MOLECULAR CHARACTERIZATION OF NEWCASTLE DISEASE VIRUS ISOLATES

A Thesis

Submitted to Bangladesh Agricultural University, Mymensingh

In partial Fulfillment of the Requirements for the Degree of

Master of Science in

Pathology

By

Mohammed Nooruzzaman

Roll No.: 10Vet Path JJ 09 M Registration No.: 31009, Session: 2004-05

Department of Pathology

Bangladesh Agricultural University Mymensingh

May, 2011

MOLECULAR CHARACTERIZATION OF NEWCASTLE DISEASE VIRUS ISOLATES

A Thesis

Submitted to Bangladesh Agricultural University, Mymensingh

In partial Fulfillment of the Requirements for the Degree of

Master of Science in

Pathology

By

Mohammed Nooruzzaman

Approved as to style and contents by

Prof. Dr. Emdadul Haque Chowdhury Prof. Dr. Md. Rafiqul Islam Co-Supervisor Supervisor

Prof. Dr. Md. Rafiqul Islam Chairman, BOS & Head Department of Pathology

May, 2011

DEDICATED TO MY BELOVED PARENTS AND ALL OF MY TEACHERS

iii  

ACKNOWLEDGEMENTS

I am very grateful to the Almighty Allah without His grace I would have never been able to pursue my research work and to prepare this manuscript.

It is difficult to overstate my gratitude to my research supervisor, Professor Dr. Md. Rafiqul Islam, Head, Department of Pathology, Bangladesh Agricultural University, Mymensingh because his enthusiasm, his inspiration, and his great efforts to explain things clearly and simply, he helped me to make this research possible. Throughout my thesis-writing period, he provided me encouragement, sound advice, good teaching, good company, and lots of good ideas.

I would like to express my deepest gratitude to my research co-supervisor, Professor Dr. Emdadul Haque Chowdhury, for his excellent guidance, caring, patience, and providing with an excellent atmosphere for doing research.

I am greatly indebted to all my teachers and colleagues Prof. Dr. Md. Iqbal Hossain, Prof. Dr. Md. Abdul Baki, Prof. Priya Mohan Das, Prof. Dr. A.S.M. Bari, Prof. Dr. Md. Mokbul Hossain, Prof. Dr. Md. Habibur Rahman, Prof. Dr. Abu Hadi Noor Ali Khan, Assistant Professor Dr. Roksana Parvin, Lecturer Dr. Jahan Ara Begum, and Dr. Munmun Pervin, Department of Pathology, Bangladesh Agricultural University, Mymensingh, for their contributions and supports throughout my academic career.

I am grateful to Dr. Enamul Haque, Dr. Mushfiqur Rahman, Dr. Abu Sufian, Dr. Ataur Rahman, Dr. Shamim, Dr. Jakir Dr. Reema Dr. Tulu and other PhD students, Department of Pathology, for their guidance and encouragement during my research period.

I would like to acknowledge and extend my heartfelt gratitude to my friends Urmi, Tusar, Rajib, Fauzia, Wakadur, Arun, MS students, Department of Pathology, Bangladesh Agricultural University, Mymensingh for their cooperation during my research period.

Lastly, and most importantly, I wish to thank my beloved parents, brothers and sisters as they raised me, supported me, taught me, and loved me.

The Author

June, 2011

iv 

 

LIST OF CONTENTS PAGE

ACKNOWLEDGEMENT iii

ABBREVIATION viii

ABSTRACT x

CHAPTER I INTRODUCTION 1-2

CHAPTER II REVIEW OF LITERATURE 3-24

2.1 Newcastle disease 3

2.1.1 History 3

2.1.2 Epidemiology 3

2.1.3 Clinical signs and pathology 6

2.2 Newcastle disease virus 9

2.2.1 Taxonomy and physic-chemical properties 9

2.2.2 Biological properties 10

2.2.3 Structure and molecular biology 10

2.3 Virus isolation and characterization 11

2.3.1 Virus isolation and identification 11

2.3.2 Antigenic, pathogenic and molecular characterization

12

2.4 Vaccination 23

CHAPTER III MATERIALS AND METHODS 25-33

3.1 Materials 25

3.1.1 Equipment 25

3.1.2 Plasticware and other consumable 25

3.1.3 Software 25

3.1.4 Virus isolates 25

3.1.5 Primers 26

3.1.6 DNA size marker 26

3.1.7 Kits 27

3.1.8 Solution, buffer and chemicals 27

3.1.8.1 Electrophoresis buffers and reagents 27

3.1.8.2 Cycle sequencing chemicals 27

3.2 Methods 28

3.2.1 Cleaning and sterilization 28

v 

 

LIST OF CONTENTS (Contd.) PAGE

3.2.2 Molecular detection 28

3.2.2.1 Viral RNA extraction 28

3.2.2.2 RT-PCR 29

3.2.2.3 Analysis of PCR products by Agarose gel electrophoresis

30

3.2.3 Molecular characterization 30

3.2.3.1 Purification of PCR products 30

3.2.3.2 Quantification of DNA 31

3.2.3.3 Gene sequencing 31

3.2.3.4 Analysis of nucleotide and deduced amino acid sequences

31

3.2.3.5 Phylogenetic analysis 32

CHAPTER IV RESULTS 34-42

4.1 RT-PCR 34

4.2 Nucleotide sequencing and blast search 34

4.3 Multiple alignment of nucleotide sequences and phylogenetic analysis

36

4.4 Alignment of predicted amino acid sequences 39

4.5 Analysis of the fusion protein cleavage site 41

CHAPTER V DISCUSSION AND CONCLUSION 43-45

REFERENCES 46-69  

 

 

 

 

 

 

 

 

vi 

 

LIST OF TABLES

TABLES PAGE

1 Primers and probes used in Newcastle disease virus detection and differentiation

14

2 Primers used in this study 26

3 The sequences of NDV isolates used in this study 32

4 Results of nucleotide blast search for BD-C162/10 sequence similarity in the GenBank 35

5 Results of nucleotide blast search for BD-P01/10 sequence similarity in the GenBank 35

6 Nucleotide sequence distance in the F gene (nt 1-354 of the coding region) among different genotypes of Newcastle disease viruses

37

7 Nucleotide sequence distance in the F gene (nt 1-354 of the coding region) among different sub-genotypes under the NDV genotype VII

38

8 NDV isolates analyzed in this study showing fusion protein cleavage site 42

vii 

 

LIST OF FIGURES

FIGURES PAGE

1 DNA size marker (100 bp) 26

2 Amplification of F gene fragment (766 bp) by RT-PCR. 34

3 Phylogenetic relationship of the Bangladeshi isolates of NDV with the strains belonging to different genotypes

36

4 Phylogenetic relationship of the Bangladeshi isolates of NDV with the strains belonging to VII sub-genotypes

38

5 Amino acid residue substitution of F gene for NDV strains of different genotypes

40

6 Amino acid residue substitution of F gene for different NDV strains of subgenotype VII (VIIa-VIIe)

41

viii 

 

LIST OF ABBREVIATIONS AND SYMBOLS

APMV Avian Paramyxovirus

BBS Bangladesh Bureau of Statistics

bp Base pair

CNS Central Nervous System

DNA Deoxyribonucleic acid

et al. And others

F Fusion

Fig. Figure

gm Gram

HA Hemagglutination

HI Hemagglutination Inhibition

HN Hemagglutinin-Neuraminidase

ICDDR, B International Centre for Diarrheal Disease Research, Bangladesh

ICPI Intracerebral Pathogenicity Index

IVPI Intravenous Pathogenicity Index

kbp Kilobase pair

MDT Mean Death Time

min Minute

ml Milliliter

MS Master of Science

ix 

 

ND Newcastle disease

NDV Newcastle disease virus

nm Nanometer

nt Nucleotide

OIE Office des International Epizootic

PCR Polymerase chain reaction

pmol picomole

RBC Red blood corpuscle

RNA Ribonucleic acid

rpm Rotation per minute

RRT-PCR Real-time reverse transcription-polymerase chain reaction

RT-PCR Reverse transcription-polymerase chain reaction

sec Second

SPF Specific pathogen free

TAE Tris Acetate EDTA

UV Ultra-Violate

% Percent

µg Microgram

µl Microliter

µM Micromole

ºC Degree Celsius

x 

 

ABSTRACT Newcastle disease is a highly contagious avian viral disease caused by avian

paramyxovirus type-1. The objective of the study was to adopt a reverse-transcription

polymerase chain reaction (RT-PCR) for rapid detection and identification of Newcastle

disease virus (NDV) and molecular characterization of local NDV isolates. The RT-PCR

successfully amplified a 766 bp fragment covering a part of the matrix (M) protein and

fusion (F) protein genes from all five recent local field samples and a reference vaccine

virus. The nucleotide sequences of the RT-PCR product of a chicken and a pigeon isolate

were determined. The first 354bp of the coding region of the F gene and their deduced

amino acid sequences (residue 1-118) were compared with that of other NDV strains

retrieved from GenBank. Phylogenetic analysis showed that the chicken and pigeon

isolates belong to genotypes VIIb and genotype VI, respectively. Analysis of the deduced

amino acid sequence at F0 cleavage site revealed that both the isolates possess 112RRQKRF117 sequence indicative of velogenic pathotype. Future studies should focus on

in vitro and in vivo pathogenic and antigenic characterization of the Bangladeshi isolates.

 

1 

 

CHAPTER I

INTRODUCTION

Livestock and poultry is an important sector in the economy of Bangladesh. Commercial

poultry farming has been growing during the last two decades and has now become one of the

most important agri-business in Bangladesh (Islam et al., 2008). The poultry in Bangladesh

includes mainly chickens, ducks and pigeons, which are kept in different production systems.

At present there are about 112.43 million chickens and 42.29 million ducks in our country

(BBS, 2009). There are about 21,712 layer farms and 40,323 broiler farms in Bangladesh

(DLS, 2008) and the investment in this sector is increasing day by day. The development of

poultry sector is seriously hampered by some infectious and non-infectious diseases.

Newcastle disease (ND), popularly known as Ranikhet disease, is one of the important

diseases affecting the commercial as well as backyard poultry worldwide causing significant

economic losses. ND is endemic in Bangladesh claiming significant mortality (Chowdhury et

al., 1982; Saha et al., 1998; Talha et al., 2001; Kafi et al., 2003; Barman et al., 2010).

Newcastle disease virus (NDV), also called Avian Paramyxovirus type 1 (APMV1), is an

enveloped, negative sense single-stranded RNA virus containing a genome of approximately

15 kb (Lamb and Kolakofsky, 1996). It affects almost all species of birds causing a highly

contagious and rapidly spreading disease with high morbidity and mortality and severe drop

in egg production. Signs of the disease usually vary in severity and lethality, but usually

include respiratory distress, diarrhea, circulatory disturbances and central nervous system

impairment (Alexander, 1997). ND has been classified as list-A disease by the World Animal

Health Organization (OIE) (Seal et al., 1995; Pedersen et al., 2004). Although numerous live

and inactivated vaccines have been developed to control the disease, the incidences of ND

outbreaks in commercial poultry have gradually increased since the 1990s (Alexander et al.,

1999).

For confirmation of ND, the OIE prescribes isolation of NDV in embryonated chicken eggs

and their identification using haemagglutination (HA) and hemagglutination inhibition (HI)

test with a NDV-monospecific antiserum (OIE, 2009). Reverse transcription-polymerase

2 

 

chain reaction (RT-PCR) has been established to identify NDV (Jestin and Jestin, 1991;

Stäuber et al., 1995; Oberdörfer and Werner, 1996; Kant et al., 1997; Kou et al., 1999; Kho et

al., 2000, Gohm et al., 2000; Zhang et al., 2010).

The amino acid sequence at fusion protein cleavage site has been postulated as a major

determinant of NDV virulence (Millar et al., 1988). The virulent type of NDV has multiple

basic amino acid residues at F protein cleavage site which can be recognized by ubiquitous

host proteases (Seal et al., 1995; Marin et al., 1996; Gould et al., 2003).

The NDVs currently circulating worldwide exhibit multiple lineages (Alexander, 1988;

Chambers et al., 1986; Toyoda et al., 1987; Glickman et al., 1988; Millar et al., 1988; Yang et

al., 1999). Restriction fragment length polymorphism analysis and partial nucleotide sequence

of fusion gene reveal that NDV strains can be classified into ten genotypes (I to X), with

genotypes VI and VII being further divided into several subgenotypes (Ballagi-Pordany et al.,

1996; Lomniczi et al., 1998; Herczeg et al., 1999; Kwon et al., 2003 and Tsai et al., 2004).

Nothing is known about the genetic properties of NDVs circulating in Bangladesh.

In this context the present study was conducted with the following objectives:

1. Molecular detection of Newcastle disease virus by RT-PCR.

2. Molecular characterization of selected Bangladeshi isolates of Newcastle disease virus

based on analysis of the fusion protein gene sequence.

 

3  

CHAPTER II

REVIEW OF LITERATURE

Newcastle disease (ND) is a viral disease of birds with wide range of clinical signs from

mild to severe. It has a worldwide distribution. Outbreaks of ND have a tremendous

impact on backyard and commercial poultry in developing countries, where this disease is

endemic. The disease is characterized by either gastrointestinal or respiratory or nervous

signs. Available literatures on ND are reviewed in this chapter.

