modulation of furin-mediated proprotein processing activity by

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc.

Val. 268, No. 29, Issue of October 15, pp. 21826-21834, 1993 Printed in U. S. A.

Modulation of Furin-mediated Proprotein Processing Activity by Site-directed Mutagenesis*

(Received for publication, May 5, 1993, and in revised form, June 17, 1993)

John W. M. CreemersS, Roland J. Siezent, Anton J. M. RoebroekS, Torik A. Y. AyoubiSll, Danny HuylebroeckII , and Wim J. M. Van de VenS** From the +Laboratory for Molecular Oncology, Center for Human Genetics, University of Leuuen, Herestraat 49, B-3000 Leuuen, Belgium, the §Department of Biophysical Chemistry, Nederlands Instituut voor Zuiuelonderzoek, Kernhemseweg 2, 6710 BA Ede, The Netherlands, and the IlLaboratory for Molecular Biology, CELGEN, University of Leuven, Herestrant 49, B-3000 Leuven, Belgium

The proprotein processing activity of mutants of the subtilisin-like enzyme furin was studied in transfected mammalian cells. Our studies indicate that the three residues of the catalytic triad of furin, Asp4’, His”, and Ser”’, are critical not only for substrate processing but also for maturation of furin. Furthermore, evidence is provided that maturation of furin occurs through an intramolecular autocatalytic process. Sub- stitution of the asparagine residue (Asn‘”) of the oxyanion hole by an alanine residue appears to block substrate processing but not furin maturation. Analysis of carboxyl-terminal deletion mutants revealed that the segment encompassing residues G ~ u ~ ~ ~ to Glu4” of the “middle” domain, which is more than 100 residues downstream of the predicted catalytic domain, contains residues that seem to be critical for processing activity but that the more carboxyl-terminal cysteine- rich region, the transmembrane region, and the cytosolic tail are dispensable. Finally, we made mutants in the substrate binding region of human furin and studied their ability to process von Willebrand factor (pro- vWF) substrates, including wild-type pro-vWF as well as pro-vWF mutants in which the P1 (VWFR-lG), P2 (vWFK-PA), or P4 (vWFR-4A) basic residue with re- spect to the pro region cleavage site had been mutated. It is demonstrated that particular negatively charged residues in or near the substrate binding region of furin are critical for cleavage activity and specificity of the enzyme for multiple basic residues in the substrate. Furthermore, substrate binding region mutants of furin were obtained, which cleaved either the pro- vWFK-PA or pro-vWFR-4A mutant of pro-vWF more efficiently than wild-type pro-vWF.

~~~ ~

It is now established that a variety of polypeptide hormones, neuropeptides, and other proteins that enter the secretory

* This work was supported in part by the Inter-University Network for Fundamental Research sponsored by the Belgian Government (1991-1995), the Geconcerteerde Onderzoekacties 1992-1996, the Na- tionaal Fonds voor Wetenschappelijk Onderzoek (NFWO, Leven- slijn), EC contract BIOT-CT91-0302, and funding to the Laboratory of Molecular Biology (CELGEN) through the Faculty of Medicine of the K. U. Leuven and Innogenetics SA. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

B Holder of a European Molecular Biology Organization long term fellowship.

** To whom correspondence should be addressed. Tel.: 32-16-345- 987; Fax: 32-16-345-997.

pathway mature from high molecular weight precursor proteins by selective endoproteolytic cleavage within the cells (1- 7). Cleavage of precursors of most hormones and neuropeptides occurs at Lys-Arg or Arg-Arg sequences in dense core secretory vesicles, whereas precursors of proteins that are secreted via the constitutive pathway seem to have more complex cleavage sites, the consensus sequence of which can be represented as Arg-X-Lys/Arg-Arg. Recently, a number of such processing enzymes have been identified in mammals (for recent reviews, see Refs. 8 and 9). Structurally and functionally, these enzymes resemble the prohormone convertase (PC)’ kexin, a subtilisin-like serine protease of yeast (6, 10). The mammalian prototype is furin (11, 12), which is encoded by the ubiquitously expressed FUR gene (13-16). Another ubiquitously expressed proprotein-processing enzyme is PACE4 (17). Other enzymes of this family display a more tissue-specific distribution; expression of the enzymes PCl/PC3 and PC2, for instance, is neuroendocrine-specific (18-21), that of PC4 is germ cell-specific (22, 23), and PC51 PC6 is expressed in subsets of endocrine and nonendocrine cells (24,25). Selective endoproteolysis at pairs of basic amino acid residues by furin was first demonstrated in coexpression experiments using the precursor of von Willebrand factor (pro-vWF) (11) or P-nerve growth factor (26) as substrate. Furin-mediated processing of a variety of other precursor proteins has been described now, including anthrax toxin protective antigen (27) and viral proteins such as hemagglu- tinin of influenza virus (28) and gp160 of the human immunodeficiency virus-1 (HIV-1) (29).

Preprofurin consists of a “prepro” domain (containing a cleavable signal peptide), a subtilisin-like catalytic domain, a “middle” domain, a cysteine-rich region, a transmembrane region, and a cytosolic tail (11, 12). Furin is activated by cleavage of its “pro” region from the catalytic domain at a consensus sequence for furin cleavage; it has been suggested that this is an autocatalytical and intramolecular event (30). A mutant form of furin which lacked the pro sequence was nonfunctional, whereas addition of the pro sequence of the PC2 enzyme did not restore activity (31). The subtilisin-like catalytic domain of furin possesses a characteristic catalytic triad, consisting of the residues Asp46, Hiss7, and Ser261 of which the Asp46 and Ser2‘j1 residues have been documented to be critical for substrate processing (30, 32,33). Another characteristic feature of the active site of furin is the oxyanion hole, with Asdm as critical residue; this asparagine is con-

l The abbreviations used are: PC, prohormone convertase; HIV-1, human immunodeficiency virus-1; vWF, von Willebrand factor; pro- vWF, precursor of von Willebrand factor; kbp, kilobase pair; PCR, polymerase chain reaction.

21826

Site-directed Mutagenesis of Human Fur in 21827

served in all other enzymes (34), except for PC2, which has an aspartic acid residue (18). Analogous to subtilisin, this oxyanion binding site is believed to stabilize an oxyanion intermediate that is generated during hydrolysis of the scissile peptide bond (35). A model of the three-dimensional structure of the catalytic domain of human furin was proposed (11,34) based on the amino acid sequences and the three-dimensional structures of the prokaryotic serine proteases thermitase, subtilisin Carlsberg, and subtilisin BPN’. This three-dimensional structure was predicted to consist essentially of the framework core of the three prokaryotic proteins with several short insertions in external loops and connections between helices and @-sheets. Two potential calcium ion binding sites were identified, and two potential disulfide bonds were proposed. This molecular modeling also suggested appropriate positioning of the residues of the catalytic triad and the oxyanion hole toward the substrate. Of particular interest was the predicted large increase in the number of negatively charged side chains in the substrate binding region of furin, as compared with the subtilisins. Many of these negatively charged residues in furin, which appeared to be absent in equivalent positions in the subtilisins and thermitase, could interact directly with basic amino acid residues near the substrate cleavage site since they were predicted to be located in or near the S1, S2, and S4 binding pockets for lysine and/ or arginine (36). It was hypothesized that such a high density of negative charges could contribute to a selectivity for positively charged substrate segments.

