molecular basis for variable expression of merozoite ...iai.asm.org/content/69/6/3782.full.pdf ·...

INFECTION AND IMMUNITY,0019-9567/01/$04.0010 DOI: 10.1128/IAI.69.6.3782–3790.2001

June 2001, p. 3782–3790 Vol. 69, No. 6

Copyright © 2001, American Society for Microbiology. All Rights Reserved.

Molecular Basis for Variable Expression of Merozoite SurfaceAntigen gp45 among American Isolates of Babesia bigemina

TINA G. FISHER,* TERRY F. MCELWAIN, AND GUY H. PALMER

Program in Vector-Borne Diseases, Department of Veterinary Microbiology and Pathology,Washington State University, Pullman, Washington 99164-7040

Received 20 October 2000/Returned for modification 25 November 2000/Accepted 8 March 2001

Immunization with the merozoite surface glycoprotein gp45 induces protection against challenge using thehomologous Babesia bigemina strain. However, gp45 B-cell epitopes are highly polymorphic among B. bigeminastrains isolated from different geographical locations within North and South America. The molecular basis forthis polymorphism was investigated using the JG-29 biological clone of a Mexico strain of B. bigemina and com-parison with the Puerto Rico, St. Croix, and Texcoco strains. The molecular size and antibody reactivity of gp45expressed by the JG-29 clone were identical to those of the parental Mexico strain. gp45 cDNA and the genomiclocus encompassing gp45 were cloned and sequenced from JG-29. The locus sequence and Southern blot datawere consistent with a single gp45 copy in the JG-29 genome. The JG-29 cDNA expressed the full-length proteinrecognized by the gp45-specific monoclonal antibody 14/1.3.2. The genomes of the Puerto Rico and St. Croix strainsof B. bigemina were shown to lack a closely related gp45-like gene by PCR using multiple primer sets and bySouthern blots using both full-length and region-specific gp45 probes. This genomic difference was confirmedusing unpassaged isolates from a 1999 disease outbreak in Puerto Rico. In contrast, the Texcoco strain retainsa gp45 gene, encoding an open reading frame identical to that of JG-29. However, the Texcoco gp45 gene is nottranscribed. These two mechanisms, lack of a closely related gp45-like gene and failure to transcribe gp45, re-sult in generation of antigenic polymorphism among B. bigemina strains, and the latter mechanism is uniquecompared to prior mechanisms of antigenic polymorphism identified in babesial parasites.

Babesiosis is a leading cause of morbidity and mortalityamong cattle throughout regions where vector ticks are en-demic (1, 7). Recovery from natural infection confers protec-tive immunity against subsequent challenge. However, mortal-ity rates of up to 80% can occur when susceptible adult cattleare imported into areas of endemic babesiosis (1, 10, 15).While attenuated live vaccines afford significant decreases inmortality, their use does not prevent infection, nor does ituniformly confer protection against disease (3, 7, 16, 17, 26,28). Importantly, the use of these blood-derived live vaccineshas been limited by the risk of transmitting contaminatingknown or unknown pathogens. The development of a saferkilled vaccine has focused on babesial antigens that play vitalroles in the parasite’s invasion of host cells (4, 26).

Babesia-infected ticks inject saliva containing sporozoitesinto the host bloodstream during feeding. Initial invasion ofhost cells is followed by sequential rounds of intracellular asex-ual replication, merozoite development, release, and new in-vasion (4, 31). With Babesia bigemina and B. bovis, the mostprevalent and severe causes of babesiosis in cattle, invasionand multiplication are limited to mature erythrocytes. Al-though the mechanism of erythrocyte invasion by these twoparasites is still incompletely understood, initial attachmenthas been postulated to involve the merozoite outer membraneglycoproteins MSA-1 and MSA-2 of B. bovis and gp45 andgp55 of B. bigemina (11, 14, 26). Antibody against B. bovisMSA-1 significantly reduces parasitemia in vitro, consistent

with the postulated role of MSA-1 in erythrocyte invasion (11).Notably however, MSA-1 and the coexpressed MSA-2 are notantigenically conserved among B. bovis strains isolated frombabesiosis-endemic regions worldwide (11, 27, 34).

Recently, the msa-1 genes of several B. bovis strains from theAmericas have been identified and characterized (34). MSA-1antigenic diversity among strains is attributed to genomic poly-morphism of a single msa-1 gene, resulting in amino acid sub-stitutions, insertions, and deletions with identity varying from52 to 98% between individual strains (34). In contrast, B. bovisMSA-2 is encoded by tandemly arranged genes within thevariable merozoite surface antigen family (vmsa) (5, 14, 27, 30;C. E. Suarez, M. Florin-Christensen, G. H. Palmer, and T. F.McElwain, unpublished data). The presence of multiple genesmay confer on B. bovis the capacity to alter msa-2 expressionthrough genetic recombination within a strain.

In contrast to the well-characterized vmsa family in B. bovis,the genes encoding B. bigemina membrane glycoproteins gp45and gp55 have not been identified, and the molecular basis oftheir antigenic diversity among strains remains unexplained.Immunization with affinity-purified native gp45 from the Mex-ico strain induces protection against homologous challenge,defined as a significant decrease in peak parasitemia comparedto adjuvant-inoculated control cattle (21). However gp45, likeB. bovis MSA-1, is antigenically polymorphic among strains(21, 27). Sera from Mexico strain gp45-immunized cattle andmonoclonal antibody against native Mexico gp45 bind mero-zoites of the homologous Mexico strain (19–21, 35). In con-trast, there is no antibody binding to other strains of B. bigem-ina isolated from Brazil, Puerto Rico, St. Croix (U.S. VirginIslands), and Texcoco (Mexico) (19, 21). This complete lack ofreactivity using monospecific polyclonal sera from immunized

* Corresponding author. Mailing address: Department of Veteri-nary Microbiology and Pathology, Washington State University, P.O.Box 647040, Pullman, WA 99164-7040. Phone: (509) 335-7259. Fax:(509) 335-8529. E-mail: [email protected].

3782

on June 23, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

and protected cattle indicates that marked B-cell epitope vari-ation among strains would limit the efficacy of a gp45-basedvaccine (4, 6, 24). Whether this antigenic variation reflectspolymorphism in a single gp45 gene, analogous to B. bovismsa-1, or the presence of a variably expressed multigene fam-ily, similar to B. bovis msa-2, is unknown. In this article, wereport the identification of a molecular basis for gp45 antigenicpolymorphism among B. bigemina strains isolated from theAmericas.