2.1 Newcastle Disease

2.1.1 History

Newcastle disease is one of the most serious infectious diseases affecting birds,

particularly poultry, worldwide and has been the cause of serious economic losses

(Alexander, 1988; Aldous et al., 2003). Newcastle disease was the name given by Doyle to

a highly contagious viral infection of poultry, also known as fowl pest, which was first

reported on a farm near Newcastle upon Tyne, UK, in 1926 (Doyle, 1927). In India, an

outbreak of this disease as a new fowl disease was first recorded by Edwards (Edwards,

1928) in 1927 in the poultry farm at Ranikhet. Cooper worked on the disease (in

Mukteswar Laboratory, Kumaun) and confirmed that the causative agent was a filter

passing virus which was immunologically identical to Newcastle disease virus of England

and other countries (Cooper, 1931). He named the disease as “Ranikhet disease”. In the

USA, Newcastle disease was first identified in California by Beach (Beach, 1942) which

was known as pneumoencephalitis.

The causative agent of the disease in Newcaslte upon Tyne was identified as a virus that

was distinct from fowl plague (avian influenza virus), although the symptoms had some

similarity. Newly emerged ND then rapidly spread throughout the world (Emmerson,

1999; Csatary et al., 2000; Lorence et al., 2001).

2.1.2 Epidemiology

The distribution of ND is dependent on the attempts at eradication and control made in

different countries. Vaccination of poultry throughout the world makes assessment of the

geographical distribution of Newcastle disease difficult. Non pathogenic strains are found

in New Zealand, Papua New Guinea, Fiji and a number of pacific countries but they are

4  

free from virulent strains (OIE, 2000). In 2002 outbreaks occurred in Australia and later

on Japan. ND is endemic in Bangladesh (Saha et al., 1998).

Velogenic Newcastle disease virus (NDV) or avian paramyxovirus 1 (APMV-1) is

endemic in Asia, the Middle East, Africa, Central and South America, and parts of

Mexico. Virulent strains are endemic in wild cormorants in the U.S. and Canada, but

commercial poultry are free of velogenic isolates. Lentogenic isolates are found in poultry

throughout the world, including the U.S. Mesogenic strains may also be found, but are less

common (OIE, 2009).

Newcastle disease virus has been isolated from a variety of species of free-living and

domestic birds. It is known to infect more than 250 species of birds in 27 orders; other

avian species may also be susceptible. Chickens are highly susceptible to NDV while

turkeys, pheasants, partridges, quail and guinea fowl are also variably susceptible (OIE

2009). Duck and geese are susceptible but severe disease is rare. Lee et al. (2009) reported

that lentogenic viruses from domestic or wild ducks have a potential to acquire virulence

by duck-to-chicken transmission in nature. Several outbreaks with neurologic signs of

NDV have been reported in pigeon (Tangredi, 1985; Barton et al., 1992). Some wild or

zoo birds like penguins, crows, sparrows, jungle fowls, kites and vultures can suffer and

spread the disease to poultry farms (Chauhan and Roy, 1996). Susceptibility to disease

varies widely in psittacine birds but they tend to carry velogenic species sub-clinically

(Roy et al., 1998). Outbreaks have been reported in ostriches (Jørgensen et al., 1998).

Wild bird species, especially aquatic birds, are considered to be more resistant to the

disease (Erickson et al., 1977 and Kaleta and Baldauf, 1998). However, several outbreaks

of ND with high mortality in Cormorants have been reported in Canada and United States

(Meteyer et al., 1997; Glaser et al., 1999; Kuiken et al., 1999).

NDV is a human pathogen. Reported infections have been non-life threatening and usually

persisting not more than a day or two (Chang, 1981). The most frequently reported and

best substantiated clinical signs in human infections have been eye infections, usually

consisting of unilateral or bilateral reddening, excessive lachrymation, edema of the

eyelids, conjunctivitis and sub-conjunctival hemorrhage. There is evidence that both

vaccinal and virulent (for poultry) strains of NDV may infect and cause clinical signs in

human. There is no evidence of human-to-human spread.

5  

Newcastle disease virus is tumor selective and intrinsically oncolytic. Genetically

modified, recombinant NDV strains are cytotoxic to human tumor cell lines of ecto-, endo-

and mesodermal origin. Cytotoxicity against tumor cells is due to multiple caspase-

dependent pathways of apoptosis independent of interferon signaling competence. So, the

recombinant NDV could be developed as a cancer virotherapy agent, either alone or in

combination with therapeutic transgenes (Elankumaran et al., 2006).

The main routes of spread of NDV are respiratory and gastrointestinal tract. Ingestion of

feces is likely to be the main method of bird-to-bird spread for avirulent enteric NDV and

pigeon isolates (Alexander et al., 1984). Clothing, hair and footgear of people and

equipment such as crates, egg flats, feed sacks and vehicles undoubtedly act mechanical

vectors. In this way, vaccinating crews contributed to the spread of velogenic,

viscerotropic ND in California (Utterback and Schwartz, 1973). However virus survival in

the nature is important which is influenced by humidity, temperature, suspending agent

and exposure to light. As a result NDV may survive in contaminated uncleaned poultry

houses for up to 7 days in summer, as long as 14 days in spring and 30 days in winter (OIE

2009).

Live infected chickens are the most likely means of introduction of NDV into village

populations, and the live bird markets are probably the major source of infection

(Alexander 1988b; Martin, 1992; Nguyen, 1992). In many developing countries, farmers

may slaughter or try to sell their chickens when they show signs of disease.

Egg associated transmission of highly virulent isolates in chicken has been reported

(Lancaster and Alexander, 1975; Beard and Hanson, 1984) but this generally results in

death of the embryo before hatching. However, infected embryo may be hatched from

eggs infected with vaccinal or other lentogenic viruses that do not essentially cause the

death of embryo (French et al., 1967).

Introduction of Newcastle disease virus (NDV) into poultry from wild birds has been

documented extensively. Specially, the waterfowl is considered to be a natural reservoir of

potentially infectious agents and a source of pathogenic APMV1 (Alexander et al., 1992;

Collins et al., 1993; Gould et al., 2001). Other common reservoirs include Cormorant,

Shags, Psittacine, Pheasant, Guinea fowl, ostriches and emues (Blaxland, 1951; Seal,

1996; Jorgensen et al., 1998).

6  

2.1.3 Clinical signs and pathology

The incubation period of ND after natural exposure has been reported to vary from 2-15

days or longer, with an average of 5-6 days. Clinical signs seen in birds infected with

NDV vary widely and are dependent on factors such as, the virus or pathotype, host

species, age of host, co-infection with other organisms, environmental stress and immune

status (Alexander, 2003; Farkas et al., 2009). Infection with NDV displays a complete

continuum from very rapid fatal disease to inapparent infection.

Initial clinical signs vary but include lethargy, inappetence, ruffled feathers, edema and

infection of conjunctiva. As the disease progresses birds may develop greenish or white

watery diarrhea, dyspnea and inflammation of the head and neck often with cyanotic

discoloration. In later stages of the disease neurologic signs may be manifested as tremors,

twisting, tonic or clonic spasms, wing or leg paresis or paralysis, torticollis and

occasionally aberrant circling (Okoye et al., 2000; Usman and Diarra, 2008; Barman et al.,

2010). Sharp drop in egg production are observed; eggs contain a watery albumin and

appear misshapen with abnormally colored, rough or thin shells. Birds that survive serious

infection may develop neurologic abnormalities and partial or complete cessation of egg

production (Alexander, 2003; OIE, 2009).

The clinical features in pigeons include nervous signs, diarrhea, periocular edema and

bilateral conjuctivitis. Walking on its hock, head tremors, drowsiness, incoordination,

torticollis and green, watery diarrhoea are common signs in pigeon (Kommers et al., 2002;

Abolink et al., 2008). However, clinical signs are less severe in turkey (Box et al., 1970).

In quail, loss of appetite, weakness and decrease in egg production, diarrhea and nervous

symptoms were the main clinical signs (Momayez et al., 2007).

Strains of NDV have been grouped into five pathotypes on the basis of the clinical signs

seen in infected chickens (Beard and Hanson, 1984). These are:

1. Viscerotropic velogenic: a highly pathogenic form in which hemorrhagic intestinal

lesions are frequently seen;

2. Neurotropic velogenic: a form that presents with high mortality, usually following

respiratory and nervous signs;

3. Mesogenic: a form that presents with respiratory signs, occasional nervous signs,

but low mortality;

7  

4. Lentogenic or respiratory: a form that presents with mild or subclinical respiratory

infection;

5. Asymptomatic enteric: a form that usually consists of a subclinical enteric

infection.

Pathotype groupings are rarely clear-cut (Alexander and Allan, 1974) and even in

infections of specific pathogen free (SPF) birds, considerable overlapping may be seen. In

addition, exacerbation of the clinical signs induced by the milder strains may occur when

infections by other organisms are superimposed or when adverse environmental conditions

are present.

NDV has an affinity for erythrocytes allowing the virus to be widely distributed

throughout the host body. An increase of the number of various leukocyte subsets was

noticed in the respiratory tract and the Harderian gland, which favors the involvement of

the local cellular immunity in the defense against NDV infection (Kommers et al., 2002).

T-lymphocytes and macrophages may be involved to produce a range of cytokines with

antiviral activity and cytokines that stimulate B-lymphocyte to proliferate and differentiate

into antibody producing plasma cells (Al-Garib et al., 2003). Brown et al. (1999) found

that velogenic viscerotropic pathotypes of NDV caused acute systemic illness with

extensive necrosis of lymphoid areas in the spleen and intestine. Velogenic neurotropic

isolates caused central nervous system disease despite minimal amounts of viral nucleic

acid detected in neural tissue. Mesogenic and lentogenic pathotypes caused no overt

disease; however, viral nucleic acid was present in myocardium and air sac epithelium

following infection with these isolates. Compromise of air sac and myocardium may

predispose mesogenic and lentogenic infected chickens to secondary infection and/or

decreased meat and egg production. However, Lam and Vasconcelos (1994) reported that

NDV in addition to causing necrosis in chicken lymphocytes can induce apoptosis. In

birds with antibody, virus was most frequently isolated from proventriculus, caecal tonsil,

bursa and brain. In immune birds, although clinical signs are mild or absent, widespread

virus replication occur up to 19 day post challenge (Parede and Young, 1990).

The gross lesions and organs infected with NDV are dependent on strain and pathotype of

infecting virus, however significant gross lesions are usually found only in birds infected

with velogenic strains. Affected birds typically have hemorrhage in larynx, trachea, heart

and stomach (Jungherr, 1964; Wan et al., 1984). Although there is no pathognomonic

8  

lesions but hemorrhage in proventriculus and caecal tonsil, button ulcers in intestine are

typical (Crawford, 1930; Jungherr, 1964; Mishra et al., 2000; Okoye et al., 2000).

Hemorrhage in the intestine of infected chickens has been used to distinguish velogenic

viscerotropic ND virus from non-velogenic ND virus (Hanson et al., 1973).

Generally, gross lesions are not observed in CNS of birds infected with NDV, regardless

of pathotype (McFerran et al., 1988). Air sacculitis may be present even after infection

with relatively mild strains and thickening of air sacs with catarrhal or caseous discharge

and congestion of lung is often observed (Beard and Hanson, 1984). There are also

lymphoid depletion and degeneration in the bursa of Fabricius, spleen and other lymphoid

organs (Mishra et al., 2000). Chickens and turkeys infected with velogenic virus in lay

show egg yolk in abdomen with flaccid, degenerated follicle as well as hemorrhage and

discoloration of reproductive tract. Similar lesions have been reported in geese, pheasant

and other species infected with virulent strains (OIE, 2009).

In pigeons, haemorrhages and congestion were observed in trachea, lungs, liver,

proventriculus and intestine after infection with NDV (Mushtaq et al., 2006). In quail,

hemorrhagic lesions of the intestinal tracts and proventriculus were found on gross

pathological investigations (Momayez et al., 2007).

The histopathology of NDV infection can be greatly affected by the phenomena as for

clinical signs and gross lesion. Congestion and hemorrhages in lung, trachea and

peritracheal tissues are found. There was rapid and progressive lymphoproliferative

hyperplasia in the gastrointestinal tract (Hamid et al., 1990), congested blood vessels,

hemorrhages and extensive hemosiderin pigment deposition in the lamina propria of

proventiculus and intestine (Kommers et al., 2002; Noor et al., 2005), extensive

degeneration, necrosis, and depletion of acinar cells in the pancreas. In liver hepatocytic

necrosis with thrombi in the sinusoids (Okoye et al., 2000) and generalized congestion was

found (Noor et al., 2005). There may be degenerative lesions in kidneys, myocardium and

liver. Necrosis, infiltration of heterophils and lymphoid cells, hyperblastic changes are

also observed in other organs (Jungherr and Terrell, 1946). Multifocal necrosis with

deposition of fibrin and apoptotic cell in spleen was observed by Kommers et al. (2002).

Intranuclear inclusions can be found in reticular cells of spleen and other organs (Dekock,

1954).

9  

Brain showed the most remarkable histological findings. There may be non-purulent

suppurative encephalomyelitis, neuronal necrosis, gliosis, perivascular cuffing and

endothelial hyperplasia in cerebellum, cerebrum and other parts of central nervous systems

(Okoye et al., 2000; Noor et al., 2005; Nakamura et al., 2008; Adi et al., 2010).

