molecular characterization and expression pattern of insulin-like growth factor binding protein-3...
TRANSCRIPT
Molecular characterization and expression patternof insulin-like growth factor binding protein-3 (IGFBP-3)in common carp, Cyprinus carpio
Wenbo Chen • Haoran Lin • Wensheng Li
Received: 29 February 2012 / Accepted: 15 June 2012 / Published online: 27 June 2012
� Springer Science+Business Media B.V. 2012
Abstract A full-length cDNA encoding the insulin-
like growth factor binding protein-3 (IGFBP-3) was
cloned from the liver of common carp (Cyprinus
carpio) by RT-PCR. The IGFBP-3 cDNA sequence is
1,680 bp long and has an open reading frame of
882 bp encoding a predicted polypeptide of 293 amino
acid residues. The deduced amino acid sequence
contains a putative signal peptide of 25 amino acid
residues resulting in a mature protein of 268 amino
acids. A single band of approximate 1.9 kb was found
in liver by Northern blot analysis. IGFBP-3 mRNA
was observed in all regions of brain with high levels.
In peripheral tissues, high levels of IGFBP-3 mRNA
were found in retina, red muscle, liver, heart, posterior
intestine, spleen, and testis. Relatively lower levels
were found in white muscle, kidney, thymus gland,
and ovary, while in head kidney, blood, skin, gill,
middle intestine, and anterior intestine, the IGFBP-3
mRNA levels were much lower. IGFBP-3 mRNA was
first detected in the blastula stage with significantly
high level. The level sharply decreased in gastrula
stage, and it became to increase in the following
stages. During the reproductive cycle, the abundance
of IGFBP-3 mRNA significantly decreased between
the recrudescing stage and the matured stage in ovary,
although in testis, IGFBP-3 mRNA expression level
did not exhibit a significant change. The mRNA
expression profiles in the present study imply that the
IGFBP-3 may play important physiological functions
in common carp development and reproduction.
Keywords Cyprinus carpio � Insulin-like growth
factor binding protein-3 � cDNA cloning � mRNA
expression
Introduction
Insulin-like growth factor (IGF) system, including
IGF-I and IGF-II, IGF receptors, and IGF-binding
proteins (IGFBPs), is important for cell growth,
proliferation, and differentiation. To date, six IGFBPs
(IGFBP-1 to IGFBP-6) have been cloned and charac-
terized in mammals (Jones and Clemmons 1995; Hwa
et al. 1999). These IGFBPs can bind IGFs with an
affinity equal to or greater than that of IGF receptors.
Many studies have been pointed that IGFBPs not only
have essential roles in controlling and regulating the
biological activities of IGFs but also IGF-independent
W. Chen � H. Lin � W. Li (&)
State Key Laboratory of Biocontrol, Institute of Aquatic
Economic Animals and Guangdong Provincial Key
Laboratory for Aquatic Economic Animals, School
of Life Sciences, Sun Yat-Sen University,
Guangzhou 510275, China
e-mail: [email protected]
W. Chen
Department of Biology, Institute of Resources
and Environment, Henan Polytechnic University,
Jiaozuo 454000, China
123
Fish Physiol Biochem (2012) 38:1843–1854
DOI 10.1007/s10695-012-9681-6
actions via their putative receptor on cell membrane or
direct nuclear actions by transporting into the nucleus
(Andress 1998; Schedlich et al. 2000; Firth and Baxter
2002).
Of the six IGFBPs, IGFBP-3 is the most abundant
IGFBP in plasma and carries the majority of the IGFs
in the circulation in a 150 kDa form complexed with
IGFs and an acid-labile subunit (Baxter and Martin
1989). In mammals, IGFBP-3 mRNA is mainly
synthesized in liver by non-parenchymal cells, while
in many other extrahepatic tissues, IGFBP-3 mRNA
also has moderate expression levels, suggesting its
endocrine and autocrine/paracrine functions (Clem-
mons 1997).
In the circulation of variety of teleost fishes, the
40–50 kDa IGFBP, postulated to be fish IGFBP-3,
has been detected using Western ligand blotting
(Kelley et al. 1992, 2001; Fukazawa et al. 1995; Park
et al. 2000; Bauchat et al. 2001; Gracey et al. 2001),
and some results show that fish IGFBP-3 is up-
regulated by growth hormone (GH), decreased by
fasting and correlate with fish somatic growth (Kelley
et al. 1992, 2001; Park et al. 2000). These results
show a similar regulation pattern as mammalian
IGFBP-3. Recently, full or partial length sequences of
fish IGFBP-3 cDNA have been cloned and charac-
terized in tilapia (Oreochromis mossambicus) (Cheng
et al. 2002), zebrafish (Danio rerio) (Chen et al.
2004), and yellowtail (Seriola quinqueradiata) (Pedr-
oso et al. 2009). Alignment of these amino acid
sequences indicates that the overall structure of fish
IGFBP-3s is conserved with high degree to their
mammalian counterparts. In striped bass (Morone
saxatilis) serum, the 35-kDa (IGFBP-3) protein is the
predominant IGFBP and its concentration is not
significantly altered by fasting and refeeding although
the levels tend to be reduced (Siharath et al. 1996).
However, little is known regarding the ontogeny of
fish IGFBP-3 mRNA and its possible involvement or
roles in fish reproduction.
To further understand the roles of IGFBPs in fish
development and reproduction, we utilized common
carp (Cyprinus carpio), one of the most economically
important fish in China, cloned and characterized the
IGFBP-3 cDNA, and determined its tissue distribu-
tion, expression patterns during early developmen-
tal stages and gonadal developmental stages using
semi-quantitative and real-time quantitative RT-PCR
analysis respectively.
