molecular biology i
DESCRIPTION
Molecular Biology I. Some basic concepts. Aspects to Cover. DNA: structure, replication. RNA: transcription and processing. Protein: translation. Gene Expression: levels of transcription and translation. Common Techniques: DNA quantitation Gel electrophoresis Southern/ Northern blot - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/1.jpg)
Molecular Biology I
Some basic concepts
![Page 2: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/2.jpg)
Aspects to CoverDNA: structure, replication
RNA: transcription and processing
Protein: translation
Gene Expression: levels of transcription and translation
Common Techniques: DNA quantitationGel electrophoresisSouthern/ Northern blotGene cloningPolymerase chain reaction (PCR)Quantitative Real-time PCR
![Page 3: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/3.jpg)
DNA - Molecular Structure
Deoxyribonucleic acid (DNA) is the genetic code that exists within every cell.
Consists of two associated strands that wind together in a helical fashion. It is often described as a double helix.
![Page 4: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/4.jpg)
Each strand is a linear polymer in which the monomers (deoxynucleotides), are linked together by means of phosphodiester bonds.
DNA - Molecular Structure
A single nucleotide subunit consists of a deoxyribose sugar joined to a phosphate group. Attached to the other side of the sugar molecule is one of four nitrogen bases.
![Page 5: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/5.jpg)
Nitrogen Base Pairing
Purines Pyrimidines
![Page 6: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/6.jpg)
DNA Double Helix
5`end
3`end
3`end
5`end
![Page 7: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/7.jpg)
DNA – The Genetic Code
The genetic code (genotype) determines how an organism looks and functions (phenotype)
DNA is essential for all living organisms.
The more complex the organism the larger the genome
Genotypewild type
Phenotypenormal
Genotypedb/db
Phenotypeobese
![Page 8: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/8.jpg)
“Central Dogma”
Central dogma describes information flow fromDNA→RNA→protein
Protein considered the functional unit within the cell
![Page 9: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/9.jpg)
DNA Replication
![Page 10: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/10.jpg)
Structure of Genomic DNA
Gene
Promoter
Exon
1 2 3 4 5
Introns
Gene: coding and regulatory elements that combine to result in a proteinExons: sequences within the gene that encode the protein structureIntrons: intervening sequences that do not encode the protein structurePromoter: regulatory sequences that, together with transcription factors, determine the amount of gene expression
5` 3`
Transcription: process to produce RNA from the gene
![Page 11: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/11.jpg)
There is more than one type of ribonucleic acid...
Messenger RNA (mRNA): carries the genetic information out of the nucleus for protein synthesis.
Transfer RNA (tRNA): decodes the information from mRNA.
Ribosomal RNA (rRNA): constitutes 50% of a ribosome, which is a molecular assembly involved in protein synthesis.
Catalytic/ functional RNAs: involved in reactions in the cell.