2.2 Newcastle disease virus

Newcastle disease is caused by viruses in the serotype avian paramyxovirus type-1

(APMV-1). It was classified as list-A disease by the World Animal Health Organization

(OIE) (Seal et al., 1995; Pedersen et al., 2004).

2.2.1 Taxonomy and physico-chemical properties

Newcastle disease virus (NDV) is the sole member of APMV-1, and is classified in the

Avulavirus genus of the family Paramyxoviridae within the order Mononegavirales (Mayo

et al., 2002).

Virions are enveloped and this is derived from the modified cell membrane as the virus is

budded from the cell surface after capsid assembly in the cytoplasm (Melnick, 1982).

Virions are generally pleomorphic, rounded and 100 to 500 nm in diameter, having helical

capsid symmetry. The virion surface is covered with 8 nm projections (so-called “herring

bone” nucleocapsids) that may be released from disrupted particles (Alexander, 1997).

The infectivity of NDV may be destroyed by physical and chemical treatments such as

heat, radiation (including light and ultraviolet rays), oxidation process, pH effects and

various chemical compounds. The rate at which infectivity is destroyed depends on the

strain of virus, the length of time of exposure, the quantity of virus and the nature of

suspending medium and interaction between treatments. Doyle (1927) reported that the

effect of marked acidity and alkalinity on the NDV infectivity indicate greater resistance

to the H ion than the OH ions. The radiation inactivation of NDV infectivity at low

temperature was due to nucleic acid degeneration and at higher temperature to protein

denaturation (Digioia et al., 1970).

10  

2.2.2 Biological properties

Several biologic activities are associated with paramyxovirus, which characterize the

group.

The ability of NDV to agglutinate red blood cells (RBCs) is due to binding of the

hemagglutinin-neuraminidase (HN) protein to receptors on the surface of RBCs. This

property and the specific inhibition of agglutination by antisera (Burnet, 1942; Beach,

1948) have been proven as powerful tools in the diagnosis of the disease. Chicken RBCs

are usually used in hemagglutination tests, but NDV will cause agglutination of all

amphibian, reptilian, and avian cells (Lancaster, 1966). Winslow et al. (1950) showed that

human, mouse and guinea pig RBCs were agglutinated by all NDV strains tested but the

ability to agglutinate cattle, goat, sheep, swine and horse cells varied with the strain of

NDV.

The enzyme neuraminidase (mucopolysaccharide N-acetyl neuraminyl hydrolase) is also a

part of HN molecule. This enzyme is responsible for the gradual elution of agglutinated

RBCs (Ackerman, 1964). NDV isolates can be broadly grouping as rapid or slow eluters

(Spalatin et al., 1970) based on the rate of elution of chicken RBCs. However, rapid

elutions occur in velogenic strain and slow in lentogenic strains (Asahara, 1978; Islam et

al., 1995).

2.2.3 Structure and Molecular biology

The genome of NDV is a single stranded negative-sense RNA consisting of 15,186

nucleotides (Krishnamurthy et al., 1997). The genome of NDV encodes for six structural

proteins. Three of them, the hemagglutinin-neuraminidase (HN), the fusion (F), and the

matrix (M) proteins, are related to the viral envelope. The remaining three proteins,

nucleoprotein (NP), the phosphoprotein (P), and the RNA polymerase (L), are related to

the genomic RNA (Chambers et al., 1986). The nucleocapsid protein (N) is responsible for

the protection of RNA from nuclear damage and the Phosphoprotein binds to the N and L

protein and forms part of the RNA polymerase complex. The matrix protein organizes and

maintains virion structure and the large protein is the catalytic subunit of RNA dependent

RNA polymerase. The HN glycoprotein is involved in attachment and release of virus and

the F glycoprotein mediates fusion of the viral envelope with cellular membranes. NDV

11  

produces two additional proteins, V and W, from P gene by alternative mRNAs that are

generated by RNA editing (McGinnes et al., 1988; Samson et al., 1991; Jordan et al.,

2000). In NDV, insertion of one non-template G residue gives rise to a V encoding

mRNA, while insertion of two non template G residues generate a W encoding mRNA.

These V and W protein share their amino (N) terminal domains with P protein and vary in

their carboxy (C) termini. NDV V protein has a cysteine rich C terminal domain which

binds two atoms of Zn2+ (Steward et al., 1995). Of the three NDV P gene products the P

protein together with L protein, is known to form part of the virus RNA polymerase

complex (Lamb and Kolakofsky, 2001).

Coexpression of homologus attachment protein, hemagglutinin-neuraminidase (HN) is

required along with protease cleavage of precursor fusion protein for the activation of

NDV (Garten et al., 1980; Kathryn and Turdy, 2003). The efficiency of cleavage of fusion

protein plays an important role in the pathogenicity of NDV (Panda et al., 2004). Park et

al. (2003) stated that V protein affects the host range of the virus via its species-specific

IFN antagonist activity.

2.3 Virus Isolation and Characterization

2.3.1 Virus Isolation and identification

For confirmation of ND, the OIE standards Commission prescribes NDV isolation in

embryonated chicken eggs, and identification using hemagglutination (HA) and

hemagglutination inhibition (HI) test with a NDV-monospecific antiserum (OIE, 2009).

Other indirect methods like enzyme-linked immunosorbent assays (ELISA), virus culture,

virus (plaque) neutralization (VN), complement fixation (CFT) can be used.

Direct methods include virus isolation, electron microscopy and virus characterization.

Samples from dead birds should consist of oro-nasal swabs, as well as sample collected

from lungs, air sac, intestine (including contents), spleen, brain, liver and heart tissues

collected separately or as a pool and placed in phosphate buffer isotonic saline (7.0-7.4

containing antibiotic) (Alexander, 2000).

Although conventional diagnosis has proven adequate for the control of ND in the past, it

does present some problems. A reliable source of eggs and chickens, which should

preferably be from a specific pathogen free flock, is needed. Confirmed diagnosis may be

12  

slow, taking several days to isolate the virus and carry out the pathogenicity test. It

assumes viruses always show their potential pathogenicity for chickens, which does not

always appear to be the case (Collins et al., 1994). Identification of the virus as NDV and

an estimate of its pathogenicity also give no information that would enable assessment of

the source of the virus and its spread. In addition, the use of animals in this way is

becoming increasingly unacceptable with the development of actual or potential

alternatives.

2.3.2 Antigenic, pathogenic and molecular characterization

Virus neutralization (VN) or agar gel diffusion techniques have shown minor antigenic

variation between different strains and isolates of NDV (Gomez-Lillo et al., 1974; Schloer

et al., 1975; Pennington, 1978). Monoclonal antibody technology provided a new

approach to antigenic differentiation of NDV strains and isolates (Russel and Alexander,

1983; Nishikawa et al., 1983; Srinivasappa et al., 1986). Monoclonal antibody may detect

slight variation in antigenicity, such as single amino acid changes at the epitope to which

the antibody is directed. As a result, they are capable of detecting differences not only

between strains but between sub-populations of virus (Hanson, 1988). Panels of mouse

monoclonal antibodies raised against NDV strains have been able to divide NDV isolates

sharing similar biological and epidemiological properties into same antigenic subgroups

(Russel and Alexander, 1983; Alexander et al., 1997).

Currently, one or more of three in vivo tests are used to characterize NDV and assess its

virulence. These include mean death time (MDT) in embryonated fowls’ eggs, the

intracerebral pathogenicity index (ICPI) in 1-day-old chicks and the intravenous

pathogenicity index (IVPI) in 6-week-old chickens (Alexander, 1988). There are three

pathotypes among the pathogenic strains which can be differentiated primarily on the basis

of the above tests. The time required for a minimum lethal dose (MDT) to kill the embryos

is >90 hours for lentogenic strains, 60-90 hours for mesogenic strains and <60 hours for

velogenic strains (Seal et al., 2000; Noor et al., 2005). The difference in

neuropathogenicity of the types is demonstrated by intracerebral inoculation of day old

chick. The pathogenicity of NDV is stronger when the ICPI value is close to 2 and weaker

when the ICPI value is close to 0. Generally speaking, strains with an ICPI value <0.5,

0.5–1.5, and >1.5 are considered as lentogenic, mesogenic, and velogenic, respectively

(Hanson, 1956; Alexander, 1998). The difference in lethality is determined by IVPI. The

13  

values in the IVPI test range from 0 to 3.0; the IVPI for velogenic strain approach 3.0,

while lentogenic strains and some mesogenic strains have IVPI values of zero. However,

some viruses that can produce severe disease have IVPI values of zero; the ICPI test is

generally preferred for this reason (OIE, 2009).

Antigenic characterization and in vivo pathogenicity testing proved useful for rapidly

sorting viruses into broad groups but have failed to differentiate viruses that were

antigenically similar or of same pathotype, although not genetically identical. Since ND

viruses have an RNA genome, reverse transcription - polymerase chain reaction (RT-PCR)

Using a reverse transcriptase, the RNA genome is transcribed into a DNA copy, which can

be used as the template in PCR. Amplification of a specific gene region has been achieved

using (i) universal primers (Jestin and Jestin, 1991; Jestin and Cherbonnel, 1992; Gohm et

al., 2000); (ii) pathotype specific primers (Kant et al., 1997); or (iii) nested PCR (Jestin et

al., 1994; Kant et al., 1997; Kou et al., 1999; Kho et al., 2000, Zhang et al., 2010).

Further studies have been carried out using the generated PCR product, including:

• Restriction enzyme analysis (Wehmann et al., 1997; Ballagi Pordany et al., 1996; Kou

et al., 1999; Nanthakumar et al., 2000)

• Probe hybridization (Jarecki Black et al., 1992; Jarecki Black and King, 1993;

Radhavan et al., 1998; Oberdörfer and Werner, 1998; Aldous et al., 2001)

• Nucleotide sequencing for cleavage site analysis and epidemiological studies (Toyoda

et al., 1989; Collins et al., 1993, 1994; Staüber et al., 1995; Seal et al., 1995, 1998;

Marin et al., 1996; Heckert et al., 1996; King and Seal, 1997, Weingartl et al., 2003;

Liu et al., 2003; Lee et al., 2004; Pedersen et al., 2004; Tsai et al., 2004; Singh et al.,

2005; Kattenbelt et al., 2006; Perozo et al., 2006; Wang et al., 2006; Czeglédi et al.,

2006; Lien et al., 2007; Lee et al., 2009; Mase et al., 2009; Adi et al., 2010; Ke et al.,

2010; Krapež et al., 2010; Berhanu et al., 2010; Zhang et al., 2010; Hasan et al., 2010;

Liu et al., 2011; Mohamed et al., 2011)

Thus, RT-PCR has been used for the detection, identification and characterization of

NDV. The primers used in many of the published studies are listed in table 1.

14  

Table 1: Primers and probes used in Newcastle disease virus detection and differentiation

Used in Gene Product size (bp)

Sequence (5’ to 3’) References

RT-PCR* F 238 CTTTGCTCACCCCCCTTGG CTTCCCAACTGCCACTGC

Jestin and Jestin, 1991

RT-PCR & sequencing

F 304 TACACCTCATCCCAGACAGG AGTCGGAGGATGTTGGCAGC

Collins et al., 1993

RT-PCR & Sequencing

F ~300 ATGCCCAAAGACAAAGAGCAA TACTGCTGTCGCTACACCTAA

RT-nPCR & Sequencing

F 175 ACACCTCATCCCAGACAG TCTTCCCAACTGCCACTG

Jestin et al., 1994 

RT-nPCR & Sequencing

F CTTTGCTCACCCCCCTTGG GCATTTTGTTTGGCTTGTA

Sequencing F AAAGCCCCATTGGAAGCAT Collins et al., 1994

RT-PCR HN ATATCCCGCAGTCGCATAAC TTTTTCTTAATCAAG(TAG)GACT

Sequencing HN GCATTGCAGAAATATCCAATA

RT-PCR F 310 GGAGGATGTTGGCAGCATT GTCAACATATACACCTCATC

Stäuber et al., 1995

RT-PCR & Sequencing

F 254 CCTTGGTGAITCTATCCGIAG CTGCCACTGCTAGTTGIGATAATCC

Seal et al., 1995

M TCGAGICTGTACAATCTTGC GTCCGAGCACATCACTGAGC

RT-PCR F 254 CCTTGGTGAITCTATCCGIAGG CTGCCACTGCTAGTTGIGATATACC

Marin et al., 1996

RT-PCR & Sequencing

F 507 TTAGAAAAAACACGGGTAGAA AGTCGGAGGATGTTGGCAGC

Heckert et al., 1996

RT-PCR & Sequencing

F GCTTTATCTCCTGTTACCACAAT CAGAACACTGACCACTTTACTCAC

RT-PCR F 1349 TGACTCTATCCGTAGGATACAAGAGTCTG GATCTAGGGTATTATTCCCAAGCCA

Ballagi-Pordány et al., 1996

RT-PCR M 1097 TCTAGGACAATTGGGCTGTACTTTGATT AGAGACGCAGCTTATTTCTTAAAAGGATTG

Wehmann et al., 1997

15  

Used in Gene Product size (bp)

Sequence (5’ to 3’) References

RT-hnPCR F 362(AB) 362(AB)

TTGATGGCAGGCCTCTTGC GGAGGATGTTGGCAGCATT

Kant et al., 1997

RT-hnPCR F 254 (AC) 254 (AD)