In this study, we first investigated the relevance of particular amino acid residues or protein domains in furin for substrate processing and autocatalytical zymogen activation. We then investigated which of the negatively charged side chains of the substrate binding region of furin constitute a determining factor for the cleavage selectivity of furin for positively charged substrate segments. Using site-directed mutagenesis, a variety of furin mutants was constructed. Mutants of pro-vWF were also made; mutations were made in its pro region cleavage site Arg-Ser-L~s-Arg~~~. Biosyn- thesis and maturation of wild-type furin and its mutants were compared, using immunological techniques and, in particular, a panel of monoclonal antibodies with specificity for the various domains of furin. Proprotein processing activity of the various furin mutants was then tested in coexpression studies using wild-type and mutants of pro-vWF as substrates. In this report, we present results that point toward differences between autocatalytical maturation of furin and substrate processing by furin. We show that only the subtilisin-like catalytic domain and part of the middle domain of furin are required for proprotein processing activity, and we provide for the first time evidence that negatively charged side chains of residues of the substrate binding region of furin indeed constitute a determining factor for the cleavage specificity of furin.

MATERIALS AND METHODS

Construction of Mutants of Human Furin and uon Willebrand Factor-Site-directed mutagenesis was used to generate mutants of human furin with alterations in specific residues of the catalytic triad, oxyanion hole, and substrate binding region or with deletions of carboxyl-terminal segments (see Table I). The altered sites in vitro mutagenesis system (Promega) was used according to the guidelines of the supplier. A 4.1-kbp human FUR EcoRI-EcoRI cDNA fragment, starting 117 nucleotides upstream of the ATG start codon and ending 21 nucleotides downstream of the poly(A) addition site (37), was cloned into pSelect. Primers used in the in vitro mutagenesis experiments and the names of the corresponding mutants are listed in Table I. The furin mutant, in which the cysteine-rich region has been deleted, was constructed using a PCR-based approach, referred to as

overlap extension (38). In the initial step, two standard PCR reactions were performed (39) using the 4.1-kilobase FUR cDNA as template and either 5’-GGC-CTG-CTC-GTC-CAC-ACT-3’ (1A) and 5’-CTA-

TCA-CAC-3’ (1B) or 5’-GTG-TGA-GGG-CAG-CAG-CCC-TGC- GCT-GGT-GTT-TTC-AAT-CTC-TAG-3’ (2A) and 5”CCC-TCA- GAT-ATC-TCC-TAG-3’ (2B), as the two primer sets. In a second PCR round, the two purified products of the initial PCR reactions were used for overlap extension in the presence of the two outer primers (1A and 2B). The final blunt-end PCR product was digested with restriction endonucleases BamHI and EcoRV. This BamHI- EcoRV DNA fragment was cloned into the FUR cDNA from which the BamHI-EcoRV DNA fragment was deleted, and the resulting clone was designated pJC44. It should be noted that in this procedure also a portion of the middle domain is also deleted (amino acid residues +449 to +466).

For the construction of pro-vWF substrate cleavage mutants, a 0.5- kbp HindIII-BamHI DNA fragment was isolated from a 8.8-kbp cDNA fragment containing all of the coding sequences for prepro- vWF (40). This 0.5-kbp DNA fragment, which contained the sequences that encode the pro region cleavage site (Arg-Ser-L~s-Arg~~~) of pro-vWF, was subcloned in pSelect, and mutagenesis was performed as described above. A list of primers and corresponding pro- vWF mutants is given in Table 11. The mutated vWF fragments were cloned back into the remaining 8.3-kbp prepro-vWF cDNA.

Mutations in the DNAs of all furin and pro-vWF mutants were confirmed by nucleotide sequence analysis. For expression studies in COS-1 cells, DNAs of the furin and vWF mutants were cloned in pSVL (Pharmacia LKB Biotechnology Inc.) in the proper orientation for expression. Names for the resulting clones were obtained by combining the acronym of the vector (pSVL) with that of the mutant; e.g. for the FUR mutant resulting from the S261A (SerZ6’ + Ala) substitution, the name pSVLfurS26lA is used. In the pSVL vector system, expression is under control of the SV40 late promoter. Expression studies using recombinant vaccinia virus V.V.:T7 were performed as described before (41). In these studies, DNA of furin mutants in pSelect or DNA of furin and pro-vWF mutants in pGEM- 7Zf(+) (Promega) were used, allowing expression under control of a T7 promoter (43, 44). To the resulting clones, a name was given in a similar way as described above for the pSVL vector, e.g. pGEMfur- S261A.

Metabolic Labeling of Transfected COS-I Cell. and Immunoprecip- itation Analysis-Transfection of COS-1 cells was performed as described previously (41). Metabolic labeling and immunoprecipitation analysis of vWF polypeptides were carried out as described before (11). As far as furin is concerned, immunoprecipitation analysis was performed as follows. Prior to labeling, COS-1 cells were starved for 1 h in methionine- and cysteine-free RPMI 1640 medium. Subse- quently, cells were labeled for 2 h in the presence of [3sS]methionine and [3sS]cysteine (200 pCi/ml each, specific activity > 800 Ci/mmol). Cells were then immediately lysed in 1 ml of DIPA buffer (10 mM Tris-HC1 (pH 7.5), 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS) supplemented with 1 mM EDTA, 1 pg/ml pepstatin, 100 units/ml Trasylol, and 1 mM iodacetamide. After centrifugation for 5 min at 3,000 Xg, supernatants were precleared by incubation with preformed complexes of protein A-Sepharose and a rabbit anti-mouse IgG preparation (Dakopatts, Glostrup, Denmark) as described above. Immunoprecipitation of furin was carried out with mouse anti-furin monoclonal antibodies (42) and preformed complexes of protein A-Sepharose and a rabbit anti-mouse IgG preparation. After washing of the immunoprecipitates twice with DIPA buffer and once with 10 mM Tris-HC1 (pH 7.8), immunoprecipitates were analyzed by SDS-polyacrylamide gel electrophoresis under re- ducing conditions using a 7.5% polyacrylamide gel. Anti-furin monoclonal antibodies used in this study included MON-148, (directed against the subtilisin-like catalytic domain; amino acid residues +16 to +189), MON-150 (epitope maps in a region including 48 carboxyl- terminal residues of the pro region and the first 16 residues of mature furin; residues -48 to +16), and MON-152 (epitope maps in a region including a carboxyl-terminal portion of the middle domain, the complete cysteine-rich region, and most of the transmembrane domain of furin; residues +435 to +629) (42). MON-152 recognizes human furin but not mouse furin (42).