Materials and methods
Fish and sample preparation
Common carps with body weight ranging from 500 to
1,200 g were collected from the local fishery center of
Guangzhou and then were cultured in a circulating
fresh water tank kept at 22–25 �C under natural
photoperiod and fed twice daily. Six male and female
fish at three different stages of reproductive cycle were
obtained, respectively, from July 2007 to February
2008 (6 9 6 = 36 fish in total). Tissue samples for
gene cloning, tissue distribution, and gonadal devel-
opment were collected after the animals had been
anesthetized on ice. Unfertilized eggs, embryos and 1-
to 30-day-old larval carps were obtained during
reproductive season from February to March 2007.
Samples were immediately frozen in liquid nitrogen
and stored at -80 �C before RNA extraction. All the
animal experiments were in accordance with the
guidelines and approval of Sun Yat-Sen University
Animal Care and Use Committee.
Cloning of common carp IGFBP-3 cDNA
Total RNA was extracted from the common carp liver
with Trizol� Reagent (Invitrogen, USA). The concen-
tration of the total RNA was estimated by measuring
the absorbance at 260 nm. Five micrograms of total
RNA from liver was used to synthesize the first-strand
cDNA using the SuperScriptTM III First-Strand Syn-
thesis System (Invitrogen, USA) following the man-
ufacturers’ instructions.
For cloning common carp IGFBP-3 partial cDNA
fragment, two pairs of degenerate primers were
designed according to comparison between the pub-
lished IGFBP-3 cDNA sequences. The forward primers
located about the evolutionarily conserved amino-
terminal (about the first 25–76 amino acid residues)
regions of zebrafish counterpart, and the reverse primers
were located on the carboxyl terminal (about the last
233–272 amino acid residues). In the first-round PCR,
1 ll RT product was used as template, ccBP3F1 and
ccBP3R1 as primers. Thirty-five cycles of amplification
were performed using a cycle profile of 94 �C for
3 min, 94 �C for 30 s, 55 �C for 30 s, 72 �C for 1 min.
The extension time was increased to 10 min in the last
cycle. Then, 2 ll of 100-fold diluted first-round PCR
product was subjected to a nested PCR, and the primers
1844 Fish Physiol Biochem (2012) 38:1843–1854
123
were replaced with ccBP3F2 and ccBP3R2. Thirty-five
cycles of amplification were performed using the same
profile as that using for the first-round PCR. Basing on
the sequenced partial fragment, the gene-specific prim-
ers for cloning 30-end and 50-end were designed. Two
round PCR with the similar procedure as described
above were performed with adaptor primers (AP,
AUAP and AAP) and gene-specific primers. All the
primers used were listed in the Table 1.
The amplification products were separated by
electrophoresis on 1.5 % agarose gel. The bands of
desired size were excised, purified using E.Z.N.A�
Gel Extraction Kit (Omega BioTek, USA), and
subcloned into the pTZ57R/T vector (Fermentas,
USA). Positive colonies were identified by color
screening on LB plates containing X-gal and Amp.
The plasmid DNA was identified by PCR amplifica-
tion and restriction enzyme digestion. And then, the
positive clones were sequenced.
Sequence analysis
The three fragments were assembled together by
DNAssist 2.0. The potential open reading frame
(ORF) was analyzed using DNAtools 6.0 and trans-
lated into the corresponding amino acids. The cDNA
sequence and the deduced amino acid sequence were
compared with the sequences in the GenBank database
using BLAST program available for the NCBI inter-
net website (http://www.ncbi.nlm.nih.gov). Multiple
alignments of amino acid sequences were achieved
using the programs of DNAstar and Clustalx 1.83. The
phylogenetic tree of vertebrate IGFBP-3 s was con-
structed using Mega 3.1 with Neighbor-Joining
method.
RNA extraction and reverse transcription (RT)
Total RNAs from 25 tissues, embryos, and larvae were
isolated, respectively, using Trizol� Reagent (Invit-
rogen, USA) and resuspended in DEPC-treated water.
The quality of RNAs was assessed by electrophoresis
on 0.8 % agarose gel based on integrity of 28S and 18S
RNA bands. 1 lg of total RNA was incubated with
DNase I (Invitrogen, USA) and then reverse-tran-
scribed into cDNA using Oligo (dT)18 primer by
RevertAidTM H Minus M-MuLV reverse transcrip-
tase kit (MBI Fermentas, USA) according to the
Table 1 Nucleotide
sequences of the primers used
for partial fragment, 30-RACE, 50-RACE, RT-PCR,
and real-time PCR of the
common carp IGFBP-3
cDNA
Primers Sequences
Primers for partial fragment
ccBP3F1 50 TGGT(C/G)CGCTGCGA(A/G)CC(A/G)TGC 30
ccBP3F2 50 TGCGG(A/C)(A/G)T(C/G)TACAC(C/G)G(A/G)GCG 30
ccBP3R1 50 CCCTT(C/T)T(G/T)GTC(A/G)CAGTT(G/T)GG 30
ccBP3R2 50 CC(A/G)TACTT(A/G)TCCAC(A/G)CACCA 30
Primers for 30 and 50-RACE PCR
ccBP3F3 50 CACGGACACGATAACCCTGAGG 30
ccBP3F4 50 CAGTGGGGTTCATACAGATA 30
ccBP3R3 50 ATGAACCCCACTGGAAACTG 30
ccBP3R4 50 CTCTTGGGTTCAGCACATTTG 30
AP 50 GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT 30
AUAP 50 GGCCACGCGTCGACTAGTAC 30
AAP 50 GGCCACGCGTCGACTAGTACGGGGGGGGGG 30
Primers for RT-PCR
ccBP3F3 50 CACGGACACGATAACCCTGAGG 30
ccBP3R4 50 CTCTTGGGTTCAGCACATTTG 30
18S-F 50 CCTGAGAAACGGCTACCACATCC 30
18S-R 50 AGCAACTTTAGTATACGCTATTGGAG 30
Primers for real-time PCR
qBP3F 50 GGGTATGATGGAAAGGAGAAAG 30
qBP3R 50 AGTGTAAAGTGAGTTGCTGGTC 30
Fish Physiol Biochem (2012) 38:1843–1854 1845
123
manufacture’s instructions. The first-strand cDNAs
were used as templates for PCR with IGFBP-3-
specific primers. The primers and PCR conditions
were optimized by preliminary experiments to avoid
dimmer formation and unspecific amplifications.