AGCGT(C/T)TCTGTCTCCT G(A/G)CG(A/T)CCCTGT(C/T)TCCC

Probe F Probe TACAACAGGACA(C/T)TGAC(C/T)AC-TTTGCTCACCCCCCTTGGTGA

Probe F Probe TATAACAGAACACTGACTACCTTGC-TCACTCCCCTTGGCGA

RT-PCR F 362 TTGATGGCAGGCCTCTTGC GGAGGATGTTGGCAGCATT

Oberdörfer & Werner, 1998

RT-PCR F 274 CTTTGCTCACCCCCCTTGG CTTCCCAACTGCCACTGC

Probe F Probe TCCACGCCTGGGGGAAGGAGACAGAAA

Probe F Probe TCCACATCAGGAGTAAGGAGGAAGAAG

Probe F Probe ACTACATCTGGAGGGGGGAGACAG-GGG

Sequencing F 778 GGGRAAGARAGTGACWTTTGACA TKGGATAAWCCRYYRGTGACCTC

Lomniczi et al., 1998

Sequencing F 557 CCYRAATCAYYRYGRYRCYRGATAA KCRGCRTTYTGKKTGGCTKGTAT

RT-PCR F 1349 CGATTCCATCCGCAAGATCCAAGGGT-CTG GATCTAGGGTATTATTCCCAAGCCA

Kou et al., 1999

RT-nPCR F GCCTTAACTCAGTTGACTATCCAGGC CAAGCAATAAATGCCCGG

Sequencing F ATATGGGCTCCGAACCTTCTACCAGGG TTTATACAGTCCAATTCTCGCGCCG

Sequencing F TAATACAAGCCAACCAGAATGCCGCC GCTCAAGCAGGAATAAATGCCCGG

Sequencing F GGGCACCTAAATAATATGCGTGCC TCGCTCTTTGGTTGCTTGTACCC

16  

Used in Gene Product size (bp)

Sequence (5’ to 3’) References

RT-PCR F 356 GCAGCTGCAGGGATTGTGGT TCTTTGAGCAGGAGGATGTTG

Nanthakumar et al., 2000

RT-PCR F 216 CCCCGTTGGAGGCATAC TGTTGGCAGCATTTTGATTG

RT-nPCR PCR ELISA

F 532 TACACCTCATCCCAGACAGGGTC AGGCAGGGGAAGTGATTTGTGGC

Kho et al., 2000

RT-nPCR PCR ELISA

F 280 Ba-TACTTTGCTCACCCCCCTT Da-CATCTTCCCAACTGCCACT

RT-PCR F 182 CGIAGGATACAAGRGTCTG GCRGCAATGCTCTYTTTAAG

Gohm et al., 2000

RT-PCR F ~700 GACCGCTGACCACGAGGTTA GCAGCATTCTGGTTGGCTTGTATCA GGCAGCATTTTGTTTGGCTTGTATC

Aldous et al., 2001

Probe F AAGCGTTTCTGTCTCCTTCCTCCG

Probe F AGACGTCCCTGTTTCCCTCCTCC

Probe F AAACGTTTCTGTCTCCTTCCTCCGG

Probe F AAACGTCTCTGTCTCCTTCCTCCGG

Probe F AAGCGTTTCTGCCTCCCTCCTCC

Probe F CCTATAAGGCGCCCCTGTCTCCC

RT-PCR & Sequencing

F 750 TGTCGCAGTGACTGCTGACC GTCAGTGACCTCGTGCACAG

Weingartl et al., 2003

RT-PCR & Sequencing

F 970 GCCGAATTCCCGAATCATCACGACGCTTAA GTGAAGCTTGAGTCTGTGAGTCGTAC

Liu et al., 2003

F 839 CACCGGTACCCCTATTCTGATCGTTAAGCTTGTAGTGGCTCTCATCTGATC

RT-PCR & Sequencing

F 695 GCTGATCATGAGGTTACCTC AGTCGGAGGATGTTGGCAGC

Lee et al., 2004

RT-PCR & Sequencing

M &F 1195 TCGAGICTGTACAATCTTGC CTGCCACTGCTAGTTGIGATAATCC

Pedersen et al., 2004

17  

Used in Gene Product size (bp)

Sequence (5’ to 3’) References

RT-PCR & Sequencing

F 305 TACACCTCATCCCAGACAGG AGTCGGAGGATGTTGGCAGC

Tsai et al., 2004

RT-PCR F 356 GCAGCTGCAGGGATTGTGGT TCTTTGAGCAGGAGGATGTTG

Singh et al., 2005

RT-nPCR F 216 CCCCGTTGGAGGCATAC TGTTGGCAGCATTTTGATTG

RT-PCR & Sequencing

HN 711 AGATGACAACATGTAGATG GGCTAACTGCGCGGTCCA

Kattenbelt et al., 2006

HN 652 TCACAACATCCGTTCTACCGCATC GAATGTGAGTGATCTCTGCA

HN 597 ATGAGTGCTACCCATTACTG ATAGATAAGATGGCCTGCTG

HN 799 CACAACATTATTCGGGGACTGG AGGGTATTGGATATTTCGGCAATGCT

HN 519 CATACACAACATCAACATG GGTAGCCCAGTTAATTTCCA

RT-PCR F 250 TGGTGAITCTATCCGIAGG CTGCCACTGCTAGTTGIGATAATCC

Perozo et al., 2006

RT-PCR & Sequencing

F 535 ATGGGCYCCAGAYCTTCTAC CTGCCACTGCTAGTTGTGATAATCC

Wang et al., 2006

RT-PCR & Sequencing

NP 1631 TATCTATCCAGGCTCAGRTATGGGTCACAG GACARAAGAGAGTTGCTTGCTCCGGTCTTG

Czeglédi et al., 2006

RT-PCR & Sequencing

F 534 ATGGGC(C/T)CCAGA(C/T)CTTCTAC CTGCCACTGCTAGTTGTGATAATCC

Lien et al., 2007

RT-PCR & Sequencing

M &F 695 GCT GAT CAT GAG GTT ACC TC AGT CGG AGG ATG TTG GCA GC

Lee et al., 2009

RT-PCR & Sequencing

F 765 TGGAGCCAAACCGCGCACCTGCGG GGAGGATGTTGGCAGCAT

Mase et al., 2009

RT-PCR & Sequencing

F 356 GCAGCTTGCAGGGATTGTGGT TCTTTGAGCAGGAGGATGTTG

Adi et al., 2010

18  

Used in Gene Product size (bp)

Sequence (5’ to 3’) References

RT-PCR & Sequencing

F 535 ATGGGC(C/T)CCAGA(C/T)CTTCTAC CTGCCACTGCTAGTTGTGATAATCC

Ke et al., 2010

HN 1922 TTCTATCACATCACCGACAACAAG GTGGGCGGGACTCAGAATAATCAT

RT-PCR & Sequencing

F 454 TGCATCTTCCCAACTGCCACT TTGAYGGCAGRCCTCTTGC

Krapež et al., 2010

RT-PCR & Sequencing

F 535 ATGGGC(C/T)CCAGA(C/T)CTTCTAC CTGCCACTGCTAGTTGTGATAATCC

Berhanu et al., 2010

HN 320 ATATCCCGCAGTCGCATAAC TTTTTCTTAATCAAGTGACT

Semi nested RT-PCR for Pathotyping

F 301 TAYACCTCRTCYCAGACW(T GGAGGATGTTGGCAGCATT

Zhang et al., 2010

F 206 TAYACCTCRTCYCAGACW(T AYRGCGCCTATAAASCGTYT

RT-PCR & Sequencing

M&F 1180 CTGTACAATCTTGCGCTCAATGTC CTGCCACTGCTAGTTGTGATAATCC

Hasan et al., 2010

Multiplex RT-PCR

F 433 ATGGATCCCAAGCCTTCTAC TGGCTTGTATGAGGGCAGAA

Liu et al., 2011

F 535 ATGGGCYCCAGAC(C/T)CTTCTAC CTGCCACTGCTAGTTGTGATAATCC

RT-PCR & Sequencing

F 1792 F: ACGGGTAGAAGATTCTG F: GTTGACTAAGTTAGGTG R: CTCTCCGAATTGACAGAC

Mohamed et al., 2011

(Modified and expanded after Adous and Alexander, 2001). *RT-PCR, Reverse transcription polymerase chain reaction; ELISA, Enzyme-linked immunosorbent assay; n, nested; hn, heminested; HN, hemagglutinin-neuraminidase protein; F, fusion protein; M, matrix protein; aB, Biotin label; D, Digoxin label.

Jestin and Jestin (1991) developed first RT-PCR for the identification of NDV. The author

amplified a 238 bp of fusion protein gene using a universal primer which was confirmed

by restriction enzyme digestion. The viruses were propagated in embryonated eggs and the

infective allantoic fluid was used for RNA extraction. The reaction was thought to be

highly specific as there was no reaction with other avian viruses.

19  

Later in 2000, NDV was detected directly from infected tissues and feces samples using

RT-PCR rather than egg-grown virus samples and also described a time-course study to

determine the sensitivity of their technique (Gohm et al., 2000). A 182 bp region of the F

gene including the cleavage site was amplified using universal primers. The author also

mentioned the potential of this system for the study of epidemiology in the sampling of

wild bird population.

A molecular test must be simpler, more reliable, rapid test and combined with maximum

operator safety. Kho et al. (2000) mentioned a RT-nested PCR enzyme-linked

immunosorbent assay technique for the rapid and sensitive detection of NDV using a

colorometric detection system rather than electrophoresis thus avoiding the more

hazardous aspect of ethidium bromide during post PCR analysis. They also claimed the

nested PCR to be 100-fold more sensitive than standard PCR.

Recently, Singh et al. (2005) amplified a portion (356bp) of the F gene by RT-PCR from

infected tissues, allantoic fluid as well as vaccine strains. The author also used a nested

RT-PCR for the amplification of a 216 bp of F gene.

A multiplex RT-PCR was developed for the detection and differentiation of class I and

class II strains of NDV (Liu et al., 2011). The author used two specific primer pair for

class I and class II isolates and amplified products of 433bp and 535bp of the F gene

respectively. These results were compared with those obtained by nucleotide sequencing

and phylogenetic analysis and found to be consistent.

FTA filter paper has been used for NDV sampling and inactivation, followed by RT-PCR,

for molecular detection and phylogenetic analysis of NDVs (Perozo et al., 2006).

Although the molecular basis of NDV pathogenicity relies on multiple genes, the amino

acid sequence motif at the cleavage site of the precursor F-glycoprotein is the critical site

for major changes in virulence (Glickman et al., 1988; Peeters et al., 1999; Romer-

Oberdorfer et al., 2003). Indeed, it is widely accepted that its genetic analysis can be used

as a clear predictor of the pathogenicity potential of an NDV isolate (Toyoda et al., 1987;

Gould et al., 2003). Mutational analysis has shown that the fusion peptide and the adjacent

heptad repeat region play a role in the fusion activity of F protein (Sergel-Germano et al.,

1994).The protein is synthesized as precursor molecule (F0), which must be proteolytically

cleaved, producing two disulfide-linked amino-terminal F2 and carboxyl-terminal F1

20  

polypeptides (Scheid et. al., 1974 Nagai et al., 1976). The new amino terminus of F1 is

extremely hydrophobic and functions as the insertion peptide, promoting fusion of the

viral and cellular envelopes (Richardson et al., 1980). This cleavage is required for

initiation of infection and is considered to be a major determinant of NDV virulence.

The amino acid sequence at the cleavage site determines viral susceptibility to cleavage.

The velogenic viruses had the motif 112R/K-R-Q-K/R-R116 at the C terminus of the F2

protein and a phenylalanine at residue 117 located at the N terminus of the F1 protein. In

contrast, virus of low virulence had sequences in the same region of 112G/E-K/R-Q-G/E-

R116 at the C terminus of the F2 protein and a leucine at residue 117 (Collins et al., 1993)

and require trypsin-like enzymes for cleavage. These viruses therefore appear to be

restricted to grow in the respiratory and intestinal tracts (Fujii et al., 1999). Some of the

pigeon variant viruses (PPMV–1) examined had the sequence 112G-R-Q-K-R-F117 but

gave high intracerebral pathogenicity index (ICPI) values (Collins et al., 1993, 1994;

Jestin & Cherbonnel, 1992). Thus, there appears to be the requirement of at least a pair of

basic amino acids (arginine, R, or lysine, K) at residues 116 and 115, a phenylalanine at

residue 117 and a basic amino acid (R) at 113 for the virus to show high virulence for

chickens.

The OIE definition for reporting an outbreak of ND is:

‘Newcastle disease is defined as an infection of birds caused by a virus of avian

paramyxovirus serotype 1 (APMV-1) that meets one of the following criteria for

virulence:

a. The virus has an intracerebral pathogenicity index (ICPI) in day-old chicks (Gallus

gallus) of 0.7 or greater.

Or

b. Multiple basic amino acids have been demonstrated in the virus (either directly or

by deduction) at the C-terminus of the F2 protein and phenylalanine at residue 117,

which is the N-terminus of the F1 protein. The term ‘multiple basic amino acids’

refers to at least three arginine or lysine residues between residues 113 and 116.

Failure to demonstrate the characteristic pattern of amino acid residues as

described above would require characterization of the isolated virus by an ICPI

test.’