Coexpression of Furin and u WF in PK15 Cell.-Transfer of DNA into V.V.:T7-infected PK15 cells has been described before (41). Subsequent analysis of newly synthesized vWF polypeptides was performed as reported previously (41). Immunoprecipitation analysis

GAG-ATT-GAA-AAC-ACC-AGC-GCA-GGG-CTG-CTG-CCC-

21828 Site-directed Mutagenesis of Human Furin TABLE I

Mutants of furin Name of mutant Mutation Mutagenic primer

Catalytic triad or oxyanion hole mutants D46A H87A N 188A S261A

A606-end A476-end A304-end 2x449-598

D47T D84G E1231 D126N E129V E150N D199V D248L E150N/D151N/D152N

Deletion mutants

Substrate binding region mutants

Asp" + Ala HisR7 --.* Ala

+ Ala Ser2" + Ala

Leum -t amber

Trp"' + amber AGIu~~' + Arg59R

Asp4' + Thr AspR4 + Gly GIu"~ + Ile Asp'2fi + Asn GIu''~ + Val GIU'~" + Asn Asp'% + Val AsD"~ -t Leu

+ ochre

CATTCTGFCGATGGCATC AATGACAACAGTCGGCACACGGTG TGGGCCTCGGGTCGGGGGCCGGGA CACGGGCACCSAGCCTCTG

CTGCCCTCACACFGCCTGAGGTGGTG CCCGTACCTCCATAAAGCAGTGGCT ATGCCAACGACTAGGCCACCAATGG See "Materials and Methods"

TCCATTCTGGACKTGGCATCGAGAA CAGATGAATFAACAGGCA CATGCTGGATGGCGGTGACAGATGCA G CGAGGTGACeTGCAGTGGA GATGCAGTGGTGGCACGCTC AGCTGGGGCCCC-MTGATGACGGCAAG TGCAACTGCGTCGGCTACAG .

G l k " + Asn ATCGTGACGACTECTTGCGGCAGAA Asp'" --.* Asn CAGCTGGGGCCCCLMT4ACGG

Asp"' + Ser GCTGGGGCCCCGAGETFGGCAAGACAGTGG CAAGACAGT

's2 + Gly

of newly synthesized furin polypeptides using MON-148 as anti-furin antibody was performed similarly as described above for COS-1 cells.

RESULTS AND DISCUSSION

Immunoprecipitation Analysis of Furin Biosynthesis and Processing-In earlier studies (11, 12), we reported the synthesis of two.furin proteins (100 and 90 kDa) in COS-1 cells that were transfected with FUR cDNA under control of the SV40 late promoter. It was assumed that the 100-kDa protein represented profurin, and the 90-kDa protein, a processed form of furin, lacking the pro domain. The latter hypothesis was recently confirmed (30) by amino-terminal sequencing of the radiolabeled 90-kDa furin protein. Furthermore, it was established by others that furin-mediated cleavage of a protein substrate in vitro was associated with the 90-kDa and not the 100-kDa furin protein; suggestive evidence was obtained by the same group that activation of furin occurs by intramolecular autoproteolytic cleavage at the sequence Arg-Thr-Lys- Arg" (30). To investigate whether or not the 100-kDa protein contains the pro domain and to confirm that this domain is cleaved off with maturation of profurin to the 90-kDa form, we carried out immunoprecipitation analysis using anti-furin monoclonal antibodies MON-148 and MON-150. Reactivity of MON-148 was mapped to a region (amino acid residues +16 to +189) in the catalytic domain of human furin, and that of MON-150 to a region spanning the junction of the pro and catalytic domain (residues -48 to +16) (42). Various pulse-chase experiments (pulse labeling for 5 min) using FUR- transfected COS-1 cells and MON-148 as antibody (Fig. lA) indicated that the 100-kDa protein is synthesized first. After a chase of 10 min, the 90-kDa protein could already be detected, and after a chase of 30 min, both the 100- and 90- kDa proteins were present in equal amounts. After prolonged chase periods, both proteins remained detectable by immunoprecipitation in about equal amounts, even after a chase of 16 h (data not shown). These results are in agreement with our previous Western blot results which also showed the detection of almost equal amounts of the two proteins in transfected COS-1 cells (11). Since the FUR-encoded proteins are expressed a t high levels in the transfected COS-1 cells, it cannot be excluded that this ratio does not reflect the natural

0 min 10 min 30 min 120 min

nt wt nt wt nt wt nt wt A _""" ~"""-1 ~""", r-----l kDa 200 -

~.

97 -

68-

B 1 2

kDa 200 '

97 -

68 -

, pro-Furin

' Furin

FIG. 1. Immunoprecipitation and SDS-polyacrylamide gel electrophoresis analysis of furin biosynthesis in COS-1 cells transfected with pSVLfur-hu DNA. As a control, nontransfected COS-1 cells were used. Panel A , upon labeling of the cells with a mixture of ["S]methionine and [35S]cysteine for 5 min, radioactivity was chased for 0-120 min, as indicated. Immunoprecipitation analysis was performed with anti-furin monoclonal antibody MON-148, which recognizes an epitope in the subtilisin-like catalytic domain of furin. Molecular mass markers are indicated. nt, not transfected; wt, wild- type human FUR DNA. Panel R, comparative immunoprecipitation analysis of the pro- and processed form of furin with anti-furin monoclonal antibody MON-148 ( l a n e I ) and MON-150 (lane 2 ) . MON-150 recognizes an epitope previously mapped to the region of human furin consisting of amino acid residues -48 to +16 (42) (see also Fig. 2).

Site-directed Mutagenesis of Human Furin 21829

ratio. With the available anti-furin antibodies, however, we have not been able to detect physiological levels of human furin polypeptides in any of the cell types tested. In similar studies in which MON-150 was used as antibody, only the 100-kDa protein was detected (Fig. 1B). This shows that the 100-kDa protein contains pro domain sequences and that removal of these from profurin can be assayed immunologi- cally by loss of reactivity to MON-150.

It has been reported (31) that removal of the pro domain sequences from profurin occurs in a postendoplasmic reticulum compartment, since the addition of the endoplasmic reticulum retention sequence, Lys-Asp-Glu-Leu, to a truncated form of furin, which lacked the transmembrane and cytosolic domains, prevented formation of active furin (31). Furthermore, a mutant form of furin lacking the pro domain was not functional, and in-phase fusion of this mutant to the pro domain of PC2, a related proprotein-processing enzyme, did not result in the formation of active furin (31). This strongly points toward a relevant role of the pro domain. In light of the apparently rather strict sequence requirements, it is possible that the pro domain of this enzyme acts as an intramolecular chaperone and guides the folding of furin into its mature form, as also demonstrated previously for subtilisins (45).

Differences between Substrate Processing and Maturation of Furin-The autocatalytic processing of profurin mutant polypeptides in which one of the residues of the catalytic triad (Asp46, Hiss7, SerZ6l) or the oxyanion hole (Amla) was replaced by an alanine residue (Fig. 2) was then studied. After transfection of the respective expression constructs into COS-

Human furin NH

-107 1 100 200

1 cells, cells were labeled with a mixture of [35S]methionine and [3SS]cysteine, and immunoprecipitation analysis was performed (Fig. 3A) . In cells transfected with any of the three catalytic triad mutants, the 100-kDa mutant profurin could be detected but not a 90-kDa protein. Furin processing is apparently impaired by the catalytic triad mutations. How- ever, in cells transfected with the oxyanion mutant N188A, both the 100- and the 90-kDa furin proteins were detected (Fig. 3A, lane 6), suggesting that asparagine 188 of the oxyanion hole is not critical for maturation of furin. It is possible that maturation occurs at a slower rate because of a lower activity of N188A furin, as observed with similar subtilisin mutants (46). This, however, remains to be established. Pre- liminary immunofluorescence analysis of the subcellular lo- calization of the catalytic triad and oxyanion hole mutants of furin revealed no major differences in subcellular distribution patterns (data not shown).