MATERIALS AND METHODS

B. bigemina. The Mexico strain was provided by Will Goff (USDA AnimalDisease Research Unit, Pullman, Wash.) and propagated by in vitro cultivationin bovine erythrocytes. The JG-29 biological clone of the Mexico strain wasobtained by limiting dilution, as previously described (36, 37). The Puerto Rico,St. Croix, Argentina S1A, and Texcoco strains were isolated from infected cattlein their respective locations (9) and provided as cyropreserved stabilates (37) byGerald Buening (University of Missouri, Columbia, Mo.) and Ignacio Echaide(Instituto Nacional de Tecnologı́a Agropecuaria, Rafaela, Argentina). An addi-tional six B. bigemina isolates were obtained from acute cases of babesiosis inPuerto Rico that occurred in 1999 and were provided by David Jimenez (May-aguez, P.R.). All six isolates were analyzed directly without prior cryopreserva-tion, in vitro culture, or in vivo passage.

Antibodies. Anti-B. bigemina monoclonal antibodies (MAbs) were producedby immunizing mice with Mexico strain merozoites (20). The selection andcharacterization of these MAbs have been reported in detail previously (20). TheMAbs used in this study were 14/1.3.2, which binds the 45-kDa merozoite surfaceglycoprotein gp45, and 14/16.1.7, which binds the 58-kDa rhoptry-associatedprotein 1 (RAP-1). Monospecific polyclonal antisera were obtained followingimmunization of cattle and rabbits with purified gp45 or RAP-1. Rabbits wereimmunized subcutaneously with 25 mg of native gp45 or RAP-1 in Freund’scomplete adjuvant and boosted with 15 mg of antigen in incomplete Freund’sadjuvant at 1- to 2-week intervals. Calf B261 was immunized intramuscularly with50 mg of native gp45 in Freund’s complete adjuvant, followed by four intramus-cular immunizations with 50 mg of native gp45 in incomplete Freund’s adjuvantat 2-week intervals. Calf B279 was immunized following the same regimen butwith native RAP-1. Sera from a nonimmunized rabbit and from an uninfected,nonimmunized calf (B235) were used as additional negative controls.

Cloning and sequencing of Mexico strain gp45 cDNA. The gp45 transcript wasinitially identified by expression screening of a B. bigemina cDNA library inlambda phage ZAP. Merozoites were isolated from an expansion culture of thebiological clone JG-29 using a 70% Percoll gradient centrifuged at 30,000 3 g(22, 23). mRNA was extracted from these merozoites by lysis in a concentratedguanidinium thiocyanate solution, followed by dilution and binding to an oli-go(dT) column. Isolated mRNA was reverse transcribed using a linker-poly(dT)primer according to the manufacturer’s instructions (Stratagene). Followingblunting and the ligation of EcoRI adapters, the resulting cDNA was cloned intolambda ZAP Express vector. Gigapack II Gold was used to package the cDNAlibrary and transfect Escherichia coli XL1 Blue MRF9 in the presence of 3 mMisopropylthio-b-galactoside and 5 mg of 5-bromo-4-chloro-3-indolyl-b-D-galac-toside per ml. Plaque lifts from XL1 Blue-transfected E. coli were immunolog-ically screened using rabbit anti-gp45 serum (R929) at a dilution of 1:10,000,followed by horseradish peroxidase—conjugated caprine anti-rabbit immuno-globulin G (IgG; heavy and light chains; (Kirkegaard & Perry; 1:2,500 dilution)and enhanced chemiluminescence (ECL) detection (Amersham Pharmacia Bio-tech). Positive plaques were selected and purified by repeated expansion, plating,and immunological screening. Following phagemid excision, six positive cloneswere identified, and two were fully sequenced. These sequences were analyzed,assembled, and translated with the Genetics Computer Group (GCG) version 10Bestfit, Assemble, and Translate programs, respectively (8). Nonredundant Gen-Bank, EMBL, DDBJ, and PDB databases were searched for homologous nucleo-tide sequences using the BlastN 2.0.10 search engine at www.ncbi.nlm.nih.gov(2). Alignments of multiple sequences were done using PileUp and Gap of GCGversion 10 and ClustalW program of the Baylor College of Medicine SearchLauncher at www.hgsc.bcm.tmc.edu. The Swissprot program from GCG wasused to search sequence databases for homologous amino acid sequences. Po-tential modification sites within the gp45 protein were located using the Find-Pattern and Prosite programs from GCG.

Binding of recombinant gp45 by anti-native gp45 monoclonal and polyclonalantibodies. Recombinant gp45 protein expressed from XL1 Blue E. coli trans-

formed with gp45 cDNA clone 4.2.2.1.1.1 was tested for specific binding bymonoclonal and polyclonal anti-native gp45 antibodies. XL1 Blue E. coli trans-formed with clone 4.2.2.1.1.1 was grown at 37°C in the presence of 1 mMisopropylthio-b-galactoside for 4 h and then pelleted and lysed as previouslydescribed (32). Equivalent amounts of protein from 4.2.2.1.1.1 bacterial lysatesupernatant, bacterial lysate supernatant from E. coli transformed with a controlplasmid, JG-29 merozoite lysate, and uninfected erythrocyte lysate were electro-phoretically separated on a 4 to 20% polyacrylamide gel and transblotted tonitrocellulose membranes. Membranes were blocked overnight and then incu-bated for 1 h with 1:500 dilutions of either anti-gp45 monospecific bovine serum(B261) or negative-control calf serum (B235). For MAb binding, membraneswere blocked for 30 min, followed by overnight incubation with either MAb14/1.3.2 or MAb Tryp1E1 (anti-Trypanosoma brucei variable surface glycopro-tein) at a final concentration of 2 mg of IgG per ml. For rabbit antibody binding,membranes were blocked for 30 min, followed by overnight incubation with1:5,000 dilutions of either anti-gp45 monospecific rabbit serum (R929) or non-immunized rabbit serum. Membranes were then washed, and antibody bindingwas detected by horseradish peroxidase-conjugated recombinant protein G(Zymed; 1:5,000 dilution), caprine anti-murine IgG (Kirkegaard & Perry; 4mg/ml), or caprine anti-rabbit IgG (Kirkegaard & Perry; 1:2,500 dilution), fol-lowed by ECL detection.

Cloning and sequencing the gp45 genomic locus. Genomic DNA was isolatedfrom B. bigemina JG-29 merozoites via standard phenol-chloroform extractionmethods (32). Isolated DNA was digested with EcoRI, separated on a 0.8%agarose gel, and transblotted to a nylon membrane. For probe construction,4.2.2.1.1.1 plasmid insert DNA was amplified using primers TGF1.0 andTGF4.1.5 and labeled with digoxigenin according to the manufacturer’s instruc-tions (Boehringer Mannheim) with melting, annealing, and extension tempera-tures of 96, 60, and 72°C, respectively. The resulting 718-bp gp45-specific probewas then hybridized with the membrane overnight at 50°C. The membrane wasthen washed with 23 SSC (13 SSC is 0.15 M NaCl plus 0.015 M sodiumcitrate)–0.1% sodium dodecyl sulfate (SDS) at room temperature, followed by anadditional higher-stringency wash of 0.53 SSC–0.1% SDS at 65°C. Probe bindingwas immunologically detected using a 1:10,000 dilution of antidigoxigenin alka-line phosphatase-labeled Fab fragments (Boehringer Mannheim) followed byECL detection. Isolated plasmid DNA from the gp45 cDNA clone was used as apositive control for probe binding. A single band of approximately 6.5 kb wasdetected in the EcoRI-digested genomic DNA.