21  

In this definition, amino acid residues are numbered from the N-terminus of the amino

acid sequence deduced from the nucleotide sequence of the F0 gene, 113–116 corresponds

to residues –4 to –1 from the cleavage site.’

Only NDV possessing additional basic amino acids at the cleavage site of the fusion

protein are rendered infectious by nontrypsine like protease. Rott (1985), therefore,

suggested that the ability of NDV isolates to form plaques in cell culture systems in the

absence of trypsin represents a simple in vitro method for the detection of virulent viruses.

Other techniques for pathotyping NDV include PCR amplification of pathotype-specific

sized bands (Kant et al., 1997) or analyzing PCR products using a specific probe, either

radiolabelled (Jarecki-Black and King, 1993) or tagged with digoxygenin (Oberdorfer and

Werner, 1998). Hybridization of PCR fragments with fluorogenic probes specific for

pathotype allowed an estimation of pathogenicity of Newcastle disease virus (NDV)

isolates using a modified TaqMan procedure (Aldous et al., 2001).

Recently, approaches using new methods or chemistry have focused intensively on

reliable pathotyping of APMV-1 (Pham et al., 2005; Wang et al., 2008; Farkas et al., 2009;

Fuller et al., 2009; Tan et al., 2009). The most widely used diagnostic method by far is the

USDA-validated real-time reverse transcription polymerase chain reaction (RRT-PCR)

method described by Wise et al. (2004) using robust TaqMan technology. Steyer et al.

(2010) developed RRT-PCR detection assays using minor groove-binding (MGB) probes

for successful detection and simultaneous prediction of a broad range of APMV-1

pathotypes, including pigeon strains. RRT-PCR methods provide high sensitivity and

opportunity for quantitative measurements. By omitting post-PCR steps, the risk of cross-

contamination and the time and material needed to make a diagnosis can be reduced

(Beläk and Thore, 2004).

Analysis of nucleotide sequences has allowed differentiation of even extremely closely

related viruses resulting in important epidemiological evidence of virus origin (Alexander

et al., 1999). Nucleotide sequencing, after RT-PCR and phylogenetic analysis, has been

used by a number of authors to assess genetic differences and genotypes of ND viruses

(Toyoda et al., 1989; Collins et al., 1993, 1994; Stauber et al., 1995; Seal et al., 1995,

1998; Marin et al., 1996; Heckert et al., 1996; King & Seal, 1997, Weingartl et al., 2003;

Liu et al., 2003; Lee et al., 2004; Pedersen et al., 2004; Tsai et al., 2004; Singh et al.,

22  

2005; Kattenbelt et al., 2006; Perozo et al., 2006; Wang et al., 2006; Czeglédi et al., 2006;

Lien et al., 2007; Lee et al., 2009; Mase et al., 2009; Adi et al., 2010; Ke et al., 2010;

Krapež et al., 2010; Berhanu et al., 2010; Zhang et al., 2010; Hasan et al., 2010; Liu et al.,

2011; Mohamed et al., 2011. It has been established that sequences of as little as 250 base

pairs give meaningful phylogenetic analyses, comparable with those obtained with much

longer sequences (Seal et al., 1995; Lomniczi et al., 1998).

To date, phylogenetic analysis based on the genomic sequences have revealed that the

strains of NDV could be divided into 2 distinct clades, class I and class II, and class I

contains 9 genotype (1-9) and class II contains ten genotypes (I-X) with genetic groups VI

and VII being further divided into several sub-genotypes (Ballagi-Pordany et al., 1996;

Lomniczi et al., 1998; Herczeg et al., 1999; Kwon et al., 2003; Liu et al., 2003; Gould et

al., 2003; Tsai et al., 2004; Kim et al., 2007a, b). Class II viruses were responsible for all

four panzootics of ND from the 1920s to the present. In particular, viruses in this class of

genotype VII are the main pathogens that have resulted in most outbreaks of ND in recent

years throughout the world (Liu et al., 2007; Miller et al., 2009, 2010). Most of the class I

isolates have been obtained from waterfowl, shorebirds or poultry in live bird markets

(LBMs) in Asia or America (Kim et al., 2007a,b; Lee et al., 2009; Jindal et al., 2009; Liu

et al., 2009, 2010; Hu et al., 2010). Almost all of the class I NDV isolates collected have

been shown to be lentogenic strains, with the exception of only one isolate, -IECK90187,

which was obtained from domestic poultry and was responsible for sporadic outbreaks of

ND in Ireland during 1990 (Alexander et al., 1992). However, the lentogenic viruses have

the potential to move from low virulence to virulence by mutation in susceptible domestic

poultry (Shengqing et al., 2002).

Four main global streams of infection have been recognized in the history of ND

panzootics in chickens and other bird species (Alexander, 1988; Alexander and Senne,

2008). The first recorded panzootic started in the Southeast Asia in the mid-1920s and it

took about 30 years to spread throughout the world. At least three genotypes (II, III, and

IV) were involved in the first panzootic (Yu et al., 2001). A second panzootic is

recognized to have started in the Middle East in the 1960s and to have spread to most

countries by the early 1970s. This panzootic prompted the development of improved

vaccines and vaccination protocols that combined with implementation of sanitary

measures brought the disease under control in North America and in some European

23  

countries. In the larger part of the world, however, especially where rural chicken breeding

is dominant, ND had become endemic. Monoclonal antibody analysis established a close

relationship of NDV strains of the second panzootic with isolates from imported

psittacines (Russell and Alexander, 1983). This was later confirmed by genetic analysis of

the fusion (F) protein gene and the classification of these isolates as genotype V (Ballagi-

Pordany et al., 1996; Lomniczi et al., 1998).

The start and spread of the third panzootic are unclear. Use of improved vaccines had

resulted in improved disease control, but vaccination did not prevent infection and the

transmission of virus from infected vaccinates. Subsequent characterization of those NDV

isolates recovered after the second panzootic revealed further genetic variation. The

presence of genotype VII was identified in Taiwan and Indonesia in the 1980s (Lomniczi

et al., 1998; Yu et al., 2001). The presence of isolates of genotype VIIb in southern Africa

and their involvement in the NDV outbreaks of the 1990s was first described by Herczeg

et al. (1999). The occurrence of other isolates characterized as subtypes of genotype VII

have also been reported: VIIa in the Far East and Europe (Yang et al., 1999; Liang et al.,

2002); VIIb in the Far East, Middle East, Europe (Jogersen et al., 1998; Alexander et al.,

1999 and Wehmann et al., 2003), India, and Southern Africa (Herczeg et al., 2001;

Abolink et al., 2004); VIIc in the Far East and Europe; and VIId in the Far East and South

Africa (Yu et al., 2001; Abolink et al., 2004). The fourth panzootic is attributed to a NDV

variant that infects primarily pigeons and doves (Aldous et al., 2004) and is now

characterized as genotype VI (Ballagi-Pordany et al., 1996; Lomniczi et al., 1998). The

variant virus was first identified in isolates recovered in the Middle East in the late 1970s,

spread to Europe in the 1980s, and was responsible for outbreaks in unvaccinated chickens

infected from feed contaminated by infected pigeons in Great Britain during the mid-

1980s. Although the timeframe overlaps the occurrence of the third panzootic, the variant

virus remains enzootic in pigeons and is a continuing threat to establish infections in

poultry.

2.4 Vaccination

Vaccination against ND should result in immunity against infection and replication of the

virus (Alexander, 1997). Vaccination will protect birds from the more serious

consequences of NDV infection since clinical signs are greatly diminished in relation to

antibody level achieved. However virulent ND strains may still infect, replicate, and be

24  

excreted from vaccinated birds. Virulent NDV may also be present in the tissues and

organs of vaccinated and apparently healthy birds. NDV vaccines are either live or

inactivated. Live vaccines are either lentogenic or mesogenic. Three lentogenic strains like

B1, F and LaSota are used in very young chicks without affecting the host. Mesogenic

strains are used in growing and adult birds.

Inactivated vaccines are usually produced from infected allantoic fluid treated with beta-

propiolactone or formalin to kill the virus and then mixed with a carrier adjuvant. Various

seed viruses used in the production of the oil-emulsion vaccines include Ulster 2C, B1,

LaSota, Roakin and also several virulent viruses. One or more other antigens (such as

Infectious Bronchitis Virus, Infectious Bursal Disease Virus) may be incorporated into the

emulsion with NDV (Alexander, 1997).

 

   

 

  25 

 

CHAPTER III

MATERIALS AND METHODS

The research work was performed in the Department of Pathology, Bangladesh

Agricultural University, Mymensingh.

3.1 Materials

3.1.1 Equipment

Balance, pH meter, refrigerators, freezers, bench top autoclave, Class II biosafety

cabinet, vortexer, thermomixer, ice box, micropipettes, centrifuge, thermocycler,

gel-electrophoresis apparatus with power supply, gel-documentation system,

spectrophotometer, etc.

3.1.2 Plasticware and other consumables

Pipette tips, Falcon tubes (50 ml and 15 ml), Cryovials (2 ml), Eppendorf tubes (1.5 ml),

PCR tubes (0.2 ml), parafilm, aluminum foil, etc.

3.1.3 Software

The EditSeq, MegAlign modules of “Lasergene” software (DNASTAR Inc., USA) was

used for editing, alignment and analysis of gene sequences. The program “Adobe

Photoshop” software was used for image processing.

3.1.4 Virus isolates

Five isolates of Newcastle disease virus (NDV) isolated earlier from field cases in the

Department of Pathology, BAU (Mazumder, 2010) were used in this study. Four isolates

(BD-C21/10, BD-C50/10, BD-C161/10, BD-C162/10) were obtained from chickens while

one isolate (BD-P01/10) was obtained from a pigeon. All samples had been propagated in

the allantoic sacs of 9-day-old embryonated chicken eggs and identity of the virus

confirmed by hemagglutination (HA) and hemagglutination-inhibition (HI) assays

(Mazumder, 2010). A NDV vaccine virus obtained from the Livestock Rersearch Institute

  26 

 

of the Department of Livestock Services (hereafter coded as BD-Vac01) was used as a

positive reference virus.

3.1.5 Primers

The primers used in this study (Table 2) were selected from published literature (Mase et

al., 2009). These primers amplify a 766 bp fragment containing a part (3' end) of the

matrix protein gene and a part (5' end) of the fusion protein gene. The primers were

synthesized commercially.

Table 2: Primers used in this study

Primers Sequences bp Position*

NDV-F2 5’-TGGAGCCAAACCGCGCACCTGCGG-3’ 24 4241-4264

NDV-R2 5’- GGAGGATGTTGGCAGCAT-3’ 18 5006-4989

*Nucleotide numbering is according to the complete genome sequence of LaSota/46

strain (Accession No. AF077761; de Leeuw and Peeters, 1999)

3.1.6 DNA size marker

Promega* DNA Ladder Molecular Weight Markers (Fig. 1) was obtained commercially

(Promega, Madison, WI 53711 USA).

Fig.1: DNA size marker (100 bp)

  27 

 

3.1.7 Kits

The following kits are used in this study.

RNeasy mini Kit (RNA extraction kit) (Qiagen, Germany)

Qiagen one step RT–PCR kit (Qiagen, Germany)

EZ-10 Spin column PCR product purification kit (Bio Basic Inc., USA)

3.1.8 Solution, buffer and chemicals

3.1.8.1 Electrophoresis buffers and reagents

TAE buffer (50X)

Tris base 242.0 g

Glacial acetic acid 57.1 ml

0.5 M EDTA, pH 8.0 100.0 ml

Distilled water to make 1 liter

The above mixture was dissolved by stirring and stored at room temperature.

1X working solution was prepared by mixing 1 part stock buffer with 49 parts water.

Electrophoresis grade Agarose:

Obtained from Promega, Madison, WI 53711 USA

Loading dye

Ultra Pure Agarose Gel Loading Dye, Bio Basic Inc., USA

Ethidium bromide (10 mg/ml)

Obtained from Sigma, USA

3.1.8.2 Cycle sequencing chemicals

Terminator Ready Reaction Mix (Big Dye)

Provided by the sequencing lab (ICDDR, B, Dhaka, Bangladesh).

3M sodium acetate pH 4.6, 100ml

Sodium acetate (MW 82.03gm) 24.61gm

Distilled water 80 ml

Dissolved and pH adjusted with 3M Acetic acid solution. Finally the volume was adjusted

with distilled waster to make 100 ml.

  28 

 

3M Acetic acid solution, 10 ml

Glacial acetic acid 1.8 ml

Distilled water 8.2 ml

95% and 75% alcohol

Prepared with molecular biology grade absolute alcohol and nuclease free water.

3.2 Methods

3.2.1 Cleaning and sterilization

Glassware, forceps and mortar and pestle were soaked in a household dishwashing

detergent solution ("Trix", Reckitt and Benckeser Bangladesh Ltd.) for at least one hour.

