore to capture
the complement strand immediately
after the template. One strand of the
duplex is sequenced at a time,
producing 1D2 reads.
Multiplexing optionsNative Barcoding Expansion 1-12 (PCR-
free), PCR Barcoding Expansion 1-12Rapid Barcoding kit SQK-RBK004 PCR Barcoding kit
+++ 2-3 Gb in 6 h8+ Gb in 48 h
++ 1-2 Gb in 6 h4+8 Gb in 48 h
+ Less than 1 Gb in 6 h1-4 Gb in 48 h
Usually 6 reactions
![Page 23: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/23.jpg)
Kits without PCR amplification during sequencing
Ligation Sequencing Kit SQK-LSK109
$599.00=6 reactions
gDNA / amplicon / cDNA ≤ 1 µg 60 mins No PCR Throu
ghput
Rapid Barcoding Kit SQK-RBK004
$650.00= 6 reactions
• barcoded
samples are
pooled
gDNA 400 ng 10 mins No PCR Speed / simplicit
y
![Page 24: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/24.jpg)
Kits with PCR amplification during sequencingPCR Sequencing KitControl over read length
Compatible with targeted
amplicon sequencing
Rapid PCR Barcoding KitSimple library preparation
(15 mins hands-on time)
16S BarcodingGenus level bacterial identification
PCR Sequencing Kit Rapid PCR Barcoding Kit 16S Barcoding Kit
Preparation time 60 mins + PCR 15 min + PCR 10 min + PCR
Input
recommendation<100 ng gDNA <10 ng gDNA <10 ng gDNA
Fragmentation Optional Transposase based Not required
Read Length Equal to fragment length post PCR ~2 kb Full-length 16S gene (~1.5 kb)
Read type
produced1D 1D 1D
Typical throughput +++ ++ ++
Compatible withAmplicon sequencing
(Four primer PCR)
PCR Sequencing Kit SQK-PSK004
$599.00
PCR Barcoding Kit SQK-PBK004
$650.00
Rapid PCR Barcoding Kit SQK-RPB004
$650.00
16S Barcoding Kit 1-24 SQK-16S024
$900.00
16S Barcoding Kit SQK-RAB204
$650.00
Multiplexing
optionsPCR Barcoding Kit
This kit offers barcoding for up to twelve
samples
This kit offers barcoding for up to twelve
samples
+++ 2-3 Gb in 6 h8+ Gb in 48 h
++ 1-2 Gb in 6 h4+8 Gb in 48 h
+ Less than 1 Gb in 6 h1-4 Gb in 48 h
Usually 6 reactions
![Page 25: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/25.jpg)
Kits with PCR amplification during sequencing16S Barcoding Kit SQK-RAB204 $650.00
gDNA 10 ng ~10 mins + PCR PCR Bacterial I
D
PCR Sequencing Kit SQK-PSK004 $599.00
gDNA 100 ng 60 mins + PCR PCR Fragment length cont
rol
a method whereby users are able to tag
their own specific amplicons with the
same 5’ group, simplifying downstream
post-PCR processing
![Page 26: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/26.jpg)
Direct RNASequence RNA molecules directly
and preserve base modifications
Up to 1 million reads
Direct cDNANo PCR bias
Up to 10 million reads
PCR cDNAOptimised for throughput
Up to 12+ million reads
Direct RNA Sequencing Kit Direct cDNA Sequencing Kit PCR cDNA Sequencing Kit
Preparation time 105 min 270 min 165 min
Input requirement 500 ng poly-A+ RNA 100 ng poly-A+ RNA 1 ng poly-A+ or 50 ng total RNA
RT Required Optional Yes Yes
PCR Required No No Yes
Read length Equal to RNA length Enriched for full-length cDNA Enriched for full-length cDNA
Typical throughput + ++ +++
Typical number of
reads1 million 5 - 10 million 7 - 12+ million
Direct RNA Sequencing Kit
SQK-RNA002
$599.00
Direct cDNA Sequencing Kit
SQK-DCS109
$599.00
PCR-cDNA Barcoding Kit
SQK-PCB109 $650.00
PCR-cDNA Sequencing Kit
SQK-PCS109 $599.00
Multiplexing
optionsIn development
Native Barcoding Expansion 1-12 and
Native Barcoding Expansion 13-24PCR Barcoding Kit
Kits for RNA sequencing
+++ 2-3 Gb in 6 h8+ Gb in 48 h
++ 1-2 Gb in 6 h4+8 Gb in 48 h
+ Less than 1 Gb in 6 h1-4 Gb in 48 h
Usually 6 reactions
![Page 27: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/27.jpg)
Kits for RNA sequencingDirect RNA Sequencing KitSQK-RNA002 $599.00
Sequence RNA molecules directly and
preserve base modifications
Description
• to prepare any RNA with a 3’ polyA
tail for 1D sequencing
• the kit requires 500 ng of input RNA
• possible input - RNA includes
eukaryotic mRNA, viral RNA with a
polyA tail
• possible input - any RNA prepared
with a polyA-tailing kit
• RNA without a polyA tail - to design
own custom adapter to ligate a
specific terminal 3’ sequence like the
3’ of tRNA or 16S rRNA.
Direct cDNA Sequencing KitSQK-DCS109 $599.00
Identification and quantification of full-length
transcripts without PCR bias
Poly-A+ RNA 100 ng 270 mins No PCR No PCR bias
Poly-
A+ RNA 1 ng 165 mins PCR Throughput
PCR-cDNA Sequencing Kit
SQK-PCS109 $599.00
Identification and quantification of full-lengthtranscripts with highest throughput
Poly-A+ RNA 500 ng 105 mins Direct RNA RNA base mods
![Page 28: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/28.jpg)
References• Jain, M., Olsen, H.E., Paten, B. et al. The Oxford Nanopore MinION: delivery of
nanopore sequencing to the genomics community. Genome Biol 17, 239 (2016). https://doi.org/10.1186/s13059-016-1103-0
• Plesivkova, Diana & Richards, Rebecca & Harbison, Sallyann. (2018). A reviewof the potential of the MinION™ single‐molecule sequencing system for forensicapplications. Wiley Interdisciplinary Reviews: Forensic Science. 10.1002/wfs2.1323.
• Lu H, Giordano F and Ning Z (2016): Oxford Nanopore MinION Sequencing and Genome Assembly. Genomics, proteomics & bioinformatics 14: 265-279.
• Tyler, A.D., Mataseje, L., Urfano, C.J. et al. Evaluation of Oxford Nanopore’sMinION Sequencing Device for Microbial Whole Genome SequencingApplications. Sci Rep 8, 10931 (2018). https://doi.org/10.1038/s41598-018-29334-5
![Page 29: MinION Nanopore sequencing](https://reader030.vdocument.in/reader030/viewer/2022020620/61e43ae161595b21ff5e0be6/html5/thumbnails/29.jpg)
Thank you for your attention.
Created thanks to the support of the project: PIGA C1_VSCHT_2019_066