Semi-quantitative RT-PCR analysis
The tissue distribution of IGFBP-3 was analyzed by
semi-quantitative RT-PCR. RT-PCR was conducted
in a 20 ll total reaction mixture containing 2 ll
10 9 MBI PCR buffer with (NH4)2SO4, 1.6 ll of
25 mM MgCl2, 0.4 ll of 10 mM dNTPs Mix, 0.4 ll of
10 lM each primer, 14.1 ll of double distilled water,
0.5 U Taq polymerase (MBI Fermentas, USA), and
1 ll of each first-strand cDNA. The PCR conditions
consisted of a denaturation cycle of 94 �C for 3 min,
followed by 35 PCR cycles each consisted of 15 s
denaturation (94 �C), 15 s annealing (56 �C), 30 s
extension (72 �C). Extension time in the last cycle was
increased to 5 min. A fragment of common carp 18S
rRNA (GenBank Accession No. AF133089) was
amplified as an internal control. The PCR conditions
for 18S rRNA were the same as the common carp
IGFBP-3 PCR, except for using the 30 cycles instead
of 35 cycles. Negative control was performed without
cDNA template. Five microliters of each PCR product
was electrophoresed through 1.5 % agarose gel and
stained with EB, and then detected under UV light
with Gel Doc 2000 (BioRad, USA).
Real-time quantitative RT-PCR analysis
The levels of IGFBP-3 mRNA during the embryonic
stages, early developmental stages, and gonadal
developmental stages were performed on an ABI
PRISM� 7900 Sequence Detection System (Applied
Biosystems). Real-time specific primers for IGFBP-3
were designed (Table 1). The 20 ll real-time PCR
reactions contained 10 ll Platinum� SYBR� Green
qPCR SuperMix-UDG (Invitrogen, USA), 0.4 ll
ROX Reference Dye, 1.0 ll of RT product, and
0.2 lM of each forward and reverse primer. The PCR
amplification was carried out as follow: 50 �C for
2 min for UDG incubation, initial denaturation 95 �C
for 2 min, 40 cycles of 95 �C for 15 s, 55.5 �C for
15 s, 72 �C for 30 s. After amplification, a melting
curve was performed at the end of the reaction to
analyze the melting peaks of the PCR products
generated. Standard curves were generated between
cycle threshold (CT) value and logarithm of vector
dilutions using serial dilutions of quantified pTZ57R/T
vector containing the fragments of IGFBP-3 and 18S
rRNA, respectively. 18S rRNA was used as internal
control in order to standardize the results by eliminat-
ing variations in mRNA and cDNA quantity and
quality. We firstly tested the stability of 18S rRNA
during development and gonadal developmental
stages based on the reports of Ye et al. (2010). The
expression of 18S rRNA showed stable values during
our assay. Quantitative results were expressed as the
ratio of target gene/18S rRNA.
Northern blot analysis
Twenty micrograms of total RNA isolated from the
common carp liver with RNA loading dye was
electrophoresed in a 1 % denatured agarose gel
containing 0.66 % Formaldehyde in 1 9 MOPS
(0.02 M MOPS, 2 mM NaAcetate, 1 mM EDTA,
PH7.0) and separated at 5v/cm over a period of 2.5 h.
After the run, the gel was rinsed briefly with
0.5 9 TBE buffer. The RNA was blotted from the
gel by electric transfer and cross-linked to Hybond-
Nylon membrane (Roche, Germany). It was fixed by
UV cross linking (12,000 Mj/cm2 for 2 min, twice).
The membrane was then hybridized with the common
carp IGFBP-3 Dig-labeled cDNA probe prepared by
PCR (PCR DIG Probe Synthesis Kit, Roche, Ger-
many). The hybridized and detection procedure were
as described in our previous report (Chen et al. 2005).
Signal was captured in Syngene Genenome (Syngene,
England).
Fig. 1 Alignment of amino acid sequences of common carp
IGFBP-3 and other species IGFBP-3 s (Clustalx 1.83). The
identical, highly conserved and less conserved amino acid
residues are indicated by asterisk, colon, dot, respectively. The
first amino acid residue of the predicted mature protein and the
conserved motif sequences (GCGCC 9 9C and CWCV) are
shaded with dark. The nuclear localization sequence was noted
by box. IGFBP-3 amino acid sequences used for analysis are
extracted from GenBank database, and their accession numbers
are: human (Homo sapiens): X64875; bovine (Bos taurus):
M76478; mouse (Mus musculus): X81581; rat (Rattus norvegi-cus): M33300; pig (Sus scrofa): NM001005156; zebrafish
(Danio rerio): NM205751; yellowtail (Seriola quinqueradiata):
ACD11356; Chinook salmon (Oncorhynchus tshawytscha):
AEC33113; channel catfish (Ictalurus punctatus): ACN41860;
common carp (Cyprinus carpio): FJ424519
c
1846 Fish Physiol Biochem (2012) 38:1843–1854
123
Fish Physiol Biochem (2012) 38:1843–1854 1847
123
Statistical analysis
Quantitative data were expressed as mean ± SEM.
Statistical differences were estimated by one-way
ANOVA followed by the Tukey multiple comparison
test; a probability level of 0.05 was used to indicate
significance. All statistics were performed using SPSS
13.0 (SPSS, Chicago, IL, USA).
Results
Cloning and characterization of the common carp
IGFBP-3 cDNA
Using the first-strand cDNA as template synthesized
from the RNA from the common carp liver, and the two
pairs of degenerate primers (ccBP3F1 and ccBP3R1;
ccBP3F2 and ccBP3R2), a cDNA fragment, approxi-
mate 536 bp in length, was amplified by two rounds
PCR. 30-RACE and 50-RACE PCR revealed products of
approximate 900 and 790 bp, respectively. Assembly of
the three cDNA fragments resulted in a 1,680-bp cDNA
of common carp IGFBP-3 (GenBank Accession No.