To test endoproteolytic activity of the catalytic triad mutants of furin as well as the oxyanion hole mutant on a substrate, the processing of pro-vWF was studied, as shown in Fig. 4A. Control experiments, using wild-type human furin and, as substrates, wild-type and mutant pro-vWF (vWFR- lG), were included. Pro-vWF processing by the endogenous furin activity is shown in lane 3; VWFR-1G is not processed by wild-type furin (11; Fig. 4A, lane 2). Each of the three catalytic triad mutants as well as the oxyanion mutant gave the same result; they all appeared to be unable to increase pro-vWF cleavage significantly, if at all.

In summary, the failure of the catalytic triad and oxyanion hole mutants of furin to process the pro-vWF substrate,

300 400 500 600 687

PEPro catalytic middle CRR TM cyt

526 1 +A

H87+A

M6+A

I N188+A - E476+st&odon

W304+stopcodon 449 598

residue

COOH

S26 1 A

H87A

D46A

N188A

A 606-end

A 476-end

A 304-end

A 449-598 FIG. 2. Schematic representation of mutants of furin with single alanine substitutions replacing residues of the catalytic

triad (Asp"', His", or Sera'') or the oxyanion hole (Asn"') or with different deletions in the carboxyl-terminal region of the protein. Point mutations were generated by site-directed mutagenesis. Deletion mutants A606-end, A476-end, and A304-end were obtained by introducing translational stop codons. Furin deletion mutant A449-598 was constructed by overlap extension (see "Materials and Methods"). The various protein domains of furin are indicated. CRR, cysteine-rich region; TM, transmembrane anchor; cyt, cytoplasmic domain.

21830 Site-directed Mutagenesis of Human Furin

A 1 2 3 4 5 6

. . . " .

"

68-

97 .

A 1 2 3 4 5 6

kDa

L." -d

200 - uu

7 8

- .. - pro-vWF - vWF

B 1 2 3

kDa 200 .

97 -

68

43

4 5 6

FIG. 3. Biosynthesis of human furin mutants with point mutations in the subtilisin-like catalytic domain (panel A ) or with deletions in the carboxyl-terminal region of the protein (panel B ) . Upon transfection of COS-1 cells with 10 pg of pSVLfur- hu DNA (lanes 2, panels A and B ) , pSVLfurS261A DNA (panel A , lane 3), pSVLfurHS7A DNA (panel A , lane 4 ) , pSVLfurD46A DNA (panel A , lane 5 ) , pSVLfurN188A DNA (panel A, lane 6 ) , pSVLfurA606-end DNA (panel B, lane 3), pSVLfurA476-end DNA (panel B, lane 4 ) , pSVLfuril304-end DNA (panel B, lane 5 ) , or pSVLfurA449-598 DNA (panel B, lane 6 ) , cells were labeled with a mixture of ["S]methionine and ["S]cysteine, and newly synthesized furin proteins were analyzed by immunoprecipitation analysis with anti-furin monoclonal antibody MON-148. Nontransfected COS-1 cells were used as a control (panels A and B, lanes 1) . Molecular mass markers are indicated.

together with the fact that the oxyanion hole mutation apparently did not affect processing of profurin itself, suggests that there are differences between processing of substrates by furin and (auto)processing of furin itself.

Effect of Domain Deletions on Proteolytic Activity of Human Furin-To test the relevance of the carboxyl-terminal domains of furin for endoproteolytic activity, four deletion mutants were constructed (Fig. 2). Mutant A606-end lacks the transmembrane domain and the cytosolic tail. Similarly, deletion mutant A476-end is a truncated form of furin lacking all carboxyl-terminal sequences after the middle domain, including the cysteine-rich region, whereas in mutant A304-end, the last 27 residues of the catalytic domain and all sequences downstream of the catalytic domain are deleted. Finally, in mutant A449-598, the cysteine-rich region and 18 carboxyl- terminal amino acids of the middle domain are deleted. Bio- synthesis of these deletion mutant proteins was first studied in transfected COS-1 cells, and expression of mutant furin forms was detected by SDS-polyacrylamide gel electrophoresis (Fig. 3B). In case of mutant A606-end (lune 3 ) , a double protein band was observed; the weak upper band most likely represents the precursor form of the mutant protein. It is of interest to note that of the mutant furin forms that lack a transmembrane domain, those encoded by A606-end and A476-end were readily detectable in the medium (data not shown). The protein encoded by deletion mutant A304-end, which also lacks a transmembrane domain, could not be detected in the medium.

To test the biological activity of these deletion mutants, the processing of pro-vWF was studied (Fig. 4B). Deletion

B 1 2 3 4 5

kDa 6

97 -

FIG. 4. Analysis of endoproteolytic processing of pro-vWF by human furin mutants with point mutations in the subtilisin-like catalytic domain (panel A ) or with deletions in the carboxyl-terminal region of the protein (panel B ) . COS-1 cells were used in transfection experiments in which a total amount of 10 pg of DNA was transferred; in cotransfection experiments with two DNA preparations, 5 pg of each of the DNAs was used. Biosynthesis and processing of vWF-related proteins were studied by immunoprecipitation analysis. Molecular mass markers and the relative positions of pro-vWF and mature vWF are indicated. DNA transferred: panel A: lane 1, pSVLvWFR-1G; lane 2, pSVLvWFR-1G and pSVLfur-hu; lane 3, pSVLvWF; lane 4 , pSVLvWF and pSVLfur-hu; lane 5, pSVLvWF and pSVLfurS261A; lane 6, pSVLvWF and pSVLfur- H87A, lane 7, pSVLvWF and pSVLfurD46A; lane 8, pSVLvWF and pSVLfurN188A. Panel R: lane 1, pSVLvWF; lane 2, pSVLvWF and pSVLfur-hu; lane 3, pSVLvWF and pSVLfurA606-end lane 4 , pSVLvWF and pSVLfurA476-end; lane 5, pSVLvWF and pSVLA304- end; lane 6, pSVLvWF and pSVLfurA449-598.

mutants A606-end and A476-end were still capable of processing pro-vWF to the same extent as wild-type human furin (Fig. 4B, lunes 2-4). This indicates that the cysteine-rich region, the transmembrane domain, and the cytosolic tail are not critical for pro-vWF processing. The middle domain, however, seems to play a critical role since truncation of furin from the carboxyl-terminal end of the catalytic domain (mutant A304-end) or internal deletion of the cysteine-rich region and part of the middle domain (mutant A449-598) impaired proteolytic activity fully (Fig. 4B, lanes 5 and 6). In studies on processing of wild-type and mutants of mouse prorenin by wild-type and deletion mutants of mouse furin, it has been reported (47) that a A470-end mutant of furin was biologically active, whereas a A441-end mutant was cleavage-defective. Together with our observation that a A449498 mutant is also processing-defective, this implies that the 21-amino acid stretch G ~ u ~ ~ ~ - G ~ u ~ ~ ~ , which is more than 100 residues downstream of the catalytic domain, contains sequences that seem to be critical for processing activity. The role of these sequences remains to be elucidated, but it is possible that the truncated and deleted forms of furin that are processing- defective are incorrectly folded or incorrectly associated with

Site-directed Mutagenesis of Human Furin 21831

1 2 3 4 5 kDa 200 -

97 -

68 -

FIG. 5. Analysis of biosynthesis and autoproteolytic processing of furin proteins encoded by furin mutant S261A coexpressed with the processing-competent furin deletion mutant A606-end. COS-1 cells were transfected with 10 pg of pSVLfur-hu DNA (lane 2 ) , 10 pg of pSVLfurS261A DNA (lane 3 ) , 10 pg of pSVLfurA606-end DNA (lane 4 ) or 5 pg of pSVLA606-end DNA and 5 pg of pSVLfurS261A DNA (lane 5), and biosynthesis of furin- related proteins was studied by immunoprecipitation analysis using anti-furin monoclonal antibody MON-148. As a control, nontransfected COS-1 cells were used (lane I). Molecular mass markers are indicated.