Genomic DNA was then digested to completion with EcoRI, and the 6- to7.5-kb fragments were purified and cloned into the Lambda ZAP Express vector.The packaged library was used to transfect XL1 Blue MRF strain E. coli. Plaquelifts onto Hybond N1 nylon membranes (Amersham) were made from trans-fected E. coli and screened by hybridization using the 718-bp gp45-specific probeas described above. Positive plaques were purified, and phagemids were excised.Two independent positive clones were identified and sequenced in both direc-tions.

Southern blot analysis of gp45 in Mexico strain genomic DNA. Genomic DNAisolated from B. bigemina JG-29 merozoites was digested with restriction en-zymes selected based on the gp45 cDNA and genomic locus sequences andpredicted to cleave either within or outside the gp45 gene. In each Southern blot,genomic DNA digested with an enzyme predicted to cut outside the gp45 genewas compared to DNA digested with an enzyme predicted to cut within gp45 andwith DNA doubly digested with both types of enzymes. The resulting digestedfragments of genomic DNA were separated on a 0.8% agarose gel and trans-blotted to a nylon membrane. Membranes were then hybridized overnight at50°C with the 718-bp gp45-specific probe described above or a full-length gp45-specific probe made in the same manner but using primers TGF1.0 and TGF10R.Membranes were then washed, and probe binding was immunologically detectedas described above. Isolated plasmid DNA from the gp45 cDNA clone was usedas a positive control for probe binding.

Expression of gp45 by B. bigemina strains. Merozoites were collected fromB. bigemina cryopreserved stabilates of Mexico, Puerto Rico, St. Croix, Argen-tina S1A, and Texcoco strains and the JG-29 clone by centrifugation at 43,700 3g. Merozoite lysates were electrophoretically separated on a 4 to 20% polyacryl-amide gel, transblotted to nitrocellulose membranes, and incubated with mono-specific bovine serum diluted 1:500 or with MAbs at a final concentration of 2 mgof IgG/ml. Bound antibody was detected as described above. The six 1999B. bigemina isolates from Puerto Rico were tested for expression of gp45 andRAP-1 using MAbs 14/1.3.2 and 14/16.1.7 in an immunofluorescence assay (27).MAb Tryp1E1 was used as a negative control.

Detection of gp45 genes in additional strains. Genomic DNA from each strain(Mexico, Puerto Rico, St. Croix, and Texcoco) and the six Puerto Rico 1999isolates was analyzed in a PCR using gp45-specific primers. Four primer sets were

VOL. 69, 2001 BABESIA BIGEMINA STRAIN VARIATION 3783


.org/D

ownloaded from

http://iai.asm.org/

tested: TGF5.0 and TGF10R, TGF1.0 and TGF4.1.5, TGF1.0 and TGF4.3.5, andTGF1.3 and TGF4.1. Amplifications were performed using 30 cycles with melt-ing, annealing, and extension temperatures of 96, 60, and 72°C, respectively.Plasmid DNA from the full-length gp45 cDNA clone served as a positive control.The rap-1 primers B483Fx and B822R, which amplify a 339-bp fragment (12, 13),were used as a positive control for DNA quality of each strain.

For Southern blot detection of gp45-related genes, EcoRI-digested DNA wasseparated on a 0.8% agarose gel and transblotted to nylon membranes. Mem-branes were hybridized with the 718-bp gp45-specific probe overnight at 50°C andthen washed twice with 23 SSC–0.1% SDS at room temperature for 5 min,followed by two 15-min washes with 0.53SSC–0.1% SDS at 65°C. Membraneswith DNA from the six Puerto Rico isolates from the 1999 outbreak were alsoincubated with three additional probes spanning the gp45 cDNA sequence:nucleotides (nt) 6 to 257, nt 287 to 630, and nt 827 to 1037. Probe binding wasimmunologically detected using a 1:10,000 dilution of antidigoxigenin alkalinephosphatase-labeled Fab fragments, followed by ECL detection. Isolated plas-mid DNA from the gp45 cDNA clone was used as a positive control for probebinding. To control for the quality of the DNA from each strain and isolate, a339-bp digoxigenin-labeled rap-1-specific probe, generated using primers B483Fxand B822R (12, 13), was tested under identical hybridization conditions.

Cloning and sequencing of Texcoco gp45 gene. Primers TGF5.0 and TGF10R,derived from the cDNA sequence of JG-29 gp45, were used to amplify a 1,098-bpsegment of the gp45 gene from Texcoco genomic DNA. The amplified productwas ligated into pCR-2.1 vector and used to transform INV-F9 bacteria. Recom-binant clones were selected, the presence of a gp45 insert was confirmed by PCRwith primers TGF 1.0 and TGF4.1.5, and the insert DNA was sequenced. Inorder to amplify the genomic sequence upstream of the Texcoco gp45 openreading frame (ORF), specific primers were derived from the sequence of the6.5-kb fragment in the JG-29 clone genomic DNA. These primers, TGF20 andTGF7.0, were used to amplify a 151-bp product from the Texcoco DNA. Theamplicon was ligated into pCR-Blunt and used to transform One Shot TOP 10ultracompetent bacteria (Invitrogen). Recombinant clones were selected, diges-tion with EcoRI was performed to confirm the presence and size of the insert,and insert DNA was sequenced in both directions.

Detection of gp45 transcription. Transcription was examined in merozoitescontaining a gp45 gene, the JG-29 clone of the Mexico strain and the Texcocostrain. Total RNA was isolated from washed merozoites with the RNAqueoustotal RNA kit (Ambion). Two DNase I treatments of total RNA were performedusing 5 U of DNase I per mg of RNA, with incubation for 30 min at 37°C, andwere followed by a third incubation using 2 U of DNase I per mg of RNA at 37°Cfor 60 min. Reverse transcription (RT) was performed using an oligo(dT20)primer and the ThermoScript RT-PCR System (Gibco-BRL). The resultingcDNA was amplified using primers TGF1.0 and TGF4.3.5. As a control for RNAand cDNA quality and amplification conditions, rap-1 was amplified from thecDNA with the B483Fx and B822R primers under the same conditions used forthe gp45 amplifications. Identical amplifications but without reverse transcriptasetreatment were done to control for contaminating DNA.

