Molecular Biology I

Some basic concepts

Aspects to CoverDNA: structure, replication

RNA: transcription and processing

Protein: translation

Gene Expression: levels of transcription and translation

Common Techniques: DNA quantitationGel electrophoresisSouthern/ Northern blotGene cloningPolymerase chain reaction (PCR)Quantitative Real-time PCR

DNA - Molecular Structure

Deoxyribonucleic acid (DNA) is the genetic code that exists within every cell.

Consists of two associated strands that wind together in a helical fashion. It is often described as a double helix.

Each strand is a linear polymer in which the monomers (deoxynucleotides), are linked together by means of phosphodiester bonds.

DNA - Molecular Structure

A single nucleotide subunit consists of a deoxyribose sugar joined to a phosphate group. Attached to the other side of the sugar molecule is one of four nitrogen bases.

Nitrogen Base Pairing

Purines Pyrimidines

DNA Double Helix

5`end

3`end

3`end

5`end

DNA – The Genetic Code

The genetic code (genotype) determines how an organism looks and functions (phenotype)

DNA is essential for all living organisms.

The more complex the organism the larger the genome

Genotypewild type

Phenotypenormal

Genotypedb/db

Phenotypeobese

“Central Dogma”

Central dogma describes information flow fromDNA→RNA→protein

Protein considered the functional unit within the cell

DNA Replication

Structure of Genomic DNA

Gene

Promoter

Exon

1 2 3 4 5

Introns

Gene: coding and regulatory elements that combine to result in a proteinExons: sequences within the gene that encode the protein structureIntrons: intervening sequences that do not encode the protein structurePromoter: regulatory sequences that, together with transcription factors, determine the amount of gene expression

5` 3`

Transcription: process to produce RNA from the gene

There is more than one type of ribonucleic acid...

Messenger RNA (mRNA): carries the genetic information out of the nucleus for protein synthesis.

Transfer RNA (tRNA): decodes the information from mRNA.

Ribosomal RNA (rRNA): constitutes 50% of a ribosome, which is a molecular assembly involved in protein synthesis.

Catalytic/ functional RNAs: involved in reactions in the cell.

RNA – From gene to protein

RNA is similar to single stranded DNA sense strand

Carries the ‘message’ to protein construction centers - ribosomes

Uracil (U) replaces thymidine (T)

sense strand

antisense strand

RNA is complementary to DNA antisense strandRNA has same sequence as DNA sense strand

RNA synthesis

5` ATGCGTTAGACTTGACACTGACTAC 3`3` TACGCAATCTGAACTGTGACTGATG 3`

DNA

5` AUGCGUUAGACUUGACACUGACUAC 3`mRNA

mRNA – The Cellular Messenger

Sugar is ribose rather than deoxyribose

RNA DNA

mRNA Processing

Pre-mRNA is transcribed from DNA in nucleus by RNA polymerase

Protein is translated from the RNA at the cytoplasm at the ribosome

Splicing removes introns from pre-mRNA to create mRNA

mRNA is transported from the nucleus to the rough endoplasmic reticulum (rER)

Protein Translation

mRNA arranged in codons – 3 bases

tRNA contains specific amino acids for particular anticodons

Occurs at ribosomes using mRNA as template and tRNA for assembly of protein building blocks – amino acids

Polymerisation of amino acids occurs until a stop codon is read

Amino acids polymerise in the order determined by the sequence of mRNA

Ribosome shuffles along mRNA to next codon

Each amino acid is encoded by one or more codons – degenerate code

Decoding the genetic code

20 common amino acids, 1 start codon (Met - AUG), 3 stop codons (UAA, UAG, UGA)

RNA to protein: one possible sequence

Protein to RNA: many possible sequences

“Gene Expression”

Gene expression is regulated at both the transcriptional and translational levels – RNA and protein expression don’t always correlate

Expression refers to both RNA and protein

A single gene does not always produce a single protein

Leptin (Ob)

Adipocytes

Hypothalamus

Ob-R NPY-ve

Leptin Background

-ve

-ve

Ob-RL

Ob-RS

Alternate splicing of Ob-R

Ob-RL and Ob-RS are identical in mRNA up until exon 18

Ob-RL uses exon 18a & 18b and Ob-RS uses exon 18 a

Different stop codon result in different proteins

Transmembrane

Extracellular

Intracellular

Ob-RLOb-RS

Leptin Receptor – Ob-R

G T

SummaryDNA replicates itself at every cell division, placing a copy of itself in every cell in every organism

Transcription produces a copy of the DNA called RNA

Translation decodes the information from the gene/mRNA into a protein – the functional endpoint of gene expression

Transcription and translation are independently regulated – mRNA and protein levels are not necessarily correlated

Small changes at the DNA level can produce drastic changes at the protein level

DNA/RNA QuantitationDNA/RNA can be extracted from virtually any tissue using special chemicals and purification procedures

Once extracted, DNA/RNA can be dissolved in water and used for a variety of different techniques – PCR etc

Wavelength (nm)

Abs

orba

nce

1.60

0200 350

260

280

Spectrophotometer can analyse the spectral properties of the nucleic acid

A260/A280 = 1.8

A260 = 1.0 50 g/ml

A260/A280 = 2.0

A260 = 1.0 40 g/ml

Similarly for RNA

Gel ElectrophoresisDNA can originate from a variety of sources:

genomic DNA - from organismsplasmid DNA - circular, cloned fragments amplified DNA - specific fragments from PCR

Knowing the size of the DNA is beneficial in identifying the fragments – distance migrated is inversely proportional to the size of the molecule

DNA size is usually measured in numbers of base pairs:bp (1 – 1000)kb (thousands of bp)Mb (millions of bp)

Gel Electrophoresis

DNA size approximated by electrophoresis through agarose and comparison with fragments of known size

-

+

Load DNA onto gelApply electric current to gel (100 V)Negatively charged DNA migrates to positive electrode

DNA moves according to size – small fragments more faster than large fragments

100 bp

200 bp300 bp400 bp500 bp

1 kb

~400 bp~250 bp

Due to phosphate backbone DNA has negative charge

Standard methodology resolves relatively small DNA molecules (0.1-50kb)

Ethidium bromide used to stain DNA – binds and fluoresces under UV illumination

% agarose determines range of DNA sizes resolved0.3% w/v resolves DNA of 5-50 kb2.0% w/v resolves DNA of 0.1-2 kb

Gel Electrophoresis