FJ424519). The common carp IGFBP-3 cDNA con-
tained an ORF of 882 bp, encoding a predicted
polypeptide of 293 amino acid residues, a 198-bp
5-untranslated region (UTR), and a 600 bp 3-UTR
containing the consensus polyadenylation signal AAT
AAA. The predicted polypeptide sequence contained a
putative signal peptide of 25 amino acid residues
resulting in a mature protein of 268 amino acids. The
mature protein had an estimated molecular mass of
29.7 kDa with three putative N-glycosylation sites
(114NPS; 132NDT; 203NFS) (Fig. 1). The overall
sequence identity of the entire protein with six known
human IGFBPs was 27.8 % (IGFBP-1), 27.0 % (IG-
FBP-2), 47.2 % (IGFBP-3), 27.9 % (IGFBP-4), 40.4 %
(IGFBP-5), and 31.2 % (IGFBP-6). The homology
analysis based on the amino acid sequences revealed
that the predicted common carp IGFBP-3 displayed
significant identities to other vertebrates. It showed that
the highest homology of 80.1 % to zebrafish, the
relatively higher identities to salmon (60.4 %), catfish
(62.8 %), and yellowtail (62.9 %), while it had lower
identities to pig (48.5 %), rat (47.4 %), mouse
(45.5 %), bovine (45.7 %), and human (47.2 %).
Like other vertebrate IGFBPs, common carp
IGFBP-3 also had two highly conversed regions: the
cysteine-rich N-terminal domain (18 cysteines) and
the cysteine-rich C-terminal domain (6 cysteines).
Within the N-terminal domain, the motif, GCGC
CXXC, is well conserved in vertebrate IGFBPs,
indicating that it may be important in interaction with
IGFs (Hwa et al. 1999). In common carp IGFBP-3, the
motif was also present and the sequence was
GCGCCMTC. The other conserved motif, CWCV,
was at position 266–269 (Fig. 1).
To ascertain the relationship of common carp
IGFBP-3 gene to those of other vertebrate IGFBP-3s,
Bovine IGFBP3
Pig IGFBP3
Human IGFBP3
Mouse IGFBP3
Rat IGFBP3
Zebrafish IGFBP3
Common carp IGFBP3
Channel catfish IGFBP3
Chinook salmon IGFBP3
Yellowtail IGFBP3
100
98
72
100
99
77100
0.1
Fig. 2 Phylogenetic tree of vertebrates IGFBP3. The full-
length amino acid sequences of various IGFBP3 were extracted
from GenBank and analyzed using the Neighbor-Joining
bootstrap method by MEGA 3.1 with 1,000 bootstrap replicates.
The number shown at each branch indicates the bootstrap values
(%). The common carp IGFBP-3 was noted by triangle
1848 Fish Physiol Biochem (2012) 38:1843–1854
123
we constructed the vertebrate IGFBP-3s phylogenetic
tree (Fig. 2). The results showed that the common carp
IGFBP-3 belongs to the branch of fish and related to
zebrafish IGFBP-3 with 100 % bootstrap value.
Northern blot analysis showed a single faint band of
approximately 1.9 kb with IGFBP-3 probe in the adult
common carp liver total RNA sample (Fig. 3). We
also noticed that the length of the mRNA (1.9 kb)
detected by northern blotting was longer than those of
the composite cDNA sequence (nearly 1.7 kb)
obtained from the RACE PCR. The reason may be
that the cDNA obtained from RACE was not con-
tained fully 3- or 5-UTR sequence.
Tissue distribution of common carp IGFBP-3 gene
To examine the distribution of IGFBP-3 in central
nervous system and the peripheral tissues of adult
common carp, its expression levels were analyzed in
twenty-five dissected tissues by semi-quantitative
RT-PCR. An internal control was achieved by perform-
ing PCR on the same samples with 18S rRNA primers.
Different regions of common carp brain, including
medulla oblongata, pituitary, cerebellum, diencepha-
lon, olfactory bulb, telencephalon, hypothalamus, and
spinal cord, were dissected. As shown in Fig. 4a,
IGFBP-3 mRNA was observed in all regions of brain
with high levels. The higher level was in olfactory
bulb, while the lower level was in pituitary.
IGFBP-3 mRNA was observed in all peripheral
tissues examined (Fig. 4b). High levels were found in
retina, red muscle, liver, heart, posterior intestine, spleen,
and testis. Relatively lower levels were found in white
muscle, kidney, thymus gland, and ovary, while in head
kidney, blood, skin, gill, middle intestine, and anterior
intestine, the IGFBP-3 mRNA levels were much lower.
The RT-PCR analysis of 18S rRNA was performed
and shown in the lower panel of Fig. 4. The levels of
18S rRNA were similar among the different tissues.
No PCR product was detected in the negative control
(PCR without cDNA template).
Expression of IGFBP-3 mRNA during embryonic
and larval development
The presence of IGFBP-3 mRNA during early development
wasexaminedbyreal-timequantitativePCR.And, the results
were presented in Fig. 5. No IGFBP-3 mRNA expression
was detected in the unfertilized eggs and eight-cell stage. Its
mRNA was first observed in the blastula stage with
significantly high level. The level sharply decreased in
Fig. 3 Northern blot
analysis of IGFBP-3 mRNA
in the common carp liver.
15 lg total RNA from an
adult common carp liver was
electrophoresed on a 1 %
agarose gel, transferred onto
a nylon membrane, and
hybridized with DIG-
labeled IGFBP-3 cDNA.