Nucleotide sequence accession numbers. Genbank accession nos. AF298630 toAF298632 were assigned to our sequences.

RESULTS

Cloning and sequencing of Mexico strain gp45. Screening ofa cDNA Lambda ZAP expression library of JG-29 B. bigemina

with rabbit anti-gp45 monospecific polyclonal serum (R929)led to the identification of four independent gp45-containingclones. The clones each contained a $1.5-kb insert, identifiedby restriction enzyme digestion of immunoreactive clones, andwere sequenced in their entirety in both directions. Clone4.2.2.1.1.1 contained a 1.5-kb cDNA insert composed of 40 bppreceding a 1,058-bp ORF, 110 bp beyond the stop codon, anda poly(A) tail (GenBank accession no. AF298630). The ORFtranslated into a 351-amino-acid polypeptide. The encodedpolypeptide initiated with a double methionine and containeda predicted leader sequence followed by an extracytoplasmicdomain (Fig. 1). The amino-terminal hydrophobic domaincontains a leader sequence with a predicted cleavage site be-tween amino acids 21 and 22 (25), while the carboxy-terminaldomain sequence contains a signal for addition of a glyco-sylphosphatidylinositol anchor near amino acid 322 (P 5 0.04;ExPASy Molecular Biology Server [expasy.cbr.nrc.ca/programDGPI]).

Immunologic reactivity of recombinant gp45. Proteins with-in the 4.2.2.1.1.1 bacterial lysate were specifically bound bybovine and rabbit monospecific gp45 polyclonal antisera (B216and R929) and not by negative control sera (data not shown).Anti-gp45 MAb 14/1.3.2 bound to a single band in each of the4.2.2.1.1.1 and the JG-29 merozoite lysates (Fig. 2). There wasno binding using the control MAb Tryp1E1. The recombinantgp45 protein recognized within the 4.2.2.1.1.1 bacterial lysatehad an apparent molecular size 3 kDa smaller than that ofnative gp45 detected within the JG-29 merozoite lysate (Fig.2), consistent with the lack of posttranslational modification inE. coli.

Genomic organization of gp45 locus. An unamplified geno-mic library prepared from EcoRI-digested JG-29 DNA wasscreened using a gp45-specific 718-bp probe derived from thecDNA clone, and two independent positive clones were iden-tified. The 6.5-kb cloned inserts were sequenced entirely inboth directions and found to be identical. The complete locussequence has been given accession number AF298631. Thegp45 ORF contained within the genomic gp45 clone was iden-tical to that identified in the cDNA clone 4.2.2.1.1.1. Therewere no homologous gp45 or gp45-like genes within the 1,422bp upstream or the 3,980 bp downstream of gp45. Three addi-tional ORFs with start and stop codons and encoding apolypeptide of $100 amino acids were identified within the6.5-kb genomic fragment. Four other motifs begin with a startcodon and end with a stop codon but encode fewer than 100amino acids. None of the complete or partial ORFs had anamino acid sequence similar to that of gp45. A Blast search didnot reveal significant similarity of these additional ORFs to anyother genes in the database.

Southern blots were performed on restriction enzyme-di-gested genomic DNA isolated from biologically cloned JG-29merozoites. The 718-bp gp45-specific probe hybridized with asingle band of approximately 6.5 kb in EcoRI-digested DNA(data not shown) and a single band of approximately 7.3 kbin XbaI-digested DNA (Fig. 3). Neither EcoRI nor XbaI cutswithin gp45 cDNA. The 718-bp probe hybridized with twobands of approximately 12 and 2.8 kb in BamHI-digested DNA(data not shown) and two bands of approximately 4.4 and 2.9kb in NdeI-digested DNA (Fig. 3). Both BamHI and NdeI cutonce within the gp45 cDNA sequence. Double digestion with

TABLE 1. PCR primers used to amplify gp45 sequences

Primer Sequence (59 to 39) Positiona Orientation

TGF1.0 CTCGCTACGTTTTCTATCGC 6/25 SenseTGF1.3 CAGATGCTGTTAAACTGCCG 750/769 SenseTGF4.1 AGATGCCTTCTTCGGTGATG 997/977 AntisenseTGF4.1.5 TGCTTTCGTCAAGAGTACTC 724/705 AntisenseTGF4.3.5 GTGCCATAGACTTCAAGAGACC 407/385 AntisenseTGF5.0 AGGATGATGCTCGCTACGTT 23/17 SenseTGF7.0 GCGATAGAAAACGTAGCGAG 26/7 AntisenseTGF10R AGTTGATCGCGTGTCACCTGAT 1095/1074 AntisenseTGF20 GCGTAGTCTGTTGCACCTG 2125/2107 Sense

a Position is from the gp45 cDNA shown in Fig. 1, with the first base designated11 (accession no. AF298630). Sequences upstream of 11 are designated with anegative number and are derived from the gp45 genomic locus sequence (acces-sion no. AF298631).

3784 FISHER ET AL. INFECT. IMMUN.


.org/D

ownloaded from

http://iai.asm.org/

EcoRI and BamHI resulted in two bands of approximately 4.9and 1.5 kb (data not shown), EcoRI and NdeI digestion re-sulted in bands of approximately 5.5 and 2 kb (data not shown),and digestion using XbaI and NdeI resulted in bands of ap-proximately 4.4 and 2.9 kb (Fig. 3). DNA digested with EcoRI,BamHI, or EcoRI and BamHI was also hybridized with afull-length gp45 probe in an attempt to identify sequenceshomologous to the 39 end of gp45 that were not represented inthe 718-bp probe. However, the banding pattern was the sameusing the full-length gp45 probe as when the 718-bp probe wasused (Fig. 3). The restriction enzyme digestion patterns ofJG-29 genomic DNA were consistent with the presence of a

single-copy gene, as previously reported for the B. bovis msa-1locus (11).

Polymorphism in expression of gp45 among B. bigeminastrains. Western blot analysis of merozoites from Americanstrains of B. bigemina demonstrated strain-specific expressionof gp45 B-cell epitopes. Both murine MAbs and bovine mono-specific polyclonal serum to native Mexico strain gp45 boundonly merozoites of the homologous strain and the biologicalclone JG-29, derived from the parent Mexico strain (Fig. 4).These antibodies did not bind to merozoite lysates of the otherAmerican strains examined here (Argentina S1A, Puerto Rico,St. Croix, and Texcoco), while monospecific polyclonal serum

FIG. 1. Mexico strain JG-29 gp45 cDNA and amino acid sequence. Nucleotide sequence of clone 4.2.2.1.1.1 and translated ORF. Theunderlined amino acids designate the mature protein following predicted amino- and carboxy-terminal processing. Base numbers along the leftmargin refer to nucleotide position.