its normal cellular compartment. In a bacterial subtilisin-like protease, residues critical for specificity were also found in a short segment far downstream of the catalytic domain (45), and activity was also lost upon progressive carboxyl-terminal truncation of a large middle domain?

Maturation of Furin Occurs through Intramolecular Auto- proteolytic Cleavage-Above, we reported that in the studies of the catalytic triad mutants of furin, which are defective for pro-vWF processing, no detectable levels of the processed forms of the corresponding profurin mutants could be detected (Fig. 3A). Compared with endogenous processing of pro-vWF, this might indicate that processing of the mutant furin enzymes by endogenous furin or furin-like enzymes in COS-1 cells is highly inefficient or does not occur a t all. This raises the question as to whether processing of furin occurs through intramolecular (auto)proteolytic cleavage. Suggestive evidence for this possibility was obtained in previous studies (30) in which a furin mutant with a mutation of the active site aspartate (Asp46 Asn) was coexpressed with a biologically active, truncated form of furin, lacking the transmembrane and cytoplasmic domains. In a similar experiment, in which our catalytic triad mutant S261A and deletion mutant A606- end were cotransfected into COS-1 cells, we also found that the pro domain of profurin S261A was not cleaved off (Fig. 5). However, there might be another explanation for these results. Deletion of the transmembrane domain is likely to prevent the A606-end furin from being tightly associated with cellular membranes; as discussed above, the A606-end was efficiently secreted in the medium. Furthermore, it has been reported (31) that the transmembrane and cytoplasmic domains are required for retention in the secretory pathway but not for propeptide processing activity. The failure to demon- strate processing could therefore be due to the fact that, unlike the processing-defective catalytic triad mutants, the processing-competent truncated mutants of furin are not retained in the secretory pathway. Therefore, we have performed experiments in which S261A mutant furin was coexpressed in COS- 1 cells with wild-type mouse furin; the mouse FUR DNA construct was shown previously to encode biologically active mouse furin (42). Biosynthesis of furin proteins was studied by immunoprecipitation analysis using MON-148 and MON- 152. MON-148 recognizes both human and mouse furin, whereas MON-152 recognizes only human furin (42). The availability of anti-furin monoclonal antibody MON-152

P. G. Bruinenberg, personal communication.

made it possible to detect selectively the human S261A furin proteins in the presence of mouse furin. The results of the coexpression studies, shown in Fig. 6, A and B, clearly indicate that wild-type mouse furin cannot process the catalytic triad mutant S261A of human furin and support the suggestion that profurin maturation into the 90-kDa mature form occurs through intramolecular autoproteolytic removal of the pro domain.

Proprotein-processing Specificity of Furin Can Be Modu- lated by Altering Negatively Charged Amino Acid Residues in the Substrate Binding Region of the Enzyme-Using the three- dimensional structures of the prokaryotic serine proteases thermitase, subtilisin Carlsberg, and subtilisin BPN', a schematic model of the catalytic domain of human furin was proposed (11). Recently, more detailed predictions of the three-dimensional structure of the catalytic domain and of the substrate binding interactions have been made, based on homology modeling (36). Intriguing in these three-dimensional models is the predicted large increase in the number of negatively charged residues in the substrate binding region of furin, relative to subtilisins. Interestingly, multiple alignment studies with PCl/PC3, PC2, PC4, PC5/PC6, and PACE4 reveal that many of these negative charges are conserved, especially those predicted to be located near one of the substrate binding pockets. Such a high density of negative charge may contribute to the observed selectivity for substrate segments with multiple positive charges as has been documented for furin in particular. To investigate this hypothesis we constructed 10 human furin mutants in which we replaced particular negatively charged residues in or near the substrate binding region. To determine the protein engineering strategy, information deduced from the amino acid sequences of more than 40 subtilisin-like serine proteases was used as well (34). These mutations in the substrate binding region are listed in Table I. The predicted positions of these mutated residues relative to the SI, S2, and S4 binding pockets of furin, the catalytic triad, and the oxyanion hole are schematically indicated in the drawing in Fig. 7, which is adapted from Siezen (36). In most of the mutants, only a single negatively charged residue was replaced, whereas in others, up to 3 of these residues were substituted. Processing activity of these furin mutants was tested on wild-type pro-vWF (cleavage site: Arg- Ser-L~s-Arg'~~) (Fig. 8, row A) and three pro-vWF mutants in which the pro sequence preceding the cleavage site had been altered (Table 11). These pro-vWF mutants included

A 1 2 3 4 5 I 3 1 2 3 4 5

kDa .. 200 .

97 -

68 -

FIG. 6. Analysis of biosynthesis and autoproteolytic processing of the S261A mutant of human furin coexpressed with wild-type mouse furin. COS-1 cells were transfected with 10 pg of pSVLfur-hu DNA (lanes 2) , 10 pg of pSVLfur-mu (lanes 3), 10 pg of pSVLfurS26lA DNA (lanes 4 ) , or 5 pg of pSVLfur-mu DNA and 5 pg of pSVLfurS26lA DNA (lanes 5), and biosynthesis of furin-related proteins was studied in labeling experiments using ["S]methionine

clonal antibody MON-148 (panel A ) or MON-152 (panel B ) was and ["S]cysteine; for immunoprecipitation analysis, anti-furin mono-

used. MON-148 recognizes both human and mouse furin, whereas MON-152 recognizes human furin only. As control, nontransfected COS-1 cells were used (lanes I ). Molecular mass markers are indicated.

21832 Site-directed Mutage

D248 D84 Dl21 I

FIG. 7. Schematic representation of the substrate binding region of the enzyme furin adapted from (36). The positions of negatively charged residues, predicted to be in or near the substrate binding region of furin and studied here, are indicated around the binding pockets S1, S2, and S4. These residues correspond to Asp", Asp"', Asp121, GluIz3, Asp"', G~U'~', G1u'60, Asp'", Asp'52, Asp'99, and Asp2*. The positions of the residues of the catalytic triad, Asp6, His", and Ser"', and the oxyanion binding site Asn" are boxed. The cleavage site of a hexapeptide substrate (P4-P3-P2-Pl-Pl'-P2'), carboxyl-terminal of P1, is indicated by a zig-zag line. Nomenclature of Pn and Sn is according to Schechter and Berger (52).