RNA – From gene to protein
![Page 12: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/12.jpg)
RNA is similar to single stranded DNA sense strand
Carries the ‘message’ to protein construction centers - ribosomes
Uracil (U) replaces thymidine (T)
sense strand
antisense strand
RNA is complementary to DNA antisense strandRNA has same sequence as DNA sense strand
RNA synthesis
5` ATGCGTTAGACTTGACACTGACTAC 3`3` TACGCAATCTGAACTGTGACTGATG 3`
DNA
5` AUGCGUUAGACUUGACACUGACUAC 3`mRNA
mRNA – The Cellular Messenger
Sugar is ribose rather than deoxyribose
RNA DNA
![Page 13: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/13.jpg)
mRNA Processing
Pre-mRNA is transcribed from DNA in nucleus by RNA polymerase
Protein is translated from the RNA at the cytoplasm at the ribosome
Splicing removes introns from pre-mRNA to create mRNA
mRNA is transported from the nucleus to the rough endoplasmic reticulum (rER)
![Page 14: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/14.jpg)
Protein Translation
mRNA arranged in codons – 3 bases
tRNA contains specific amino acids for particular anticodons
Occurs at ribosomes using mRNA as template and tRNA for assembly of protein building blocks – amino acids
Polymerisation of amino acids occurs until a stop codon is read
Amino acids polymerise in the order determined by the sequence of mRNA
Ribosome shuffles along mRNA to next codon
![Page 15: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/15.jpg)
Each amino acid is encoded by one or more codons – degenerate code
Decoding the genetic code
20 common amino acids, 1 start codon (Met - AUG), 3 stop codons (UAA, UAG, UGA)
RNA to protein: one possible sequence
Protein to RNA: many possible sequences
![Page 16: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/16.jpg)
“Gene Expression”
Gene expression is regulated at both the transcriptional and translational levels – RNA and protein expression don’t always correlate
Expression refers to both RNA and protein
A single gene does not always produce a single protein
![Page 17: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/17.jpg)
Leptin (Ob)
Adipocytes
Hypothalamus
Ob-R NPY-ve
Leptin Background
-ve
-ve
![Page 18: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/18.jpg)
Ob-RL
Ob-RS
Alternate splicing of Ob-R
Ob-RL and Ob-RS are identical in mRNA up until exon 18
Ob-RL uses exon 18a & 18b and Ob-RS uses exon 18 a
Different stop codon result in different proteins
![Page 19: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/19.jpg)
Transmembrane
Extracellular
Intracellular
Ob-RLOb-RS
Leptin Receptor – Ob-R
G T
![Page 20: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/20.jpg)
SummaryDNA replicates itself at every cell division, placing a copy of itself in every cell in every organism
Transcription produces a copy of the DNA called RNA
Translation decodes the information from the gene/mRNA into a protein – the functional endpoint of gene expression
Transcription and translation are independently regulated – mRNA and protein levels are not necessarily correlated
Small changes at the DNA level can produce drastic changes at the protein level
![Page 21: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/21.jpg)
DNA/RNA QuantitationDNA/RNA can be extracted from virtually any tissue using special chemicals and purification procedures
Once extracted, DNA/RNA can be dissolved in water and used for a variety of different techniques – PCR etc
Wavelength (nm)
Abs
orba
nce
1.60
0200 350
260
280
Spectrophotometer can analyse the spectral properties of the nucleic acid
A260/A280 = 1.8
A260 = 1.0 50 g/ml
A260/A280 = 2.0
A260 = 1.0 40 g/ml
Similarly for RNA
![Page 22: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/22.jpg)
Gel ElectrophoresisDNA can originate from a variety of sources:
genomic DNA - from organismsplasmid DNA - circular, cloned fragments amplified DNA - specific fragments from PCR
Knowing the size of the DNA is beneficial in identifying the fragments – distance migrated is inversely proportional to the size of the molecule
DNA size is usually measured in numbers of base pairs:bp (1 – 1000)kb (thousands of bp)Mb (millions of bp)
![Page 23: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/23.jpg)
Gel Electrophoresis
DNA size approximated by electrophoresis through agarose and comparison with fragments of known size
-
+
Load DNA onto gelApply electric current to gel (100 V)Negatively charged DNA migrates to positive electrode
DNA moves according to size – small fragments more faster than large fragments
100 bp
200 bp300 bp400 bp500 bp
1 kb
~400 bp~250 bp
Due to phosphate backbone DNA has negative charge
![Page 24: Molecular Biology I](https://reader030.vdocument.in/reader030/viewer/2022032805/5681329b550346895d99370e/html5/thumbnails/24.jpg)
Standard methodology resolves relatively small DNA molecules (0.1-50kb)
Ethidium bromide used to stain DNA – binds and fluoresces under UV illumination
% agarose determines range of DNA sizes resolved0.3% w/v resolves DNA of 5-50 kb2.0% w/v resolves DNA of 0.1-2 kb
Gel Electrophoresis