.org/D

ownloaded from

http://iai.asm.org/

to RAP-1 bound all strains (Fig. 4). The two RAP-1 proteinsdetected represent the products of the polymorphic rap-1 al-leles in each strain (12, 13). These findings replicate previousresults using the Mexico, Puerto Rico, St. Croix, and Texcocostrains (20, 21) and demonstrate the binding to the JG-29clone. In addition to these strains, six uncloned isolates from a1999 babesiosis outbreak in Puerto Rico were examined forRAP-1 and gp45 expression by immunofluorescence assay onacetone-fixed blood smears. All six isolates were bound byMAb 14/16.1.7 (anti-RAP-1), while MAb 14/1.3.2 (anti-gp45)failed to bind any of the isolates. As a positive control, MAbs14/16.1.7 and 14.1.3.2 bound the Mexico strain. Neither MAbbound uninfected erythrocytes, and a negative control MAb,Tryp1E1, did not bind to any of the blood smears.

Detection of gp45 genes in additional strains. Amplicons ofthe predicted size, 1,098 bp, were obtained when genomicDNA isolated from the parental Mexico strain, the JG-29Mexico strain clone, and the Texcoco strain was amplified withgp45-specific primer pair TGF5.0 and TGF10R (Fig. 5). Noamplicons were obtained from Puerto Rico or St. Croix geno-mic DNA using the same primers and identical amplificationconditions (Fig. 5). Amplification using three additional primersets, TGF1.0/TGF4.1.5, TGF1.0/TGF4.3.5, and TGF1.3/TGF4.1,resulted in the same pattern, detection in the Mexico and Texcocostrains and the JG-29 clone but not in the Puerto Rico or St.Croix strains (data not shown). Simultaneous amplification ofeach genomic DNA sample with rap-1-specific primers gener-

ated a 339-bp amplicon, confirming the presence of intact B. bi-gemina genomic DNA (Fig. 5).

Southern blot analysis using the 718-bp probe derived fromthe JG-29 gp45 cDNA clone (nt 6 to 724) confirmed the pres-

FIG. 2. Recognition of recombinant gp45 by MAb. Lysates fromE. coli transfected with plasmid 4.2.2.1.1.1, E. coli transfected withplasmid lacking an insert, B. bigemina-infected bovine erythrocytes(RBCs), and uninfected bovine erythrocytes were electrophoresed ona polyacrylamide gel, transferred to nitrocellulose, and reacted withanti-gp45 MAb 14/1.3.2. There was no reactivity using the negativecontrol MAb Tryp1E1 (data not shown). Molecular sizes are indicatedin the left margin.

FIG. 3. Southern blot analysis of gp45. Genomic DNA was isolatedfrom JG-29 strain B. bigemina, digested with restriction enzymes, electro-phoretically separated on a 0.8% agarose gel, and transblotted to nylonmembranes. The selected restriction enzymes were expected to predictedto cleave outside of (p) or within (1) the gp45 ORF. EcoRI, EcoRI-BamHI, and BamHI digests were hybridized with the full-length gp45digoxigenin-labeled probe, while XbaI, XbaI-NdeI, and NdeI digests werehybridized with a 718-bp digoxigenin-labeled gp45 probe. (A) Southernblots exposed for 8 min. (B) Two-hour exposure of the EcoRI-BamHI andBamHI lanes of panel A.

FIG. 4. Strain-specific expression of gp45. Equal amounts of proteinfrom infected erythrocytes (RBCs) of each strain or from uninfectederythrocytes were electrophoresed on a polyacrylamide gel, transferred tonitrocellulose, and reacted with antibodies in Western blots. The mem-branes were reacted with 1:500 dilutions of anti-gp45 (A) or anti-RAP-1(B) monospecific bovine serum or with 2 mg of anti-gp45 MAb 14/1.3.2(C) or anti-RAP-1 MAb 14/16.1.7 (D) per ml. Molecular sizes are indi-cated in the right margin, and the locations of gp45 and RAP-1 areindicated in the left margin.



.org/D

ownloaded from

http://iai.asm.org/

ence of gp45-related genes within the Mexico and Texcocostrains of B. bigemina (Fig. 6A). No gp45-related sequenceswere detected within genomic DNA from the Puerto Rico orSt. Croix strains of B. bigemina (Fig. 6A). Three additionalprobes derived from the JG-29 cDNA gp45 sequence (251-bpprobe spanning nt 6 to 257, 343-bp probe spanning nt 287 to630, and 210-bp probe spanning nt 827 to 1037) were used toscreen additional Southern blots of the uncloned Puerto Ricoisolates. No gp45-related gene sequences were detected (Fig.6B). The presence of intact genomic DNA in each Southernblot was confirmed by the binding of a 339-bp rap-1-specificprobe to the multiple rap-1 genes of each sample. The vari-able number and arrangement of polymorphic rap-1 genesamong strains have been described previously in detail (12,13).

Cloning and sequencing of Texcoco gp45 gene. A 1,098-bpamplicon was generated from Texcoco genomic DNA usinggp45-specific primers derived from the cDNA sequence ofJG-29 gp45. The 59 TGF5.0 primer incorporated the startcodon of the ORF, and the 39 TGF10R primer was derivedfrom downstream of the stop codon. This amplicon was clonedand sequenced entirely in both directions. The cloned se-quence was identical to the cDNA sequence of JG-29 extend-ing through the entire ORF to the stop codon. Additionalprimers flanking the start codon (TGF7.0) and upstream of thegp45 orf (TGF20) were used to amplify the 111 bp upstream ofand including the start codon of the Texcoco genomic gp45sequence. The full-length gp45 ORF and upstream sequencesin the Texcoco strain have been given GenBank accession no.AF298632. While the gp45 start codon is conserved within the

Texcoco strain, 14 mutations were observed within the up-stream sequence.

Detection of gp45 transcription. Transcripts of gp45 weredetected within mRNA from JG-29 but not from the Texcocostrain (Fig. 7A). The sequence of the JG-29 amplicon was

FIG. 5. PCR-based detection of gp45 genes in American strains ofB. bigemina. DNA was amplified using gp45- or rap-1-specific primersunder identical reaction conditions, electrophoretically separated on a6% polyacrylamide gel, and visualized by ethidium bromide staining.The gp45 cDNA clone 4.2.2.1.1.1 was used as a positive control. Mo-lecular size standards are shown in the left margin, and the predictedsizes of the gp45 amplicons (1,098 bp) and rap-1 amplicons (336 bp) areshown in the right margin.