Contaminated items were disinfected overnight in 2% sodium hypochloride solution prior

to immersing in detergent. The items soaked in detergent were cleaned by brushing,

washed thoroughly in running tap water and rinsed four times in distilled water. Finally

glassware, forceps and mortar and pestle were wrapped with brown paper and sterilized by

dry heat in a hot air oven at 160ºC for one hour. Glass bottles having plastic caps or rubber

seals and disposable plasticware (Eppendorf tubes, micropipette tips etc.) were sterilized

by autoclaving for 15 min. at 1210C under 15 lbs pressure per sq. inch. Autoclaved items

were dried in a hot air oven at 50°C. The graduated glass pipettes were taken in a large

cylinder filled with water, washed thoroughly by continuous filling and removal of water

from the cylinder, finally washed 4 times in the same manner using distilled water. The

pipettes were dried in an oven at 500C. The graduated pipettes were cotton plugged at the

neck, placed in a canister and sterilized by dry heat in a hot air oven at 160ºC for one hour.

3.2.2 Molecular detection

3.2.2.1 Viral RNA extraction

Viral RNA was extracted from infected allantoic fluid using RNeasy Kit (Qiagen,

Germany) as recommended by the manufacturer. In brief, 600 µl RLT buffer (10 µl 2-

mercaptoethanol added to 1 ml RLT buffer) and 100 µl virus suspension (allantoic fluid or

reconstituted vaccine) were taken in an Eppendorf tube, vortexed and incubated at room

temperature for 2 minutes. Then 700 µl of 70% ethanol was added to the supernatant and

mixed gently. 700 µl of mixture was transferred to an RNeasy spin column placed in a 2

  29 

 

ml collection tube. This was centrifuged at 10,000 rpm for 15 sec. The flow-through at the

collection tubes was discarded and the remaining 700µl of mixture was transferred to the

column and centrifuged again as above. After that 700µl of RW1 buffer was added to the

column, centrifuged as above and the flow-through was discarded. 500µl of RPE (to which

4 volumes ethanol had been added) was added to the spin column and centrifuged for 15

sec at 10,000 rpm and flow-through was removed. Again 500µl of RPE was taken in the

column and centrifuged for 2 min at 10,000 rpm. Then the spin column was placed in a 1.5

ml Eppendorf tube and 50 µl of RNAse free water was added to the column and

centrifuged for 2 min as above. The RNeasy spin column was discarded and the Eppendorf

tube containing RNA was labeled and stored at -20ºC or at -80ºC for short term and long

term storage, respectively.

3.2.2.2 RT-PCR

The RT-PCR was carried out using the Qiagen one step RT–PCR kit (Qiagen, Germany)

as recommended by the supplier with minor modification. The purified NDV genomic

RNA was used as the template.

The reaction was set up as follows:

Components Volume / Reaction Final Concentration

Mastermix

Nuclease-free water 11.5 µl -

5X Qiagen One Step RT-PCR buffer 5.0 µl 1x

dNTP Mix (containing 10 mM

of each dNTP)

1.0 µl 400 µM of each dNTP

Primer NDV F2 (Table 1) 0.5 µl 100 pmol

Primer NDV R2 (Table 1) 0.5 µl 100 pmol

Qiagen OneStep RT-PCR Enzyme Mix 1.0 µl -

RNasin® RNA inhibitor 0.5 µl 10 U /reaction

Total (Mastermix) 20 µl

Template RNA 5.0 µl

Total 25 µl

  30 

 

The RT-PCR reaction was performed in a thermocycler (Eppendorf Mastercycler). The

thermal profile was as follows: reverse transcription at 50ºC for 30 min; initial

denaturation and activation of Taq polymerase at 95ºC for 15 min; 30 cycles of the PCR

reactions each consisting of denaturation for 30 sec at 94ºC, annealing for 30 sec at 55ºC

and extension for 1 min at 72ºC; final elongation for10 min at 72ºC.

3.2.2.3 Analysis of PCR products by agarose gel electrophoresis

1.2% agarose gel (w/v) was prepared by dissolving agarose powder in 1x TAE Buffer. The

agarose was dissolved by heating in microwave oven. After that ethidium bromide was

added to the agarose solution @ 0.5µg/ml (5µl of stock/100 ml). The agarose solution

containing ethidium bromide was poured into the gel casting tray to which the comb was

properly positioned. When the gel was completely set, the comb was removed and the gel

was transferred into the electrophoresis tank which was filled with 1x TAE buffer.

An amount of 5 µl PCR product was mixed with DNA loading buffer (5 vol. PCR product

+ 1 vol. DNA loading buffer and loaded onto the slots of the gel. As a size standard, a 100

bp ladder was also loaded to one slot. Electrophoresis was run at 90 V for 30 min. After

the completion of electrophoresis the gel was placed on the UV transilluminator in the

dark chamber of the image viewing and documentation system. The result was viewed on

the monitor as well as saved electronically.

3.2.3 Molecular Characterization

The RT-PCR products were subjected to nucleotide sequencing, which involved the

following steps.

3.2.3.1 Purification of PCR products

PCR products were purified using EZ-10 Spin column PCR product purification kit (Bio

Basic Inc., USA). First the PCR reaction mixture was transferred to a 1.5 ml microfuge

tube and 3 volumes of the Binding Buffer I was added. Then the above mixture solution

was transferred to the EZ-10 column and incubated at room temperature for 2 minutes and

centrifuged at 10,000 rpm for 2 minutes. The flow-through in the tube was removed and

500 µl of Wash Solution was added to the column and centrifuged as above. The washing

step was repeated and spinned at 10,000 rpm for an additional minute to remove any

  31 

 

residual Wash Solution. The column was transferred into a clean microfuge tube and 30µl

of Elution Buffer was added into the center of the column and incubated at room

temperature for 2 minutes. The column was then centrifuged at 10,000 rpm for 2 minutes

to elute the DNA. Finally the purified DNA was stored at -20˚C.

3.2.3.2 Quantification of DNA

The purified RT-PCR products (cDNA) were quantified with an UV spectrophotometer

measuring the absorbance at 260nm weave length.

3.2.3.3 Gene sequencing

For sequencing the purified RT-PCR product was subjected to cycle sequencing with Big

Dye Terminator Ready Reaction kit. The concentrations of DNA were adjusted as per

recommendation of the kit. The reaction mixture (total vol. 20 µl) consisted of Terminator

Ready Reaction Mix (Big Dye) 4.0 µl, template (DNA) 1.0 µl, primer (forward or reverse

at conc. of 3.2 pmol/µl) 1.0 µl and deionized water 14.0 µl. The thermal cycling profile

was as follows: initial denaturation at 96°C for 1 minute followed by 25 cycles of

denaturation at 96°C for 10 seconds, annealing at 50°C for 5 seconds and elongation at

60°C for 4 minutes and finally, hold at 4°C.

The cycle sequencing reaction product was purified by ethanol precipitation. Briefly, 20.0

µl products were added to a 1.5 ml micro centrifuge tube containing 2.0 µl of 3M sodium

acetate, pH.4.6, and 50.0 µl 95% alcohol and mixed thoroughly. The tube was left for 1-2

hours at room temperature, and then centrifuged for 20 min at 14000 rpm. The supernatant

was carefully aspirated. The pellets were washed twice with 250 µl of 70% alcohol and

were recovered after spinning for 10 min; finally the pellets were left over night for drying

after covering the tube with parafilm containing a hole. The dried purified product was

sent to a sequencing laboratory at ICDDR, B, Dhaka for generation of sequence data after

capillary electrophoresis on a gene sequencing machine (Genetic Analyzer 3130).

3.2.3.4 Analysis of nucleotide and deduced amino acid sequences

The sequence data were compiled with the EditSeq Module of Lasergene DNASTAR

software (DNASTAR Inc. Madison, WI). Nucleotide and deduced amino acid sequences

of the F gene corresponding to the N terminus of the fusion protein (amino acid residues

  32 

 

1-118) of NDV were aligned using the Megalign Module of Lasergene DNASTAR

software (DNAstar Inc. Madison, WI).

3.2.3.5 Phylogenetic analysis

Phylogenetic analysis was performed with ClustalV and tree based on the nucleotide

sequences of 354 bp fragment (corresponding to the first 118 amino acid residues) of the

fusion protein gene were constructed by the neighbor-joining algorithm using MegAlign

Module of Lasergene DNASTAR software. The nucleotide sequence data of the fusion

protein gene used in this study (Table 3) were obtained from GenBank.

Table 3: The sequences of NDV isolates used in this study

NDV Isolates Country Host Geno-type

Patho-type

Accession no.

Reference

Ulster/67 Northern Ireland

CK* I L M24694 Toyoda et al., 1989

D26/76 Japan DK I L M24692 Toyoda et al., 1989

V4/66 Australia CK I L M24693 Toyoda et al., 1989

B1/47 USA CK II L M24695 Toyoda et al., 1989

BD-Vac01 Bangladesh CK II L

LaSota/46 USA CK II L AF077761 De Leeuw and Peeters, 1999

Texas GB/48 USA CK II V M23407 Schaper et al., 1988

Sato/30 Japan CK III V AB070382 Mase et al., 2002

Mukteswar India CK III V AF224505 Wehmann and Lomniczi, 2000

Miyadera/51 Japan CK III V M24701 Toyoda et al., 1987

Texas USA CK IV V M33855 Taylor et al., 1990

Herts/33 Great Britain

CK IV V M24702 Toyoda et al., 1989

CA1085/71 USA CK V V AF001106 Lomniczi et al., 1998

H-10/72 Hungary CK V V AF001107 Lomniczi et al., 1998

  33 

 

NDV Isolates Country Host Geno-type

Patho-type

Accession no.

Reference

A-24/96 Australia CK VI V AF001133 Lomniczi et al., 1998

IT-227/82 Hungary PG VI AJ880277 Ujvari, D., 2006

RI-3/88 Indonesia CK VIIa V AF001135 Lomniczi et al., 1998

E-1/93 Hungary CK VIIa V AF001126 Lomniczi et al., 1998

AE232/96 United Arab

Emirates

Partridge

VIIb V AF109884 Alexander et al., 1999

MZ-48/95 Mozam CK VIIb V AF136779 Herczeg et al., 1999

TW/84C Taiwan CK VIIc V AF083965 Yang et al., 1999

JS-2/98 China CK VIIc V AF458013 Liu et al., 2003

Ch/98-3 China CK VIId V AF364835 Yu et al., 2001

Kr/005/00 Korea CK VIId V AY630423 Lee et al., 2004

TW/2000 Taiwan CK VIIe V AF358786 Yu et al., 2001

TW/08-07 Taiwan CK VIIe V AB512616 Ke et al., 2010

SG-4H/65 South Africa

CK VIII V AF136762 Herczeg et al., 1999

AF2240/60 Malaysia CK VIII V AF048763 GenBank

F48E9/44 China CK IX V AY508514 Xu et al., 2003

FJ-1/85 China CK IX V AF458009 Liu et al., 2003

TW-C69-10-36 Taiwan CK X V AY372163 Tsai et al., 2004

DE-R49/99 Germany Duckling

Class I

A DQ097393 Czegledi et al., 2006

Alaska/415/91 Alaska Goose Class I

A AB524405 Tsunekuni et al., 2010

*CK = Chicken, DK = Duck, PG = Pigeon, V = Velogenic, L = Lentogenic, A =

Apathogenic

 

34 

 

CHAPTER IV

RESULTS

4.1 RT-PCR

A fragment of the F gene of five Bangladeshi NDV isolates was amplified by RT-PCR using NDV-F2 and NDV-R2 primers with the expected band size of 766 bp (Fig. 2).

Fig.2: Amplification of F gene fragment (766 bp) by RT-PCR. M=Marker (100bp), NC= Negative Control, PC= Positive Control (BD-Vac01), 21=BD-C21/10, 50= BD-C50/10,

161=BD-C161/10, 162= BD-C162/10, Pigeon= BD-P01/10.

4.2 Nucleotide sequencing and blast search

The RT-PCR products of one selected chicken isolate (BD-C162/10), the pigeon isolate

(BD-P01/10) and the vaccine virus (BD-Vac01) were subjected to nucleotide sequencing.

The nucleotide sequence of (411-418) base pairs was successfully resolved for all the three

samples. The sequence of BD-C162/10 and BD-P01/10 were subjected to blast search in

the GenBank.

35 

 

The results of the search revealed that the chicken isolate BD-C162/10 had close similarity

with the isolates from the Far East, Europe and South Africa with 91% to 92% and the

pigeon isolate BD-P01/10 had 92% to 95% identity with the isolates from different parts

of the world (Table 4 and 5).

Table 4: Results of nucleotide blast search for BD-C162/10 sequence similarity in the GenBank

Isolates GenBank Accession No.

Country of origin Identity with BD-C162/10

Niigata/89 AB070410 Japan 92% ZW 3422/95 AF109877 Zimbabwe 92% PTTY91146 AY175761 Portugal 92% AESCK90174 AY175652 Spain 92% 1ZAOS95044 AY175640 South Africa 92% IT-112/84 AF218127 Italy 92% ZA-33/94 AF136772 South Africa 92% ZA-26/93 AF136769 South Africa 92% IT-113/85 AF218128 Italy 91% ZA71/B/94 AF532751 South Africa 91%

Table 5: Results of nucleotide blast search for BD-P01/10 sequence similarity in the GenBank

Isolates GenBank Accession No.

