Molecular Biology Background

Schematic view of DNA organization in a cell

• A Gene is the fundamental physical and functional unit of heredity. A gene is an ordered sequence of nucleotides located in a particular position on a particular chromosome that encodes a specific functional product (i.e., a protein or RNA molecule).

• A Genome is all the genetic material (DNA) in the chromosomes of a particular organism; its size is generally given as its total number of base pairs.

Genes and Genomes

genetics.gsk.com/ graphics/dna-big.gif

• Four nucleotides: adenine (A), cytosine

(C), guanine (G), and thymine (T)

• Bindings:

– A with T (weaker), C with G (stronger)

• Forms a double helix – each strand is

linked via sugar-phosphate bonds

(strong), strands are linked via hydrogen

bonds (weak)

• Genome is the part of DNA that

encodes proteins:

– …AACTCGCATCGAACTCTAAGTC…

DNA Structure

Comparisons between DNA and single stranded RNA with the diagram of the bases showing.

The chemical structure of DNA

Why is genomics interesting for the

signal processing person?

Because there are sequences there!

OK, what sort of sequences?

1. Sequences from an alphabet of size four:

…ATTCGAAGATTTCAACGGGAAAA…

DNA

2. Sequences from an alphabet of size twenty:

AACWYDEFGHIKLMNPQRSTVAPPQR

Protein

Size-4 alphabet:

A, C, T, G: bases (also called or nucleotides)

DNA sequences (genomes) are made of these.

Genes are parts of DNA, and are 4-letter sequences.

Adenine Thymine Cytosine Guanine

or Uracil (in RNA)

DNA: deoxyribonucleic acid

RNA:ribonucleic acid

Central Dogma of Molecular Biology

• Flow of information in a cell

• Recent development of high-throughput technologies that study the above flow

– requires interdisciplinary effort

– dealing with a huge amount of information

Details of the information flow

• Replication of DNA

– {A,C,G,T} to {A, C, G,T}

• Transcription of DNA to mRNA

– {A,C,G,T} to {A, C, G,U}

• Translation of mRNA to proteins

– {A,C,G,U} to {20 amino-

acids}

http://www-stat.stanford.edu/~susan/courses/s166/central.gif

Genes can be turned on and off

The twenty natural amino acids

(B,J,O,U,X,Z missing)

11 essential amino acids.

Animals cannot make the eleven

indicated amino acids.

They need to eat them;

Milk provides all of these.

Grains and beans together

provide all of these.

Protein Example

Fibroblast growth factor proteins

Basic bovine

Acidic bovine

length 146

length 140

Example of a Protein: Hemoglobin (oxy, human)

http://www.biochem.szote.u-szeged.hu/astrojan/protein2.htm

Sequence of amino acids. Folds into beautiful 3D shapes. Necessary for function.

Example of a protein (an enzyme)

http://www.biochem.szote.u-szeged.hu/astrojan/protein2.htm

The mapping from amino acids to codons is many-to-one

Computational Gene-Finding