FIG. 6. (A) Southern blot detection of gp45 genes in Americanstrains of B. bigemina. Equal amounts of genomic DNA from each ofthe B. bigemina strains were digested with EcoRI, separated on a 0.8%agarose gel, and transblotted to nylon membranes. Membranes werehybridized with a digoxigenin-labeled 718-bp gp45 probe derived fromJG-29. Left panel: Puerto Rico and St. Croix strains. Right panel:Texcoco and Mexico strains. Molecular size markers are indicated inthe right margin. Distinct bands were observed in all strains usingreplicate blots which were hybridized with a rap-1 probe under iden-tical conditions (data not shown). (B) Southern blot detection of gp45in isolates from the 1999 Puerto Rico outbreak. Equal amounts ofDNA were digested with EcoRI, electrophoretically separated on a0.8% agarose gel, and transblotted to nylon. Membranes were hybrid-ized with each of the following three probes derived from the JG-29strain gp45: nt 6 to 257, nt 287 to 630, and nt 827 to 1037. Replicatemembranes were hybridized with a rap-1 probe. Puerto Rico 3 isisolate number 3 from the 1999 outbreak. Molecular size standards areindicated in the right margin. The left panel represents hybridizationwith the 210-bp gp45 probe spanning nt 827 to 1037. The right panelrepresents hybridization with a 336-bp rap-1 probe.



.org/D

ownloaded from

http://iai.asm.org/

identical to the corresponding sequence previously identifiedin both the JG-29 cDNA and genomic DNA. Amplification ofrap-1 transcripts from both strains confirmed the integrity ofthe RNA and cDNA tested (Fig. 7A). Both gp45 and rap-1could be amplified simultaneously from JG-29 reverse-tran-scribed mRNA, but only rap-1 could be amplified from Tex-coco reverse-transcribed mRNA (Fig. 7B). In contrast, bothgp45 and rap-1 could be amplified simultaneously from DNAof either strain (Fig. 7B). The possibility that Texcoco RNAwas specifically inhibitory for gp45 transcript amplification wasexcluded by showing that rap-1 and gp45 could be amplifiedfrom cDNA generated using equal amounts of JG-29 andTexcoco RNA (Fig. 7B). No amplicons were generated using

RNA as a template if reverse transcriptase was excluded (Fig.7A and B).

DISCUSSION

Multiple lines of evidence support that we have identifiedthe gene that encodes the 45-kDa merozoite surface glycopro-tein, gp45, of B. bigemina. First and most importantly, lysatesof E. coli transfected with gp45 cDNA clone 4.2.2.1.1.1 andB. bigemina merozoite lysates were compared in a Western blotformat using anti-gp45 MAb 14/1.3.2. This MAb, which definesgp45 as a surface-exposed and protection-inducing glycopro-tein (20, 21), detected a single protein band in both lysates,while MAb to an unrelated protein failed to detect any pro-teins within either lysate. The recombinant gp45 is 3 kDasmaller than native gp45, as anticipated from the lack of post-translational modification of eukaryotic proteins expressedwithin bacteria. Second, lysates of E. coli transfected with gp45cDNA clone 4.2.2.1.1.1 and E. coli transfected with controlplasmid were compared in a Western blot using polyclonalanti-gp45 serum. Both monospecific polyclonal rabbit anti-na-tive gp45 antibody and native gp45-immunized bovine serumrecognized a protein of the predicted size within the 4.2.2.1.1.1.lysates but not in the control E. coli lysates. This protein wasnot detected by negative control rabbit or bovine serum. Third,the encoded protein is predicted to have structural features, anamino-terminal signal peptide, a central hydrophilic domain inthe mature protein, and a carboxy-terminal signal for additionof a glycosylphosphatidylinositol anchor, previously identifiedin the native gp45 protein, which is surface exposed, glycosy-lated, and myristylated (20, 21).

B. bigemina gp45 lacks introns, as shown by the identicalORFs of the genomic and cDNA clones. In addition, unlikethe tandem arrangement of B. bovis msa-2 genes, gp45, similarto B. bovis msa-1 (34), is flanked by unrelated ORFs andappears to be present as a single-copy gene. The stringency ofthe Southern blot analysis was predicted to be capable ofdetecting additional gp45-like genes with $55% homology tothe defined gp45 gene. While no additional gp45-like sequenceswere identified in the Southern blot analysis, the alternativebut unlikely explanation of multiple identical copies with iden-tical flanking sequences cannot be definitively excluded (5, 11,14). Nonetheless, the genomic structure of gp45 is clearly dif-ferent from that of the multicopy B. bovis msa-2 gene family(14) and suggests that gp45 antigenic polymorphism amongstrains involves strain-specific differences in the presence, se-quence, or regulation of a single gene.

The antigenic polymorphism among B. bigemina strains is asignificant constraint to vaccine development (6, 24, 27). Theexperiments presented here replicate previous results and con-firm surface B-cell epitope variation among strains isolatedfrom the Americas (19–21). Both MAb and polyclonal mono-specific serum against native gp45 bind epitopes only in thehomologous Mexico strain. As anticipated, the expression ofgp45 by the biological clone JG-29 mimics that of the unclonedparental Mexico strain. In addition, analysis of six unpassagedPuerto Rico isolates replicated those of the cryopreservedPuerto Rico strain. Together, these results indicate that theepitope variation cannot be attributed to in vitro or in vivopassage, cryopreservation, or biological cloning.

FIG. 7. Detection of gp45 transcripts. B. bigemina total RNA iso-lated from JG-29 or the Texcoco strain was reverse transcribed usingan oligo(dT20) primer and amplified in reactions using specific primers,TGF1.0 and TGF4.3.5 for gp45 or B483Fx and B822R for rap-1. DNAfrom each strain was used as a positive control for gene-specific am-plification, and RNA without addition of reverse transcriptase (RT)was used as a control for contaminating DNA in the RNA tem-plates.(A) JG-29 or Texcoco strain RNA was reverse transcribed usingan oligo(dT20) primer, and cDNA or genomic DNA was amplifiedusing separate reactions for each primer set. Molecular size markersare in the outside lanes, with the positions of the 350-bp and 600-bpmarkers indicated in the margins. (B) JG-29 and the Texcoco strainRNA were reverse transcribed using an oligo(dT20) primer either inseparate reactions or with equal amounts from each strain together ina single reaction. The cDNA or genomic DNA was then amplifiedusing either separate reactions for each primer set or both primer setsin the same reaction. Molecular size markers are in the outside lanesand middle lanes, with the positions of the 300-bp and 400-bp markersindicated in the margins.