Country of origin Identity with BD-P01/10

JAESA90099 AY135748 United Arab Emirates 95% JAEFA96038 AY175738 United Arab Emirates 95% Chiba/69 AB070387 Japan 93% BG-72/74 AF402116 Bulgaria 93% Narashio/68 AB070386 Japan 93% BG-99/82 AF402131 Bulgaria 92% Lebanon 70 AF001110 Lebanon 92% Kuwait 256 AF001109 Kuwait 92% Iraq AG68 AF001108 Iraq 92% ASTR/74 Y19012 Russia 92%

36 

 

4.3 Multiple alignment of nucleotide sequences and phylogenetic analysis

The first 354 nucleotides of the coding region of F gene of BD-C162/10, BD-P01/10 and

BD-Vac01 were aligned with the corresponding region of the F gene of 22 NDV strains

belonging to 10 different genotypes, downloaded from the GenBank. A phylogenetic tree

was constructed (Fig. 3). In the phylogenetic tree, BD-C162/10 isolate clustered with the

strain under genotype VII. The pigeon isolate BD-P01/10 belonged to the genotype VI and

the vaccine strain BD-Vac01 to genotype II.

Fig. 3: Phylogenetic relationship of the Bangladeshi isolates of NDV with the strains belonging to different genotypes. The analysis was based on the sequence of 354-bp fragment of the fusion protein gene. Bangladeshi isolates subjected to analysis were

highlighted with double asterisk (**).

37 

 

Table 6 showed the distances in nucleotide sequences of fusion protein gene fragment of

25 strains/isolates belonging to all ten genotypes of NDVs. The nucleotide divergence

between the different genotypes varied from 6.6 – 24%. Within a genotype relatively

higher diversity in nucleotide sequence was notice in genotype VI (8.8-11.1%) and

genotype VII (5.5-11.5%).

The nucleotide sequence divergence between the Bangladeshi chicken isolate BD-C162/10

and pigeon isolate BD-P01/10 was 17.4%. The Bangladeshi vaccine virus (coded as BD-

Vac01) was 20.5% and 22.3% divergent from BD-C162/10 and BD-P01/10, respectively.

Table 6: Nucleotide sequence distance in the F gene (nt 1-354 of the coding region) among different genotypes of Newcastle disease viruses 

 

The viruses under the genotype VII are further subdivided into 5 sub-genotypes. The

sequence of Bangladeshi chicken isolate BD-C162/10 was aligned with the 10 sequences

representing all five sub-genotypes (VIIa-VIIe). The sequence of D26/76_I strain

(Genotype 1) was used as an outgroup. The results (Fig. 4) showed that BD-C162/10

isolate clustered with the strains belonging to sub-genotype VIIb, although it formed a

separate branch.

38 

 

Fig. 4: Phylogenetic relationship of the Bangladeshi isolates of NDV with the strains belonging to VII sub-genotypes. The analysis was based on the sequence of 354-bp fragment of the fusion protein gene. Bangladeshi isolates subjected to analysis were

highlighted with double asterisk (**). D26/76_I strain was used as an out group.

The sequence distance table (Table 7) revealed that the nucleotide diversity between the

sub-genotypes of genotype VII varied from 2.9 - 15.1%. The Bangladeshi chicken isolate

BD-C162/10 was most closely related to strains belonging to sub-genotype VIIb, but the

nucleotide diversity was quite high (9.5 – 11.5%).

Table 7: Nucleotide sequence distance in the F gene (nt 1-354 of the coding region) among different sub-genotypes under the NDV genotype VII 

39 

 

4.4 Alignment of the predicted amino acid sequences

Amino acid residues were predicted from the nucleotide sequences and the resulting

deduced amino acid sequences, spanning from the position 1 to 118 in the fusion protein,

of all the 25 strains/isolates of different genotypes were aligned (Fig. 5). The N terminus

of the fusion protein from residues 1 to 30 appears to be a hypervariable region. The

Bangladeshi chicken isolate BD-C161/10 had unique amino acid substitutions at position

24 (S/G to I) and 43 (V to I). The pigeon isolate BD-P01/10 also possessed two unique

amino acid substitutions at position 8 (R/K/N to W) and 41 (G to E). The genotype II

viruses including Bangladeshi vaccine virus (coded as BD-Vac01) had five signatory

amino acid residues at position 13 (M), 22 (V), 32 (I), 69 (L) and 82 (D). The amino acid

residues at position 72, 78 and 79, suggested to be associated with a neutralizing epitope,

are identical among the two isolates and the vaccine virus from Bangladesh.

Deduced amino acid sequences of 10 strains representing 5 sub-genotypes of VII (VIIa-

VIIe) and the Bangladeshi chicken isolate BD-C162/10 were also aligned (Fig. 6). BD-

C162/10 possessed sub-genotype VIIb specific amino acid substitution (K to R) at position

101. However, BD-C162/10 isolate also had some unique amino acid substitutions at

position 13 (P), 19 (A), 24 (I), 29 (A) and 43 (I) which were different from all other strains

representing different sub-genotypes including VIIb.

40 

 

Fig. 5: Amino acid residue substitution of F gene for NDV strains of different genotypes

41 

 

Fig. 6: Amino acid residue substitution of F gene for different NDV strains of subgenotype

VII (VIIa-VIIe)

4.5 Analysis of the fusion protein cleavage site

The amino acid sequences of the fusion protein cleavage site (amino acid residue 112 to

118) of different strains belonging to different genotypes are shown in Table 8. Both the

Bangladeshi isolates from chicken (BD-C162/10) and pigeon (BD-P01/10) possessed the

same amino acid sequences 112R-R-Q-K-R-F117 at F0 cleavage site, which was identical to

the motif of velogenic type of NDV. On the other hand, the vaccine virus (coded as BD-

Vac01) had amino acid sequences 112G-R-Q-G-R-L117 at the F0 cleavage site representing

the motif of lentogenic type of NDV.

42 

 

Table 8: NDV isolates analyzed in this study showing fusion protein cleavage site

NDV Isolates Country Host Genotype Cleavage sitea Ulster/67 Northern Ireland Chicken I GKQGRL D26/76 Japan Duck I GKQGRL V4/66 Australia Chicken I GKQGRL B1/47 USA Chicken II GRQGRL BD-Vac01 Bangladesh Chicken II GRQGRL LaSota/46 USA Chicken II GRQGRL Texas GB/48 USA Chicken II RRQKRF Sato/30 Japan Chicken III RRQRRF Mukteswar India Chicken III RRQRRF Miyadera/51 Japan Chicken III RRQRRF Texas USA Chicken IV RRQRRF Herts/33 Great Britain Chicken IV RRQRRF CA1085/71 USA Chicken V RRQKRF H-10/72 Hungary Chicken V RRQKRF A-24/96 Australia Chicken VI RRQKRF IT-227/82 Hungary Pigeon VI GRQKRF BD-P01/10 Bangladesh Pigeon VI RRQKRF AE232/96 United Arab Emirates Partridge VIIb KRQRRF BD-C162/10 Bangladesh Chicken VIIb RRQKRF MZ-48/95 Mozam Chicken VIIb RRQKRF RI-3/88 Indonesia Chicken VIIa RRQKRF E-1/93 Hungary Chicken VIIa RRQKRF TW/84C Taiwan Chicken VIIc RRQKRF JS-2/98 China Chicken VIIc RRQKRF Ch/98-3 China Chicken VIId RRQKRF Kr/005/00 Korea Chicken VIId RRQKRF TW/2000 Taiwan Chicken VIIe RRQKRF TW/08-07 Taiwan Chicken VIIe RRQKRF SG-4H/65 South Africa Chicken VIII RRQKRF AF2240/60 Malaysia Chicken VIII RRQKRF F48E9/44 China Chicken IX RRQRRF FJ-1/85 China Chicken IX RRQRRF TW-C69-10-36 Taiwan Chicken X RRQKRF DE-R49/99 Germany Duckling Class I GRQGRL Alaska/415/91 Alaska Goose Class I ERQERL

aAmino acid residues 112-117

 

43 

 

CHAPTER V

DISCUSSION AND CONCLUSION

An RT-PCR protocol was adopted for molecular detection of NDV. A 766 bp fragment

covering a part of matrix protein and fusion protein genes was successfully amplified from

five local isolates of NDV (four from chickens and one from pigeon) and a reference

vaccine virus. Although virus isolation and serological identification followed by in vivo

pathogenicity testing still remains as the gold standard, RT-PCR offers a reliable tool for

quick detection of NDV. Moreover, RT-PCR products can be used for down steam

pathotypic and genetic analysis (Toyoda et al., 1989; Collins et al., 1993, 1994 and Seal et

al., 1995).

The RT-PCR product of a chicken isolate, the pigeon isolate and the vaccine virus was

subjected to nucleotide sequencing. Blast search, multiple alignment and phylogenetic

analysis of the nucleotide sequence of the first 354 bp from the coding region of F gene

and their deduced amino acid sequence (residues 1-118) revealed that the Bangladeshi

chicken isolate (BD-C162/10) and pigeon isolate (BD-P01/10) belong to genotype VII

(sub-genotype VIIb) and genetype VI, respectively, under the Class II NDV. It has been

established that sequence of as little as 250 base pairs give meaningful phylogenetic

analysis comparable with those obtained with much longer sequence (Seal et al., 1995;

Lomniczi et al., 1998). In this study a 354 base pairs genomic region (nt 1-354 of F gene)

was used for phylogenetic analysis. The topology of the constructed tree was consistent

with previous reports (Collins et al., 1996, Herczeg et al., 1999; Lomniczi et al., 1998 and

Seal et al., 1995). The world has experienced at least four panzootic of NDV infections.

Viruses belonging to genotypes II, III and IV were attributed to the first panzootic (Yu et

al., 2001) while genotype V to the second panzootic (Ballagi-Pordany et al., 1996;

Lomniczi et al., 1998). The viruses of genotype VII are responsible for the third panzootic

and have been causing most of the recent outbreaks (Liu et al., 2007; Miller et al., 2009,

2010). The fourth panzootic which overlapped the third one in terms of time frame is

being caused by genotype VI viruses that primarily infects pigeon and dove (Ballagi-

Pordany et al., 1996; Lomniczi et al., 1998; Aldous et al., 2004 ). The field virus isolates

from a chicken and a pigeon of Bangladesh, characterized in the present study, also belong to

44 

 

genotype VII and genotype VI, respectively. On the other hand, the vaccine strain BD-Vac01

belonged to more classical genotype II viruses.

The amino acid sequence at fusion protein cleavage site has been postulated as a major

determinant of NDV virulence (Millar et al., 1988). Analysis of this cleavage site was used

for determining the pathogenicity of NDV instead of conventional method such as Mean

Death Time (MDT) and Intracerebral Pathogenicity Index (ICPI) tests (Seal et al., 1995;

Marin et al., 1996; Alexander, 1997; Gould et al., 2001). Fewer basic amino acids are

present in fusion protein cleavage site of lentogenic strain than that in the protein of either

mesogenic or velogenic NDV strains (Seal et al., 1995). Study revealed that the two local

isolates BD-C162/10 and BD-P01/10 maintained the common motif of 112RRQKRF117 at

fusion protein cleavage site which was consistent with the characteristics of velogenic

strain, indicating that they may be virulent strains. On the other hand, the Bangladeshi

vaccine isolate BD-Vac01 possessed 112GRQGRL117 motif at fusion protein cleavage site,

suggesting that it was a lantogenic strain. Although Collins et al., 1994 reported that 2 of

15 NDV isolates had the virulent motif of 112RRQKRF117 at F0 cleavage site but

pathogenicity index tests revealed that these isolates were of mesogenic and lentogenic

types. So, in vivo pathogenic characterization is required for the confirmation of the

virulence of the local isolates.

The five major epitopes on F protein of NDV were previously mapped (Toyoda et al.,

1988 and Yusoff et al., 1989). The stretch of amino acids from residues 157-171 and

individual residues 72, 78, 79 and 343 were critical for both the structures and functions of

these epitopes (Chen et al., 2001). Individual residues at positions 72, 78 and 79 were

conserved in the Bangladeshi NDV isolates along with most of the strains included in the

analysis. However, further cross protection test is necessary to check if any antigenic

variations exist between the chicken and pigeon isolates of Bangladesh.

In conclusion, NDV from allantoic fluid and the vaccine virus was successfully detected

by RT-PCR. The chicken and pigeon isolates of NDV from Bangladesh belonged to

genotype VIIb anf genotype VI. Deduced amino acid sequences at the F0 cleavage site

suggest that both the chicken and pigeon isolate of Bangladesh are of velogenic pathotype.

45 

 

Further studies should focus on:

1. Pathogenic characterization of the Bangladeshi isolates based on mean embryo

death time and intracerebral pathogenicity index.

2. In vivo testing of the pigeon isolate for the pathogenicity for chickens.

3. Antigenic characterization of the chicken and pigeon isolates by cross-

neutralization test.

 

  46

REFERENCES

Abolnik, C.; Gerdes, G. H.; Kitching, J.; Swanepoel, S.; Romito, M. and Bisschop, S. P.

R. (2008). Characterization of pigeon paramyxoviruses (Newcastle disease virus)

isolated in South Africa from 2001 to 2006. Onderstepoort Journal of Veterinary

Research, 75:147–152.

Abolnik, C.; Horner, R. F.; Bisschop, S. P. R.; Parker, M. E.; Romito, M. and Viljoen, G.

J. (2004). A phylogenetic study of South African Newcastle disease virus strains

isolated between 1990 and 2002 suggests epidemiological origins in the Far East.

Archive of Virology, 149: 603-619.

Ackerman, W. W. (1964). Cell surface phenomena of Newcastle disease virus. In: R.P.