VWFR-1G ( A r g - S e r - L ~ s - W ~ ~ ~ ) (Fig. 8, row B ) , vWFK-2A (Arg-Ser-&-Arg7=) (Fig. 8, row C), and vWFR-4A (m- S e r - L ~ s - A r g ~ ~ ~ ) (Fig. 8, row D) and are listed in Table 11. Results of biosynthesis and autocatalytic processing of wild- type human furin and the various furin mutants are presented in row E of Fig. 8. Processing studies were then performed in PK15 cells using a recombinant vaccinia virus expression system, since pilot studies with the pro-vWF and furin mutants had indicated that processing as well as autocatalytic maturation proceeded more efficiently in this system than in the system using COS-1 cells (see also below).

In the first two lanes of rows A-D, the following control experiments are shown: endogenous processing of wild-type pro-vWF and the three pro-vWF mutants (the first lanes) and processing by wild-type human furin (the second lanes), re- spectively. Row B shows that wild-type furin and the 10 mutant furins cannot process VWFR-1G (11). This suggests either that the basic residue in the P1 position is very critical or that the substitution into glycine is very unfavorable. Since glycine is much smaller than arginine and in fact has no side chain, it cannot interact with either a negatively charged residue or a hydrophobic residue of the S1 binding pocket. Studies with substrates in which the P1 arginine is mutated into large hydrophobic residues will be needed to elucidate the interactions within the S1 binding pocket. From our three- dimensional model we predict Asp'" to be a prime candidate for interaction with a P1 basic residue (see below). In contrast to VWFR-lG, the vWFK-2A and vWFR-4A substrates were processed almost to completion by wild-type furin. In COS-1 cells, however, processing of the latter two pro-vWF mutants proceeded for only 40-60% (results not shown), as was also reported by Rehemtulla and Kaufman (33). Maturation of the furin mutants by autoprocessing seems to proceed more efficiently in the recombinant vaccinia virus-based expression

'nesis of Human Furin

system as well; in transfected COS-1 cells, no detectable maturation of most of the furin mutants could be detected, and no enzyme activity could be demonstrated (results not shown).

The single substitution in D47T (lanes 3 ) had an interesting effect since it seemed to have generated a furin mutant with a preference (with regard to its cleavage efficiency) for one of the three pro-vWF mutants that were tested, namely vWFK- 2A (sequence Arg-Ser-Ala-Arg763). Processing of wild-type pro-vWF and of the mutants VWFR-1G and vWFR-4A, which all have a lysine in the P2 position, appeared to be impaired. However, about 50% of mutant vWFK-PA, which has the P2 lysine replaced by an alanine, was processed. The Asp47 residue is predicted to be near the S2 binding pocket (36), and our results suggest that it may occupy a position critical for interaction with the P2 lysine. Replacement of this positively charged P2 lysine residue by a neutral alanine seemed to compensate to some extent for the negative effects of the D47T substitution. Again, alanine is a much smaller amino acid than lysine, and therefore it may interact less with residues in the S2 binding pocket. Conversely, introduction of larger uncharged residues at this P2 position in the substrate might enhance cleavage by the D47T furin mutant. Autocatalytic processing of D47T furin also appeared to be impaired (row E, lane 3 ) , probably because of the P2 lysine at the autoproteolytic cleavage site (sequence Arg-Thr-Lys- Arg"). Although only a fraction of the newly synthesized D47T profurin mutant was found to mature, this is apparently sufficient for processing of the vWFK-2A precursor.

The single substitutions in furin mutants D84G (lanes 4 ) , EXON (lunes 9), and E1231 (lanes 10) did not produce any changes; no differences were observed in processing of wild- type pro-vWF (row A ) , mutant vWFK-2A (row C), and mutant vWFR-4A (row D) substrates by these furin mutants as compared with processing by wild-type furin. Autocatalytic processing of these three furin mutants was also similar to that of wild-type furin (row E ) . The location of these negatively charged residues Aspa4, GlulZ3, and GluI5' within the catalytic domain of the enzyme is apparently too far away to contribute directly to specific interactions of these pro-vWF substrates with the binding region. Modeling studies show that GlulZ3 may interact with side chains of the P3 and/or P5 substrate residues, and this may contribute to binding if the substrate carries a positive charge at one of these position^.^

Amino acid residue Asp'" (lunes 5 ) is predicted to be located at the bottom of the S1 binding pocket. Substitution of Asp'99 into asparagine reduces the enzyme activity below detectable levels. This establishes the apparently critical role of Asp'99 for enzyme activity, presumably because of its indispensable negative charge within the S1 binding pocket needed to interact with the P1 arginine. From protein engineering studies of the S1 pocket in trypsin, it also appears that an aspartic acid residue (AsplS9), located at the bottom of the S1 binding pocket, is essential for specific interaction with the P1 arginine or lysine (48). Furthermore, substitution of Gly" in the S1 pocket of subtilisin (Asplg9 is in the equivalent position in human furin) into Asp'66 or Glu'@ resulted in a subtilisin mutant with specificity for arginine or lysine in the P1 position of substrates (49-51).

The single substitution E129V in furin (lanes 6) generated a mutant which hardly, if at all, processed VWFR-1G (Arg- S e r - L ~ s - G l y ~ ~ ~ ) and vWFK-2A (Arg-Se~Ala-Arg~~~). In contrast, it seemed to possess a preference for vWFR-4A (cleavage after Ala-Ser-L~s-Arg~~~), although partial cleavage was observed with wild-type pro-vWF (cleavage after Arg-Ser-

R. J. Siezen and J. W. M. Creemers, manuscript in preparation.

Site-directed Mutagenesis of Human Furin 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2

21833

A vWF (R6-K-RI

B VWFR-1G fR.S.K-G_I

: pro-vWF vWF

4 . pro-vWF . vWF

i :! J i 6 7 8 0 1 0 1 1 1 2

""""""'

, pro-Furin

' Furin

Lys-Gly"'), vWFK-PA (Arg-Ser-Ea-Arg7"'), and vWFR-4A (--Ser-Lys-Arg7"'), by wild-type and 10 substrate binding FIG. 8. Analysis of endoproteolytic processing of wild-type pro-vWF and pro-vWF cleavage mutants VWFR-1G (Arg-Ser-

region mutants of human furin. For these studies, enzymes and substrates were expressed in PK15 cells. Cells were first infected with recombinant vaccinia virus V.V.:T'I (rows A-D), which encodes T7 RNA polymerase, and thereafter, cells were lipofected with pGEMvWF DNA (row A ) , pGEMvWFR-IG DNA (row B), pGEMvWFK-2A DNA (row C), or pGEMvWFR-4A DNA (row D), as already described above. Together with the lipofection of the vWF-derived DNAs, DNAs encoding wild-type or one of the 10 substrate binding region mutants of human furin were lipofected, as indicated above the lanes. Biosynthesis and processing of vWF-related proproteins were studied in labeling experiments using [35S]methionine. In row E, biosynthesis and autocatalytical processing of wild-type and the substrate binding region mutants of human furin are shown. Lanes 1 , no furin; lanes 2, wild-type furin; lanes 3, D47T; lanes 4, D84G; lanes 5, D199G; lanes 6, E129V; lanes 7, D248L; lanes 8, D126N; lanes 9, E150N; lanes IO, E123I; lanes 11, E150N/D151N/D152N; lanes 12, D151S/D152G. The relative positions of pro-vWF and mature vWF and profurin and mature furin are indicated. All experiments were performed at least twice.