.org/D

ownloaded from

http://iai.asm.org/

Lack of gp45 expression in American strains was attributedto mechanisms at two levels. The first, typified by the PuertoRico and St. Croix strains, was the absence of a closely relatedgp45-like gene. This conclusion was based initially on the in-ability of PCR with JG-29 gp45-specific primers to generate anamplicon from either strain. The four primer sets selected werefrom the JG-29 gp45 ORF and allowed amplification of thegene in both the Mexico and Texcoco strains. As a control,rap-1 sequences could be amplified from all strains, includingPuerto Rico and St. Croix. To avoid the obvious bias of usingspecific gp45 primers, Southern blots were then done usingfour gp45 probes. Initial Southern blots of Puerto Rico and St.Croix genomic DNA were performed using a 718-bp probederived from the 59 half of gp45. It is predicted that under thehybridization stringency used, sequences of $55% homologywould have been detected. Thus, any gp45-like genes in thePuerto Rico and St. Croix strains would be highly polymorphiccompared to the Mexico strain and JG29 clone. Three addi-tional probes, ranging from 210 to 343 bp in length and col-lectively spanning the entire gp45 gene, were used to screen forthe presence of any shorter gp45-like sequences within thegenomic DNA of uncloned Puerto Rico isolates. These probeswould have detected sequences of $75% homology to the 59,central, or 39 third of gp45 regardless of the homology to thefull-length JG-29 gp45 gene, but did not hybridize with thePuerto Rico or St. Croix strains. Furthermore, a gp45-like genecould not be identified within the Puerto Rico strain genomewhen the orthologous locus was PCR amplified using primersderived from the unrelated ORFs flanking the JG-29 gp45,cloned, and probed for related sequences (data not shown).

Do B. bigemina strains, like Puerto Rico and St. Croix, whichlack a closely related gp45-like gene have another functionalorthologue? A second glycosylated and myristylated merozoitesurface protein, gp55, has been demonstrated to be expressedby the Mexico strain of B. bigemina (20). However, neithergp45 nor gp55, as defined in the Mexico strain, is expressed bythe Puerto Rico and St. Croix strains of B. bigemina (20, 21).Alternatively, the Puerto Rico and St. Croix strains may ex-press an as yet unidentified, functionally analogous surfaceglycoprotein. The ability of parasites defective in a single in-vasion pathway to utilize alternative pathways has been clearlyshown in malarial parasites. Whether this applies to Babesiaspp. is unknown.

The second mechanism responsible for the lack of gp45expression is exemplified by the Texcoco strain. The Texcocostrain contains a gp45 ORF which was identical to that in theMexico strain and JG-29 clone but was not transcribed. Thislack of transcription is specific to gp45, as Texcoco rap-1 tran-scripts were readily detected. Why this gene is not transcribedis unresolved. However, 9 of 13 potential transcription factor-binding site sequences (TESS and Matlnspector/TRANSFC[29] programs) that are identical to known eukaryotic tran-scription factor-binding sites, including those shown to func-tion in Plasmodium spp. (18, 33), were altered in the Texcocogenome by the presence of base substitutions. Furthermore,the NNPP/Eukaryotic program identified a single eukaryoticpromoter site within the genomic sequence upstream of theJG-29 gp45 gene. Four of the observed base changes upstreamof the Texcoco gp45 gene occur within this sequence. Thus,gp45 in the Texcoco strain could simply represent a pseudo-

gene. Alternatively, transcription may be tightly regulated andoccur only in nonerythrocytic stages of the parasite life cycle.

The mechanism of B-cell epitope variation in B. bovisMSA-1 has been attributed to extensive polymorphism, pre-sumably arising by mutation, within ORFs encoded by msa-1 inthe Mexico and Argentina strains (34). The gp45 antigenicpolymorphism in B. bigemina may reflect a similar mechanism,as illustrated by the Puerto Rico and St. Croix strains, in whichany gp45-like sequences would be highly polymorphic (,55%identity) compared to the Mexico strain. However, the anti-genic polymorphism of gp45 B-cell epitopes between the Mex-ico and Texcoco strains does not reflect this same mechanism.This generation of antigenic polymorphism in merozoite sur-face glycoproteins using at least two mechanisms in B. bovisand B. bigemina supports a critical role for surface glycoproteinpolymorphism in successful parasitism.

ACKNOWLEDGMENTS

We thank Deb Alperin, Bev Hunter, and Carla Robertson for tech-nical assistance and Kelly Brayton and Rich Scott for assistance withthe figures.

This work was supported by USAID PCE-G-00-98-00043-00, USDANRI 96-35204-3667, and NIH K11 AI 01269.

REFERENCES

1. Alonso, M., C. Arello-Sota, V. H. Cereser, C. O. Cordoves, A. A. Gugliel-mone, R. Kessler, A. J. Mangold, A. Nari, J. H. Patarroyo, M. A. Solari, C. A.Vega, O. Vizcaino, and E. Camus. 1992. Epidemiology of bovine anaplas-mosis and babesiosis in Latin America and the Caribbean. Rev. Sci. Technol.11:713–733.

2. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller,and D. J. Lipman. 1997. Gapped BLAST and PSI-Blast: a new generation ofprotein database search programs. Nucleic Acids Res. 25:3389–3402.

3. Bock, R. E., A. J. de Vos, A. Lew, T. G. Kingston, and I. R. Fraser. 1995.Studies on failure of T strain live Babesia bovis vaccine. Aust. Vet. J. 72:296–300.

4. Brown, W. C., and G. H. Palmer. 1999. Designing blood-stage vaccinesagainst Babesia bovis and Babesia bigemina. Parasitol. Today 15:275–281.

5. Cowman, A. F., O. D. Bernard, N. Stewart, and D. J. Kemp. 1984. Genes ofthe protozoan parasite Babesia bovis that rearrange to produce RNA specieswith different sequences. Cell 37:653–660.

6. Dalrymple, B. P. 1993. Molecular variation and diversity in candidate vaccineantigens from Babesia. Acta Trop. 53:227–238.

7. de Castro, J. J. 1997. Sustainable tick and tickborne disease control inlivestock improvement in developing countries. Vet. Parasitol. 71:77–97.

8. Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set ofsequence analysis programs for the VAX. Nucleic Acids Res. 12:387–395.

9. Figueroa, J. V., G. M. Buening, D. A. Kinden, and T. J. Green. 1990.Identification of common surface antigens among Babesia bigemina isolatesusing monoclonal antibodies. Parasitology 100:161–175.

10. Guglielmone, A. A. 1995. Epidemiology of babesiosis and anaplasmosis inSouth and Central America. Vet. Parasitol. 57:109–119.

11. Hines, S. A., G. H. Palmer, D. P. Jasmer, T. C. McGuire, and T. F. McEl-wain. 1991. Neutralization-sensitive merozoite surface antigens of Babesiabovis encoded by members of a polymorphic gene family. Mol. Biochem.Parasitol. 55:85–94.