Arrow indicates position of
1.9 kb IGFBP-3 mRNA
Fig. 4 mRNA expression in different tissues of adult common
carp. a RT-PCR analysis of the expression of IGFBP-3 gene in
the common carp central nervous system and pituitary. 18S
rRNA was used as an internal control for the relative
quantification of cDNA in PCR reactions. Double distilled
water was used as negative control. M marker; 1 medulla
oblongata; 2 pituitary; 3 cerebellum; 4 diencephalon; 5 olfactory
bulb; 6 telencephalon; 7 hypothalamus; 8 spinal cord; ncnegative control. b RT-PCR analysis of the expression of
IGFBP-3 gene in the peripheral tissues of adult common carp.
18S rRNA was used as an internal control for the relative
quantification of cDNA in PCR reactions. Double distilled water
was used as negative control. M marker; 1 retina; 2 red muscle; 3white muscle; 4 kidney; 5 thymus gland; 6 ovary; 7 head kidney;
8 liver; 9 blood; 10 heart; 11 skin; 12 gill; 13 posterior intestine;
14 middle intestine; 15 anterior intestine; 16 spleen; 17 testis; ncnegative control
Fish Physiol Biochem (2012) 38:1843–1854 1849
123
gastrula stage, and it became to increase in the following
stages. Other significantly increasing point of IGFBP-3
mRNA level was in blood cycling stage. Subsequently, the
levelof IGFBP-3mRNAdecreased inpre-hatchingstageand
increased in hatching stage and 1-day-post-hatching larvae.
After 1-day-post-hatching, a significant decrease was found
in 10-day-post-hatching larvae, and then a gradually increase
was observed in the following day-post-hatching larvae.
Expression pattern of IGFBP-3 mRNA in gonad
during the reproductive cycle
Interesting, IGFBP-3 mRNA was observed in the ovary
and testis with relatively high level (Fig. 4b). This caused a
question that whether the IGFBP-3 plays an important role
during the reproductive cycle. So, we next examined the
IGFBP-3 gene expression at different gonadal develop-
mental stages with real-time quantitative PCR. As shown
in Fig. 6a, IGFBP-3 mRNA abundance was significantly
decreased at matured stage in ovary. Subsequently, at
regressed stage, the mRNA abundance of IGFBP-3
mRNA remained low in ovary. In contract, IGFBP-3
mRNA abundance did not exhibit a significant change
throughout the reproductive cycle in testis (Fig. 6b).
Discussion
In the present study, we have cloned the full-length
cDNA encoding IGFBP-3 from the common carp liver
0
0.01
0.02
0.03
0.04
0.05
0.06
0.07
0.08
unfer
tilize
d egg
eight-
cell
stage
blastu
la
gastr
ula
body
segm
ent s
tage
optic
vesic
le sta
ge
lens f
ormati
on st
age
heart
-bea
ting s
tage
blood
cycli
ng st
age
pre-h
atchin
g stag
e
hatch
ing st
age
1dph
10dp
h
15dp
h
20dp
h
25dp
h
Rel
ativ
e co
ncen
trat
ion
of I
GFB
P3
Fig. 5 Expression of
IGFBP-3 mRNA during
embryonic and larval
developmental stages of
common carp. mRNA
expression level was
qualified by real-time
quantitative PCR,
respectively. Data were
represented as
mean ± SEM (three
replicates of pooled
embryos). dph day of post-
hatching
Fig. 6 Expression profiles
of IGFBP-3 mRNA in gonad
during the reproductive
cycle. mRNA expression
level was qualified by real-
time quantitative PCR,
respectively. Bars sharing
the same letter are not
significantly different
(n = 6, P \ 0.05)
1850 Fish Physiol Biochem (2012) 38:1843–1854
123
and determined its mRNA expression patterns of
tissue-specific, embryonic, and early developmental
stages and gonadal developmental stages. The com-
mon carp IGFBP-3 cDNA sequence was 1,860 bp
long and had an ORF of 882 bp long encoding a
predicted polypeptide of 293 amino acids. Like other
IGFBP-3 s, common carp IGFBP-3 also had cysteine-
rich N- and C-terminal domains that were highly
conserved among species, and a central domain with
no cysteine residues. Previous study had validated that
the conserved N- and C-terminal domains of IGFBPs
are important and required for IGFs binding (Hwa
et al. 1999; Baxter 2000) and the central region,
L-domain, which amino acid sequence is highly
variable with shared lower similarity, acts structurally
as a hinge between N- and C-terminal domains (Hwa
et al. 1999). However, the L-domain is also the sites of
post-translation modification such as glycosylation
(Firth and Baxter 2002). Although the glycosylation
does not affect IGF binding, it has the potential to
modulating IGF’s cell-binding ability (Firth and
Baxter 1999). In common carp IGFBP-3, there were
three putative N-glycosylation sites. Collectively,
these results indicated that common carp IGFBP-3
may be structurally and functionally conservative like
its mammalian counterpart.
IGFBP-3 has been shown to directly induce apop-
tosis in some cancer cells independently of the IGF–
IGF receptor system (Gill et al. 1997; Rajah et al.
1997; Firth and Baxter. 2002; Hong et al. 2002). One
of possible reasons is that IGFBP-3 can locate in the
nucleus of certain cells via its nuclear localization
sequence (NLS). Nuclear localization of IGFBP-3 has
been demonstrated in a variety of cellular models (Li
et al. 1997; Jaques et al. 1997; Wraight et al. 1998; Liu
et al. 2000). The sequence, 215KKGFYKKKQCRP
SKGRKR232, existing in the human IGFBP-3, has
been considered as the NLS, mediating its nuclear
localization (Radulescu 1994). Liu et al. (2000) had
been validated that nuclear IGFBP-3 could bind the
nuclear retinoid X receptor-a (RXR-a) regulating gene
transcription and cellular apoptosis. It is noteworthy
that common carp IGFBP-3 also contains the consen-
sus sequence of the putative NLS. In common carp
IGFBP-3, this sequence was 221QKGFYKKKQCSP
SKGRRR238, only three amino acid residues differing
from human IGFBP-3. Furthermore, IGFBP-3 had
been shown to adhere to cell surfaces, and this binding
interaction is believed to be mediated through
proteoglycans (Clemmons 1997). It had shown that
proteoglycan binding results in disruption of the IGF/
IGFBP-3/ALS complex (Baxter 1990). After IGFBP-3
binding to cell surfaces, tenfold reduction in IGFBP-3
affinity of IGF-I was occurred, and the adherence
enhanced the stimulating effect of IGF-I (Conover
1992). The reason why IGFBP-3 could adhere to the
cell surfaces was that the 18 amino acids
(221QKGFYKKKQCSPSKGRRR238) also contained
heparin binding domain (HSD), resulting in heparin
and certain other glycosaminoglycans apparently
change the conformation of IGFBP-3 (Arai et al.