TABLE I1 Mutants of uon Willebrand factor

VWFR-1G Arg"j3 + Gly TAGGCTCCCTTTGCTGCG (53 )

vWFK-2A LYS'~' + Ala GATAGGCTCCTTEGCTGCGATGAGA

vWFR-4A Arg760 + Ala GCTCCTTTTGCTEATGAGACAGGG

L~s-Arg~~ ' ) . The Glu'*' residue is predicted to be at the bottom of the S4 binding pocket of furin (36), and our results suggest that it may have a critical position for interaction with the substrate P4 arginine. Replacement of the positively charged P4 arginine residue by an alanine in vWFR-4A apparently led to a more favorable substrate for cleavage by this E129V mutant enzyme (row D). The increase of hydrophobicity of the S4 pocket caused by the glutamate to valine substitution is possibly further enhanced by tryptophan 147 which may turn into the S4 binding pocket once the glutamate has been substituted by a smaller neutral residue. The overall effect will be a smaller, much more hydrophobic S4 binding pocket, perfectly capable of interacting with small hydrophobic P4 residues like alanine, as in the preferred substrate vWFR-4A. Autocatalytic processing of the E129V mutant was severely impaired, which is in agreement with the reduced cleavage of pro-vWF substrates with a P4 arginine, as shown above. Although only a minor portion of the newly synthesized profurin E129V mutant matures (row E, lune 6) , this is apparently sufficient for almost total processing of the vWFR- 4A precursor (row D, lane 6 ) .

Asp'26 is predicted to be at the entrance of the S4 binding

pocket (36). With mutant D126N (lunes 8), processing was only observed with the wild-type pro-vWF substrate; autocatalytic processing was impaired (row E, lune 8). The most likely effect of this mutation is only that the S4 binding pocket becomes less negatively charged; presumably, the size of the pocket is not affected. In contrast to the situation in furin mutant E129V, the tryptophan 147 in the D126N mutant cannot turn into the S4 binding pocket because it is still obstructed by G~U'~'. In this case, the size of the alanine side chain in vWFR-4A is probably too small to interact with the large S4 pocket, as already discussed above in the P1-S1 mutations.

The combined substitutions in furin mutants E150N/ D151N/D152N (lanes 11) and D151S/D152G (lunes 12) resulted in loss of processing activity; in all cases, no mutant furin-mediated cleavage was observed with any of the pro- vWF substrates. From these two inactive mutants, it can be deduced that at least one of the residues Asp'" or is important for substrate processing, since for G1u'sO, it had already been demonstrated (E150N mutant, lunes 9) that this residue is not important for binding these pro-vWF substrates. At the level of our three-dimensional model (see schematic model in Fig. 7), it is therefore tempting to specu- late that Asp"' is the most important residue since it is located closer to the S4 binding pocket than Additional engineering studies will be needed to substantiate this further. Finally, it should be stressed that in the furin mutants with multiple mutations, autocatalytic maturation was again severely impaired but not completely blocked (lunes l l and 12, row E ) . Since in furin mutant E129V a similar ratio between

21834 Site-directed Mutagel

precursor and mature furin was observed, it seems unlikely that the lack of substrate processing activity in these mutants is caused solely by the absence of sufficient mature enzyme.

No processing of any of the four pro-vWF substrates was observed with mutant D248L (lanes 7); however, autocatalytic processing was not impaired (row E , lane 7). This result is difficult to explain. From our three-dimensional model of the catalytic domain of furin, Aspz4', although predicted to be located some distant away from the catalytic groove, could interact with 2 arginine residues of the en~yme.~ The D248L substitution, therefore, was expected to lead to destabilization of the enzyme and also to impaired autoprocessing.

It is remarkable that negative charges on the residues 126, 129, and 151, which are predicted to be located close to the S4 binding pocket, are also present in all other known mem- bers of the family of subtilisin-like, mammalian proprotein- processing enzymes, even in those whose cleavage recognition site does not require an arginine at the P4 position (e.g. PC1/ 3 and PC2). Additional characteristics of the S4 binding pocket or contributions of additional binding subsites, such as S3, S5, and S6, might therefore determine the difference in cleavage specificity of these proprotein-processing enzymes. Alternatively, environmental factors may influence specificity; e.g. differences in local pH, substrate concentration, or specific ion concentration. Taken together, our engineering studies of the substrate binding region of human furin have provided the first evidence that residues with negatively charged side chains are important for cleavage specificity for sites with basic residues. A prominent example in this study is residue Asp47. Substitution of this single amino acid by a threonine residue apparently blocks or severely impairs cleavage of substrates with a lysine residue at the P2 position. Another single substitution, E129V, seems to alter the furin enzyme in such a way that the pro-vWF cleavage site preceded by a simple Lys-Arg pair is apparently preferable above one with an additional arginine in the P4 position.

Acknowledgments-We thank P. Groot Kormelink and E. W. Beek for contributions to the vaccinia virus experiments, M. Latijnhouwers for generating mutants, G. Vandereyken and I. Pauli for excellent technical assistance, and G. Doucet for synthesizing primers.

REFERENCES 1. Steiner, D. F., and Oyer, P. E. (1967) Proc. Natl. Acad. Sci. U. S. A. 6 7 ,

2. Chrktien, M., and Li, C. H. (1967) Can. J. Biochern. 4 6 , 1163-1174 3. Docherty, K., and Steiner D. F. (1982) Annu. Reo. Physiol. 44,625-638 4. Douglas, J., Civelli, O., and Herbert, E. (1984) Annu. Reu. Biochern. 5 3 ,

5. Sossin, W. S., Fisher, J. M., and Scheller, R. H. (1989) Neuron 2 , 1407-

6. Fuller, R. S., Sterne, R. E., and Thorner, J. (1988) Annu. Reu. Physiol. 5 0 ,

7. Hutton, J. C. (1990) Curr. Opin. Cell Biol. 2 , 1131-1142 8. Steiner, D. F., Smeekens, S. P., Ohagi, S., and Chan, S. J. (1992) J. Biol.

Chern. 2 6 7 , 23435-23438 9. Van de Ven, W. J. M., Van Duijnhoven, J. L. P., and Roebroek, A. J. M.