12. Hotzel, I., W. C. Brown, T. F. McElwain, S. D. Rodriguez, and G. H. Palmer.1996. Dimorphic sequences of rap-1 genes encode B and CD41 T helperlymphocyte epitopes in the Babesia bigemina rhoptry associated protein-1.Mol. Biochem. Parasitol. 81:89–99.

13. Hotzel, I., C. E. Suarez, T. F. McElwain, and G. H. Palmer. 1997. Geneticvariation in the dimorphic regions of rap-1 genes and rap-1 loci of Babesiabigemina. Mol. Biochem. Parasitol. 90:479–489.

14. Jasmer, D. P., D. W. Reduker, S. A. Hines, L. E. Perryman, and T. C.McGuire. 1992. Surface epitope localization and gene structure of a Babesiabovis 44-kilodalton variable merozoite surface antigen. Mol. Biochem. Para-sitol. 55:75–84.

15. Kaufmann, J. (ed.). 1996. Parasitic infections of domestic animals: a diag-nostic manual, p. 61–65. Birkhauser Verlag, Basel, Switzerland.

16. Lawrence, J. A., and A. J. de Vos. 1990. Methods currently used for thecontrol of anaplasmosis and babesiosis: their validity and proposals forfuture control strategies. Parassitologia 32:63–71.

17. Lawrence, J. A., J. Malika, A. P. Whiteland, and P. Kafuwa. 1993. Efficacy ofan Australian Babesia bovis bovis vaccine strain in Malawi. Vet. Rec. 132:295–296.



.org/D

ownloaded from

http://iai.asm.org/

18. Lewis, A. P. 1990. Sequence analysis upstream of the gene encoding theprecursor to the major merozoite surface antigen of Plasmodium yoelii. Mol.Biochem. Parasitol. 39:285–288.

19. Madruga, C. R., C. E. Suarez, T. F. McElwain, and G. H. Palmer. 1996.Conservation of merozoite membrane and apical complex B cell epitopesamong Babesia bigemina and Babesia bovis strains isolated in Brazil. Vet.Parasitol. 61:21–30.

20. McElwain, T. F., L. E. Perryman, W. C. Davis, and T. C. McGuire. 1987.Antibodies define multiple proteins with epitopes exposed on the surface oflive Babesia bigemina merozoites. J. Immunol. 138:2298–2304.

21. McElwain, T. F., L. E. Perryman, A. J. Musoke, and T. C. McGuire. 1991.Molecular characterization and immunogenicity of neutralization-sensitiveBabesia bigemina merozoite surface proteins. Mol. Biochem. Parasitol. 47:213–222.

22. Mishra, V. S., T. F. McElwain, J. B. Dame, and E. B. Stephens. 1992.Isolation, sequence and differential expression of the p58 gene family ofBabesia bigemina. Mol. Biochem. Parasitol. 53:149–158.

23. Mishra, V. S., E. B. Stephens, J. B. Dame, L. E. Perryman, T. C. McGuire,and T. F. McElwain. 1991. Immunogenicity and sequence analysis of recom-binant p58: a neutralization-sensitive, antigenically conserved Babesia bigem-ina merozoite surface protein. Mol. Biochem. Parasitol. 47:207–212.

24. Musoke, A. J., G. H. Palmer, T. F. McElwain, V. Nene, and D. McKeever.1996. Prospects for subunit vaccines against tick-borne diseases. Br. Vet. J.152:617–619.

25. Nielson, H. J. Engelbrecht, S. Brunak, and G. von Heijne. 1997. Identifica-tion of prokaryotic and eukaryotic signal peptides and prediction of theircleavage sites. Protein Eng. 10:1–6.

26. Palmer, G. H., and T. F. McElwain. 1995. Molecular basis for vaccinedevelopment against anaplasmosis and babesiosis. Vet. Parasitol. 57:233–253.

27. Palmer, G. H., T. F. McElwain, L. E. Perryman, W. C. Davis, D. W. Reduker,D. P. Jasmer, V. Shkap, E. Pipano, W. L. Goff, and T. C. McGuire. 1991.Strain variation of Babesia bovis merozoite surface-exposed epitopes. Infect.Immun. 59:3340–3342.

28. Payne, R. C., O. Osorio, and A. Ybanez. 1990. Tick-borne diseases of cattlein Paraguay. II. Immunisation against anaplasmosis and babesiosis. Trop.Anim. Health Prod. 22:101–108.

29. Quandt, K., K. Frech, H. Karas, E. Wingender, and T. Werner. 1995. Matlndand Matlnspector—new fast versatile tools for detection of consensusmatches in nucleotide sequence data. Nucleic Acids Res. 23:4878–4884.

30. Reduker, D. W., D. P. Jasmer, W. L. Goff, L. E. Perryman, W. C. Davis, andT. C. McGuire. 1989. A recombinant surface protein of Babesia bovis elicitsbovine antibodies that react with live merozoites. Mol. Biochem. Parasitol.35:239–248.

31. Ristic, M., and J. P. Kreier (ed.). 1981. Babesiosis, p. 445–457. AcademicPress, New York, N.Y.

32. Sambrook, J., E. F. Fritsch, and T. Maniatis (ed.). 1989. Molecular cloning:a laboratory manual, 2nd ed., p. 9.16–9.23. Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, N.Y.

33. Saul, A., and D. Battistutta. 1990. Analysis of the sequences flanking thetranslational start sites of Plasmodium falciparum. Mol. Biochem. Parasitol.42:55–62.

34. Suarez, C. E., M. Florin-Christensen, S. A. Hines, G. H. Palmer, W. C.Brown, and T. F. McElwain. 2000. Characterization of allelic variation in theBabesia bovis merozoite surface antigen-1 (msa-1) locus and identificationof a cross-reactive, inhibition-sensitive MSA-1 epitope. Infect. Immun. 68:6865–6870.

35. Suarez, C. E., T. F. McElwain, I. Echaide, S. Torioni de Echaide, and G. H.Palmer. 1994. Interstrain conservation of babesial RAP-1 surface-exposed B-cell epitopes despite rap-1 genomic polymorphism. Infect. Immun. 62:3576–3579.

36. Vega, C. A., G. M. Buening, S. D. Rodriguez, and C. A. Carson. 1986. Cloningand in vitro propogated Babesia bigmenia. Vet. Parasitol. 22:223–233.

37. Vega, C. A., G. M. Buening, S. D. Rodriguez, C. A. Carson, and K. McLaugh-lin. 1985. Cryopreservation of Babesia bigmenia for in vitro cultivation. Am. J.Vet. Res. 46:421–423.

Editor: J. M. Mansfield



.org/D

ownloaded from

http://iai.asm.org/

molecular basis for variable expression of merozoite ...iai.asm.org/content/69/6/3782.full.pdf ·...

Documents