1994).
IGFBP-3 is the most abundant IGFBP in serum and
is an important modulator of IGF-I in circulation or
extracellular fluids. More than 90 % of IGF-I in
circulation is associated with IGFBP-3 in mammals.
Previous study had validated that IGF-I expressed in
various tissues and the most abundant was in liver in
common carp (Tse et al. 2002). In this study, common
carp IGFBP-3 mRNA was also expressed in all
examined tissues with different levels. The pattern of
expression in various tissues suggests that common
carp IGFBP-3 is being synthesized locally and may
modulate the local actions of IGFs. However, our
results showed that the expression levels in heart, post-
intestine, spleen, and testis were equal or relatively
higher than that of in liver. Similarly, whole mount in
situ hybridization did not detect the IGFBP-3 mRNA
in the liver in zebrafish embryos and larvae (Li et al.
2005). Unlike IGF-I, the expression pattern of IGFBP-
3 mRNA was slightly different from previous mam-
malian reports. In mammals, IGFBP-3 mRNA was
mainly expressed in liver and endothelium (Booth
et al. 1990). What causes the different IGFBP-3
mRNA expression level in liver between fish and
mammals? In mammals, IGFBP-3 in the liver is
mainly produced by Kupffer cells, but how about in
fish? Which type of cells in liver can produce the
IGFBP-3 in fish? Whether the different liver structure
results in the different tissue expression pattern. The
exact reasons await further investigations.
Significant levels of IGFBP-3 mRNA were found in
all regions of common carp brain and pituitary. These
observations were consistent with previous studies. In
human cerebrospinal fluid, several different IGF-
binding proteins and IGFs have been identified
including IGFBP-3 (Binoux et al. 1991). IGFBP-3
mRNA was also found in brain of tilapia (Chen et al.
Fish Physiol Biochem (2012) 38:1843–1854 1851
123
2004). Previous result suggested that IGFBP-3 may be
synthesized locally by glial cells and neurons and not
derived from plasma by crossing the blood–brain
barrier (Ocrant et al. 1990). Moreover, in rat MtT/S
cells, IGF-I could cause an ultrasensitive reduction in
GH mRNA levels via an extracellular mechanism
involving IGFBPs (Voss et al. 2001). We detected
relatively high level of IGFBP-3 mRNA in pituitary
indicting that IGFBP-3 may be involved in the IGF
feedback regulation pituitary GH mRNA expression.
In spleen and thymus gland, we also detected IGFBP-3
mRNA, implying that it may also play a role in
immune system.
Previous study had reported that IGFBP-3 mRNA
was expressed in embryonic stages in zebrafish (Chen
et al. 2004; Li et al. 2005). In the present study, we
detected the expression of IGFBP-3 mRNA in blastula
and the following embryonic stages. These results
suggest that IGFBP-3 may be involved in the fish early
development. Like in zebrafish (Chen et al. 2004), we
also found that the expression level of IGFBP-3
mRNA was significantly increased at blastula stage.
At blastula stage what resulted in the sharp increase of
IGFBP-3 mRNA expression level and which kind or
kinds of cells were benefited from the increased
IGFBP-3 mRNA were obscure. Additionally, IGF-I
and IGF-II were also detected in the early develop-
ment of common carp (Tse et al. 2002). Together these
results, we supposed that IGFBP-3 may be involved in
the early development through regulating the IGFs
bioavailability.
IGF system is important on the reproduction in
vertebrate animals. As the most abundant IGFBP,
IGFBP-3 protein or mRNA had been detected in
human follicular fluid (Giudice et al. 1990), porcine
ovarian granulosa cells in vivo (Wandji et al. 2000)
and in vitro (Mondschein et al. 1990) and purified rat
Leydig cells (Lin et al.1993). To our interest, in the
present study, IGFBP-3 mRNA was detected in testis
with great abundance, while relatively lower level in
ovary and its mRNA expression level altered in
different stages of gonadal development. Meanwhile,
in zebrafish, the most abundance of IGFBP-3 mRNA
was detected in ovary by real-time PCR (Chen et al.
2004). These results indicate that IGFBP-3 may play
important roles in the common carp gonadal develop-
ment. In ovary, we observed a significant decrease
between the recrudescing stage and the matured stage.
At this period, the level of estradiol was decreased
while 17,20 b-dihydroxy-4-pregnen-3-one (17, 20bP)
was increased. There were only a few studies exam-
ining the effects of sex steroids on IGFBP-3 expres-
sion. 17b-estradiol treatment of ewes down-regulated
expression of IGFBP-3 protein and mRNA in the
endometrium (Peterson et al. 1998). Estradiol could
significantly decreased IGFBP-3 mRNA level in cattle
theca cells (Voge et al. 2004). Furthermore, follicle-
stimulating hormone, a key regulator of follicular
development and steroidogenesis, has been shown up-
regulatory effect on IGFBP-3 mRNA expression level
in porcine and bovine granulose cells (Voge et al.
2004; Ongeri et al. 2004). So, we supposed that the
abundance of IGFBP-3 mRNA was subjected to the
sex steroid hormones correlating with the specific
development stage in different cells. The increased or
decreased IGFBP-3 production would result in a
change of the amount of bioavailable IGFs and thus
influence gonadal growth and development.