(1993) Crit. Reu. Oncog. 4 , 115-136 10. Julius, D., Brake, A,, Blair, L., Kunisawa, R., and Thorner, J. (1984) Cell

3 7 , 1075-1089 11. Van de Ven, W. J. M., Voorherg, J., Fontijn, R., Pannekoek, H., Van den

Ouweland, A. M. W., Van Duijnhoven, J. L. P., Roebroek, A. J. M., and Siezen, R. J. (1990) Mol. Biol. Rep. 14 , 265-275

473-480

665-715

1417

345-362

zesis of Human Furin 12. Van de Ven, W. J. M., Creemers, J. W. M., and Roebroek, A. J. M. (1992)

13. Roebroek, A. J. M., Schalken, J. A,, Bussemakers, M. J. G., Van Heerikhu- Enzyme 45,257-270

izen. H.. Onnekink. C.. Debruvne. F. M. J.. Bloemers. H. P. J.. and Van de Ven,'W. J. M. (1986) Mol. Bioi. Rep. 1 l', 117-125 '

14. Roebroek, A. J. M., Schalken, J. A., Leunissen, J. A. M., Onnekink, C., Bloemers, H. P. J., and Van de Ven, W. J. M. (1986) EMBO J. 6,2197-

15. Schalken, J. A,, Roebroek, A. J. M., Oomen, P. P. C. A,, Wagenaar, S. S., 2202

J. Clin. Inuest. 80, 1545-1549 Debruyne, F. M. J., Bloemers, H. P. J., and Van de Ven, W. J. M. (1987)

16. Barr, P. J., Mason, 0. B., Landsberg, K. E., Wong, P. A,, Kiefer, M. C., and Brake, A. J. (1991) DNA Cell Biol. 10,319-328

17. Kiefer, M. C., Tucker, J. E., Joh, R., Landsberg, K. E., Saltman, D., and Barr, P. J. (1991) DNA Cell Biol. 10 , 757-769

18. Smeekens, S. P., and Steiner, D. F. (1990) J. Biol. Chem. 2 6 6 , 2997-3000 19. Seidah, N. G., Gaspar, L., Mion, P., Marcinkiewicz, M., Mbikay, M., and

20. Smeekens, S. P., Avruch, A. S., LaMendola, J., Chan, S. J., and Steiner, D.

21. Creemers, J. W. M., Roebroek, A. J. M., and Van de Ven, W. J. M. (1992)

22. Nakayama, K., Kim, W. S., Torii, S., Hosaka, M., Nakagawa, T., Ikemizu,

23. Seidah, N. G., Day, R., Hamelin, J., Gaspar, A. M., Collard, M. W., and

24. Nakagawa, T., Hosaka, M., Torii, S., Watanabe, T., Murakami, K., and

25. Lusson, J., Vieau, D., Hamelin, J., Day, R., Chrktien, M., and Seidah, N.

Chrhtien, M. (1990) DNA Cell Biol. 9 , 415-424

F. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,340-344

FEBS Lett. 300,82-88

J., Baba, T., and Murakami, K. (1992) J. Biol. Chern. 267,5897-5900

Chrbtien, M. (1992) Mol. Endocrinol. 6, 1559-1570

Nakayama, K. (1993) J. Biochern. 113,132-135

G . 11993) Proc. Nntl. A c d . Sci. IJ . S. A. BO. 6691-6fi9.5 ~ ~ ~ . . , ~ ..~. ." - . .~ . . , . . . - . . . . 26. Bresnahan, P. A,, Leduc, R., Thomas, L., Thorner, J., Gibson, H. L., Brake,

27. KlimDel. K. R.. Mollov. S. S.. Thomas, G., and Lemla. S. H. (1992) Proc. A. J., Barr, P. J., and Thomas, G. (1990) J. Cell Biol. 1 1 1,2851-2859

28. Stieneke-Grober, A,, Vey, M., An liker, H., Shaw, E., Thomas, G., Roberts, Natl. Acad. Sci. U. $'A. SO, 10277-10281 " .

29. Hallenbereer. S.. Aneliker. H.. Shaw. E.. Klenk. H. D.. and Garten. W. C., Klenk, H. D., and Garten, 6. (1992) EMEO J. 11 , 2407-2414

30.

31.

32.

33. 34.

35. 36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

(1992) fiature'360; 3581361

Chem. 267,14304-14308

Sci. U. S. A. 89,8235-8239

U. S. A. 88,6834-6838

, ,

Leduc, R., Molloy, S. S., Thorne, B. A., and Thomas, G. (1992) J. Biol.

Rehemtulla, A., Dorner, A. J., and Kaufman, R. J. (1992) Proc. Natl. Acad.

Korner, J., Chun, J., Harter, D., and Axel, R. (1991) Proc. Natl. Acad. Sci.

Rehemtulla, A., and Kaufman, R. J. (1992) Blood 79,2349-2355 Siezen, R. J., De Vos, W. M., Leunissen, J. A. M., and Dijkstra, B. W.

Wells, J. A,, and Estell, D. A. (1988) Trends Biol. Sei. 13 , 291-297 Siezen, R. J. (1993) in Subtilisin Enzymes (Bott, R., and Betzel, C., eds)

Van den Ouweland, A. M. I$., Van Dui'nhoven, J. L. P., Keizer, G. D., Plenum Publishing Co., in ress

Dorssers, L. C. J.. and Van de Ven, d. J. M. (1990) Nucleic Acids Res.

(1991) Protein Eng. 4 , 719-737

Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. 18 ,664

(1989) Gene (Amst.) 77,51-59 Ma nen P. Devriendt K. Van den Berghe, H., and Cassiman, J. J. (1990)

F%BS tt't. 262,349"35'2 Verwel C. L. Dlergaarde, P. J., Hart, M., and Pannekoek, H. (1986)

EMbO J. 6,'1839-1847 Roebroek, A. J. M., Creemers, J. W. M., Pauli, I. G. L., Bogaert, T., and

Van de Ven, W. J. M. (1993) EMBO J. 12 , 1853-1870 Van Duijnhoven, J. L. P., Creemers, J. W. M., Kranenbor M. G. C.,

broek, A. J. M., and Van de Ven, W. J. M. (1992) H bridorna 11 , 71-86 Timmer, E. D. J., Groeneveld, A,, Van den Ouweland, A. k'. M., Roe-

Feurst, T. O., Niles, E. G., Studier, F. W., and Moss, 8. (1986) Proc. Natl.

Andreasson, K. I., Tan, W. W. H., Feurst, T. O., Moss, B., and Loh, Y. P.

Vos, P., Boerrigter, I. J., Buist, G., Haandrikman, A. J., Nijhuis, M., De (1989) FEBS Lett. 248,43-47

Reuver, M. B., Siezen, R. J., Venema, G., De Vos, W. M., and Kok, J. (1991) Protein Eng. 4, 479-484

Bryan, P., Pantoliano, M. W., Quill, S. G., Hsiao, H.-Y., and Poulos, T. (1986) Proc. Natl. Acad. Sci. U. S. A. 83,3743-3745

Hatsuzawa, K., Murakami, K., and Nakayama, K. (1992) J. Biochern. 1 1 1 ,

Acad. S C ~ . U. S. A. 83,8122-8126

296-301 Evnin. L. B., Vasquez, R., and Craik, C. S. (1990) Proc. Natl. Acad. Sei.

Estell, D. A,, Graycar, T. P., Miller, J: V., Powers, D. B., Burnier, J. P.,

Wells, J. A. Powers D. B. Bott, R. R., Graycar T. P., and Estell, D. A.

Wells, J. A,, Cunningham, B. C., Graycar, T. P., and Estell, D. A. (1987)

Schechter, I., and Berger, A. (1967) Biochem. Biophys. Res. Cornmun. 2 7 ,

U. S. A. 87,6659-6663

Ng, P. G., and Wells, J. A. (1986) ScLence 233,659-663

(1987) P,oc. Natl. head. h i . U. S. A. 84.1219-1223

Proc. Natl. Acad. Sa. U. S. A. 8 4 , 5167-5171

53. Voorber , J., Fontijn, R., Van Mourik, J. A., and Pannekoek, H. J. (1990) 157-162

EMBd J. 9 , 797-803

modulation of furin-mediated proprotein processing activity by

Documents