In conclusion, we cloned and characterized the full
length of the common carp IGFBP-3 cDNA. Its
expression patterns of tissue-specific, embryonic, and
early developmental stages and gonadal developmen-
tal stages suggest that IGFBP-3 may play important
roles in the reproduction and development by modu-
lating the actions of the local IGF. However, addi-
tional studies focusing on the exact physiological
functions are needed.
Acknowledgments This work was supported by the National
Basic Research Program (973 program, No. 2004CB117402,
2010CB126302), the National Natural Science Foundation of
China (No. 31072194), and the Guangdong Provincial Science
and technology Program (No. 2006B36501006) and the
Fundamental Research Funds for the Central Universities to
Dr. Wensheng Li.
References
Andress DL (1998) Insulin-like growth factor-binding protein-5
(IGFBP-5) stimulates phosphorylation of the IGFBP-5
receptor. Am J Physiol 274:E744–E750
Arai T, Parker A, WJr Busby, Clemmons DR (1994) Heparin,
heparan sulfate, and dermatan sulfate regulate formation of
the insulin-like growth factor-I and insulin-like growth
factor-binding protein complexes. J Biol Chem
269(32):20388–20393
Bauchat JR, Busby WH Jr, Garmong A, Swanson P, Moore J,
Lin M, Duan C (2001) Biochemical and functional analysis
of a conserved IGF-binding protein isolated from rainbow
trout (Oncorhynchus mykiss) hepatoma cells. J Endocrinol
170(3):619–628
1852 Fish Physiol Biochem (2012) 38:1843–1854
123
Baxter RC (1990) Glycosaminoglycans inhibit formation of the
140 kDa insulin-like growth factor-binding protein com-
plex. Biochem J 271(3):773–777
Baxter RC (2000) Insulin-like growth factor (IGF)-binding
proteins: interactions with IGFs and intrinsic bioactivities.
Am J Physiol Endocrinol Metab 278(6):E967–E976
Baxter RC, Martin JL (1989) Binding proteins for the insulin-
like growth factors: structure, regulation and function. Prog
Growth Factor Res 1(1):49–68
Binoux M, Roghani M, Hossenlopp P, Whitechurch O (1991)
Cerebrospinal IGF binding proteins: isolation and charac-
terization. Adv Exp Med Bio 293:161–170
Booth BA, Bar RS, Boes M, Dake BL, Bayne M, Cascieri M
(1990) Intrinsic bioactivity of insulin-like growth factor-
binding proteins from vascular endothelial cells. Endocri-
nology 127(6):2630–2638
Chen JY, Chen JC, Huang WT, Liu CW, Hui CF, Chen TT, Wu
JL (2004) Molecular cloning and tissue-specific, develop-
mental-stage-specific, and hormonal regulation of IGFBP3
gene in zebrafish. Mar Biotechnol (NY) 6(1):1–7
Chen R, Li W, Lin H (2005) cDNA cloning and mRNA expres-
sion of neuropeptide Y in orange spotted grouper, Epi-nephelus coioides. Comp Biochem Physiol B 142(1):79–89
Cheng R, Chang KM, Wu JL (2002) Different temporal expres-
sions of Tilapia (Oreochromis mossambicus) insulin-like
growth factor-I and IGF binding protein-3 after growth
hormone induction. Mar Biotechnol (NY) 4(3):218–225
Clemmons DR (1997) Insulin-like growth factor binding pro-
teins and their role in controlling IGF actions. Cytokine
Growth Factor Rev 8(1):45–62
Conover CA (1992) Potentiation of insulin-like growth factor
(IGF) action by IGF-binding protein-3: studies of under-
lying mechanism. Endocrinology 130(6):3191–3199
Firth SM, Baxter RC (1999) Characterisation of recombinant
glycosylation variants of insulin-like growth factor binding
protein-3. J Endocrinol 160(3):379–387
Firth SM, Baxter RC (2002) Cellular actions of the insulin-like
growth factor binding proteins. Endocr Rev 23(6):824–854
Fukazawa Y, Siharath K, Iguchi T, Bern HA (1995) In vitro
secretion of insulin-like growth factor-binding proteins
from liver of striped bass, Morone saxatilis. Gen Comp
Endocrinol 99(2):239–247
Gill ZP, Perks CM, Newcomb PV, Holly JM (1997) Insulin-like
growth factor-binding protein (IGFBP-3) predisposes
breast cancer cells to programmed cell death in a non-IGF-
dependent manner. J Biol Chem 272(41):25602–25607
Giudice LC, Farrell EM, Pham H, Rosenfeld RG (1990) Iden-
tification of insulin-like growth factor-binding protein-3
(IGFBP-3) and IGFBP-2 in human follicular fluid. J Clin
Endocrinol Metab 71(5):1330–1338
Gracey AY, Troll JV, Somero GN (2001) Hypoxia-induced
gene expression profiling in the euryoxic fish Gillichthysmirabilis. Proc Natl Acad Sci U S A 98(4):1993–1998
Hong J, Zhang G, Dong F, Rechler MM (2002) Insulin-like
growth factor (IGF)-binding protein-3 mutants that do not
bind IGF-I or IGF-II stimulate apoptosis in human prostate
cancer cells. J Biol Chem 277(12):10489–10497
Hwa V, Oh Y, Rosenfeld RG (1999) The insulin-like growth
factor-binding protein (IGFBP) superfamily. Endocr Rev
20(6):761–787
Jaques G, Noll K, Wegmann B, Witten S, Kogan E, Radulescu
RT, Havemann K (1997) Nuclear localization of insulin-
like growth factor binding protein 3 in a lung cancer cell
line. Endocrinology 138(4):1767–1770
Jones JI, Clemmons DR (1995) Insulin-like growth factors and
their binding proteins: biological actions. Endocr Rev
16(1):3–34
Kelley KM, Siharath K, Bern HA (1992) Identification of
insulin-like growth factor-binding proteins in the circula-
tion of four teleost fish species. J Exp Zool 263(2):220–224
Kelley KM, Haigwood JT, Perez M, Galima MM (2001) Serum
insulin-like growth factor binding proteins (IGFBPs) as
markers for anabolic/catabolic condition in fishes. Comp
Biochem Physiol B: Biochem Mol Biol 129:229–236
Li W, Fawcett J, Widmer HR, Fielder PJ, Rabkin R, Keller GA
(1997) Nuclear transport of insulin-like growth factor-I and
insulin-like growth factor binding protein-3 in opossum
kidney cells. Endocrinology 138(4):1763–1766
Li Y, Xiang J, Duan C (2005) Insulin-like growth factor-binding
protein-3 plays an important role in regulating pharyngeal
skeleton and inner ear formation and differentiation. J Biol
Chem 280(5):3613–3620
Lin T, Wang D, Nagpal ML, Shimasaki S, Ling N (1993)
Expression and regulation of insulin-like growth factor-
binding protein-1, -2, -3, and -4 messenger ribonucleic
acids in purified rat Leydig cells and their biological
effects. Endocrinology 132(5):1898–1904
Liu B, Lee HY, Weinzimer SA, Powell DR, Clifford JL, Kurie
JM, Cohen P (2000) Direct functional interactions between
insulin-like growth factor-binding protein-3 and retinoid X
receptor-alpha regulate transcriptional signaling and
apoptosis. J Biol Chem 275(43):33607–33613
Mondschein JS, Smith SA, Hammond JM (1990) Production of
insulin-like growth factor binding proteins (IGFBPs) by
porcine granulosa cells: identification of IGFBP-2 and -3
and regulation by hormones and growth factors. Endocri-
nology 127(5):2298–2306
Ocrant I, Fay CT, Parmelee JT (1990) Characterization of insulin-
like growth factor binding proteins produced in the rat
central nervous system. Endocrinology 127(3):1260–1267
Ongeri EM, Zhu Q, Verderame MF, Hammond JM (2004)
Insulin-like growth factor-binding protein-3 in porcine
ovarian granulosa cells: gene cloning, promoter mapping,
and follicle-stimulating hormone regulation. Endocrinol-
ogy 145(4):1776–1785
Park R, Shepherd BS, Nishioka RS, Grau EG, Bern HA (2000)
Effects of homologous pituitary hormone treatment on
serum insulin-like growth-factor-binding proteins (IG-
FBPs) in hypophysectomized tilapia, Oreochromis mos-sambicus, with special reference to a novel 20-kDa IGFBP.
Gen Comp Endocrinol 117(3):404–412
Pedroso FL, Fukada H, Masumoto T (2009) Molecular char-
acterization, tissue distribution patterns and nutritionalregulation of IGFBP-1, -2, -3 and -5 in yellowtail, Seriolaquinqueradiata. Gen Comp Endocrinol 161(3):344–353
Peterson AJ, Ledgard AM, Hodgkinson SC (1998) Oestrogen
regulation of insulin-like growth factor binding protein-3
(IGFBP-3) and expression of IGFBP-3 messenger RNA in
the ovine endometrium. Reprod Fertil Dev 10(3):241–
247
Fish Physiol Biochem (2012) 38:1843–1854 1853
123
Radulescu RT (1994) Nuclear localization signal in insulin-like
growth factor-binding protein type 3. Trends Biochem Sci
19(7):278
Rajah R, Valentinis B, Cohen P (1997) Insulin-like growth
factor (IGF)-binding protein-3 induces apoptosis and
mediates the effects of transforming growth factor-beta1
on programmed cell death through a p53- and IGF-inde-
pendent mechanism. J Biol Chem 272(18):12181–12188
Schedlich LJ, Le Page SL, Firth SM, Briggs LJ, Jans DA, Baxter
RC (2000) Nuclear import of insulin-like growth factor-
binding protein-3 and -5 is mediated by the importin beta
subunit. J Biol Chem 275(31):23462–23670
Siharath K, Kelley KM, Bern HA (1996) A low-molecular-
weight (25-kDa) IGF-binding protein is increased with
growth inhibition in the fasting striped bass, Moronesaxatilis. Gen Comp Endocrinol 102(3):307–316
Tse MC, Vong QP, Cheng CH, Chan KM (2002) PCR-cloning
and gene expression studies in common carp (Cyprinuscarpio) insulin-like growth factor-II. Biochim Biophys
Acta 1575(1–3):63–74
Voge JL, Santiago CA, Aad PY, Goad DW, Malayer JR, Spicer
LJ (2004) Quantification of insulin-like growth factor
binding protein mRNA using real-time PCR in bovine
granulosa and theca cells: effect of estradiol, insulin, and
gonadotropins. Domest Anim Endocrinol 26(3):241–258
Voss TC, Flynn MP, Hurley DL (2001) IGF-I causes an ultra-
sensitive reduction in GH mRNA levels via an extracellular
mechanism involving IGF binding proteins. Mol Endocri-
nol 15(9):1549–1558
Wandji SA, Gadsby JE, Simmen FA, Barber JA, Hammond JM
(2000) Porcine ovarian cells express messenger ribonucleic
acids for the acid-labile subunit and insulin-like growth
factor binding protein-3 during follicular and luteal phases
of the estrous cycle. Endocrinology 141(7):2638–2647
Wraight CJ, Liepe IJ, White PJ, Hibbs AR, Werther GA (1998)
Intranuclear localization of insulin-like growth factor
binding protein-3(IGFBP-3) during cell division in human
keratinocytes. J Invest Dermatol 111(2):239–242
Ye X, Zhang L, Dong H, Tian Y, Lao H, Bai J, Yu L (2010)
Validation of reference genes of grass carp Ctenophar-yngodon idellus for the normalization of quantitative real-
time PCR. Biotechnol Lett 32(8):1031–1038
1854 Fish Physiol Biochem (2012) 38:1843–1854
123