Hanson (ed.). Newcastle disease virus an evolving pathogen. University of

Wisconsin Press, Medison. WI. pp. 153-166.

Adi, A. A.; Astawa, N. M.; Putra, K. S.; Hayashi, Y. and Matsumoto, Y. (2010). Isolation

and characterization of a pathogenic Newcastle disease virus from a natural case in

Indonesia. Journal of Veterinary Medical Science, 72: 313-319.

Aldous, E. W. and Alexander, D. J. (2001). Detection and differentiation of Newcastle

disease virus (avian paramyxovirus type 1). Avian Pathology, 30: 117-128.

Aldous, E. W.; Collins, M. S.; McGoldrick, A. and Alexander D. J. (2001). Rapid

pathotyping of Newcastle disease virus (NDV) using fluorogenic probes in a PCR

assay. Veterinary Microbiology, 80: 201-212.

Aldous, E. W.; Fuller, C. M.; Mynn, J. K. and Alexander, D. J. (2004). A molecular

epidemiological investigation of isolates of the variant avian paramyxovirus type 1

virus (PPMV-1) responsible for the 1978 to present panzootic in pigeons. Avian

Pathology, 33: 258-269.

Aldous, E. W.; Mynn, J. K.; Banks, J. and Alexander, D. J. (2003). A molecular

epidemiological study of avian paramyxovirus type 1 (Newcastle disease virus)

  47

isolates by phylogenetic analysis of a partial nucleotide sequence of the fusion

protein gene. Avian Pathology, 32: 239-256.

Alexander D. J. and Allan W. H. (1974). Newcastle disease virus pathotypes. Avian

Pathology, 3: 269-278.

Alexander D. J.; Campbell, G.; Manvell, R. J; Collins, M. S.; Parsons, G. and McNulty,

M. S. (1992). Characterization of an antigenically unusual virus responsible for

two outbreaks of Newcastle disease in the Republic of Ireland in 1990. Veterinary

Record, 130: 65-68.

Alexander, D. J. (1988). Historical aspects, p. 1–10. In: D. J. Alexander (ed.), Newcastle

disease. Kluwer Academic Publishers, Boston, MA.

Alexander, D. J. (1988b). Newcastle disease diagnosis. In: Alexander, D. J. (Ed.),

Newcastle Disease. Kluwer Academic Publishers, Boston, 147-160.

Alexander, D. J. (1997). Newcastle disease and avian paramyxovirus infections. In:

Calnek, B. W.; Bernes, H. J.; Beard, C. W. and McDougald, L. R. (ed.), Disease of

poultry, 10th edition. Iowa State University Press, Ames. Pp. 541-569.

Alexander, D. J. (1998). Newcastle disease and other avian Paramyxovirus. In: A

laboratory manual for the isolation and identification of avian pathogens, 4th ed.

Swayne, D.; Glisson, J. R.; Jackwood, M. W.; Pearson, J. E. and Reed, W. M. eds.

American Association of Avian Pathologists, Kennett Square, PA. pp. 156-163.

Alexander, D. J. (2000). Newcastle disease and other avian paramyxoviruses. Review of

Science and Technology, 19: 443-462.

Alexander, D. J. (2003). Newcastle disease and other Paramyxoviridae infections. In:

Diseases of poultry, 11th ed. Saif, Y. M.; Barnes, H. J.; Glisson, J. R.; Fadly, A.

M.; McDougald, L. R. and Swayne, D. E. eds. Iowa State University Press, Ames,

IA. pp. 63-87.

  48

Alexander, D. J. and Senne, D. A. (2008). In: Diseases of Poultry, ed. by. Saif, Y. M.;

Fadly, A. M.; Glisson, J. R.; McDougald, L. R.; Nolan, L. K.; Swayne, D. E.

Blackwell, Ames, pp. 75-100.

Alexander, D. J., Manvell, R. J., Lowings, P., Frost, K. M., Collins, M. S., Russell, P. and

Smith, J. (1997). Antigenic diversity and similarities detected in avian

paramyxovirus type 1 (Newcastle disease virus) isolates using monoclonal

antibodies. Avian Pathology, 26: 399-418.

Alexander, D. J.; Banks, J.; Collins, M. S.; Manvell, R. J.; Frost, K. M.; Speidel, E. C. and

Aldous, E. W. (1999). Antigenic and genetic characterization of Newcastle disease

viruses isolated from outbreaks in domestic fowl and turkeys in Great Britain

during 1997. Veterinary Record, 145: 417-421.

Alexander, D. J.; Pearson, G. and Marshall, R. (1984). Infection of fowl with Newcastle

disease virus by food contaminated with pigeon feces. Veterinary Record, 115:

601-602.

Al-Garib, S. O.; Gielkens, A. L. J.; Gryus, E. and Koch, G. (2003). Review of Newcastle

disease virus with particular reference to immunity and vaccination. World’s

Poultry Science Journal, 59: 185-200.

Asahara. (1978). Study on the virulence of Newcastle disease virus. Kitasato Archives of

Experimental Medicine, 51:15-29.

Ballagi-Pordany, A.; Wehmann, E.; Herczeg, J.; Belak, S. and Lomniczi, B. (1996).

Identification and grouping of Newcastle disease virus strains by restriction site

analysis of a region from the F gene. Archives of Virology, 141: 243-261.

Bangladesh Bureau of Statistics. (2009). Livestock and Poultry Survey - 2009. Planning

Division, Ministry of Planning. Government of the People’s Republic of

Bangladesh.

Barman, L. R.; Islam, M. N.; Flensburg, M. F.; Permin, A.; Petersen, S. L. and Islam, M.

R. (2010). Newcastle disease vaccination regimen comprising both Lentogenic and

  49

Mesogenic strains is more effective than Lentogenic strain only. Bangladesh

Veterinary Journal, 27: 1-7.

Barton, J. T.; Bickford, A. A.; Cooper, G. L.; Charlton, B. R. and Cardona, C. J. (1992).

Avian paramyxovirus type 1 infections in racing pigeons in California. I. Clinical

signs, pathology and serology. Avian Diseases, 36: 463-468.

Beach, J. R. (1942). Avian Pneumoencephalitis. North American Veterinary Journal, 24:

288-292.

Beach, J. R. (1948). The application of hemagglutination inhibition test in the diagnosis of

avian pneumoencephalitis (Newcastle disease). Journal of American Veterinary

Medical Association, 112: 85-91.

Beard, C. W. and Hanson, R. P. (1984). Newcastle disease, In: Hofstad, M. S.; Barnes, H.

J.; Calnek, B. W.; Reid, W. M. and Yoder H. W. (ed.). Disease of poultry, 8th ed.

Iowa State University Press, Ames, IA, pp. 452-470.

Beläk, S. and Thorén, P. (2004). Validation and quality control of polymerase chain

reaction methods used for the diagnosis of infectious diseases, p. 30–36. In OIE

Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, 5th ed. Office

International des Epizooties, Paris, France.

Berhanu, A.; Ideris, A.; Omar, A. R. and Bejo, M. H. (2010). Molecular characterization

of partial fusion gene and C-terminus extension length of haemagglutinin-

neuraminidase gene of recently isolated Newcastle disease virus isolates in

Malaysia. Virology Journal, 7: 183, doi:10.1186/1743-422X-7-183.

Blaxland, J. D. (1951). Newcastle disease in shags and comorants and its significance as a

factor in the spread of this disease among domestic poultry. Veterinary Record, 63:

731-733.

Box, P. G.; Helliwell, B. I. and Halliwell, P. H. (1970). Newcastle disease in turkeys.

Veterinary Record, 86: 524-527.

  50

Brown, C.; King, D. J. and Seal, B. S. (1999). Pathogenesis of Newcastle Disease in

Chickens Experimentally Infected with Viruses of Different Virulence. Veterinary

Pathology, 36: 125-132.

Burnet, F. M. (1942). The affinity of Newcastle disease virus to the influenza virus group.

Australian Journal of Experimental Biology and Medical Science, 20: 81-88.

Chambers, P.; Millar, N. S.; Bingham, R. W. and Emmerson, P. T. (1986). Molecular

cloning of complementary DNA to Newcastle disease virus, and nucleotide

sequence analysis of the junction between the genes encoding the haemagglutinin-

neuraminidase and the large protein. Journal of General Virology, 67: 475-486.

Chang, P. W. (1981). Newcastle disease. In: CRC Handbook Series in Zoonoses. Section

B: Viral Zoonoses Volume II, Beran, G. W. (ed.) CRC Press, Boca Raton, Florida,

USA, 261-274.

Chauhan, H. V. S. and Roy, S. (1996). Poultry Disease, Diagnosis and Treatment. 2nd ed.

New Age International (P) Limited Publishers, New Delhi. pp. 58-64.

Chen, L.; Gorman, J. J.; McKimm-Breschkin, J.; Lawrence, L. J.; Tulloch, P. A.; Smith,

B. J.; Colman, P. M. and Lawrence, M. C. (2001). The structure of the fusion

glycoprotein of Newcastle disease virus suggests a novel paradigm for the

molecular mechanism of membrane fusion. Structure, 9: 255-266.

Chowdhury, T. I. M. F. R.; Sarker, A. J.; Amin, M. M. and Hossain, W. I. M. A. (1982).

Studies on Newcastle disease in Bangladesh. A Research Report, Bangladesh

Agricultural University, Mymensingh, Bangladesh.

Collins, M. S.; Bashiruddin, J. B. and Alexander, D. J. (1993). Deduced amino acid

sequences at the fusion protein cleavage site of Newcastle disease virus showing

variation in antigenicity and pathogenicity. Archives of Virology, 128: 363-370.

Collins, M. S.; Strong, I. and Alexander, D. J. (1994). Evaluation of the molecular basis of

pathogenicity of the variant Newcastle disease viruses termed “pigeon PMV-1

viruses. Archives of Virology, 134: 403-411.

  51

Collins, M. S.; Strong, I. and Alexander, D. J. (1996). Pathogenicity and phylogenetic

evaluation of the variant Newcastle disease viruses termed ‘pigeon PMV-1 viruses’

based on the nucleotide sequences of the fusion protein gene. Archives of Virology,

141: 635-647.

Cooper, H. (1931). Ranikhet disease: A new disease of fowl in India due to a filter passing

virus. Indian Journal of Veterinary Science and Animal Husbandry, 1: 107-123.

Crawford, M. (1930). Ranikhet disease. Annual Report of Government Veterinary

Surgeon, Colombo, Ceylon.

Csatary, L. K.; Csatary, E. and Moss R. W. (2000). Scientific interest in Newcastle disease

virus is reviving. Journal of National Cancer Institute, 92: 493-494.

Czeglédi, A.; Ujvári, D.; Somogyi, E.; Wehmann, E.; Werner, O. and Lomniczi, B.

(2006). Third genome size category of avian paramyxovirus serotype 1 (Newcastle

disease virus) and evolutionary implications. Virus Research, 120: 36-48.

de Leeuw, O. and Peeters, B. (1999). Complete nucleotide sequence of Newcastle disease

virus: evidence for the existence of a new genus within the subfamily

Paramyxovirinae. Journal of General Virology, 80: 131-136.

Dekock, G. (1954). Studies on the histological and pathogenesis of ND of fowls in South

Africa with special reference to the lymphoid tissue. Onderstepoort Journal of

Veterinary Research, 26: 599-620.

Department of livestock Services (DLS). (2008). Poultry sector review Bangladesh.

ftp://ftp.fao.org/docrep/fao/011/ai319e/ai319e00.pdf.

Digioia, G. A.; Licciardello, J. J.; Nickerson, J. J. R. and Goldblith, S. A. (1970). Thermal

inactivation of Newcastle disease virus. Applied Microbiology, 9: 451-454.

Doyle, T. M. (1927). A hitherto unrecorded disease of fowls due to a filter-passing virus.

Journal of Comparative Pathology and Theriogenology, 48: 1-20.

Edwards, J. T. (1928). A new fowl disease. Annual Report of Institute of Veterinary

Research, Mukteswar, pp. 15-15.

  52

Elankumaran, S.; Rockemann, D. and Samal, S. K. (2006). Newcastle Disease Virus

Exerts Oncolysis by both Intrinsic and Extrinsic Caspase-Dependent Pathways of

Cell Death. Journal of Virology, 80: 7522-7534.

Emmerson, P. T. (1999). Newcastle disease virus (Paramyxoviridae); Virology and

Microbiology; Academic press. University of Newcastle upon Tyne, UK.

Erickson, G. A.; Mare´, C. J.; Gustafson, G. A.; Miller, L. D. and Carbrey, E. A. (1977).

Interactions between viscerotropic velogenic Newcastle disease virus and pet birds

of six species. II. Viral evolution through bird passage. Avian Disease, 21: 655-

669.

Farkas, T.; Szekely, E.; Belak, S. and Kiss, I. (2009). Real-time PCR-based pathotyping of

Newcastle disease virus by use of TaqMan minor groove binder probes. Journal of

Clinical Microbiology, 47: 2114-2123.

French, E. L.; St. George, T. D. and Percy, J. J. (1967). Infection of chicks with recently

isolated Newcastle disease virus of low virulence. Australian Veterinary Journal,

43: 403-409.

Fujii, Y.; Sakaguchi, T.; Kiyotani, K. and Yoshida T. (1999). Comparison of substrate

specificities against the fusion glycoprotein of virulent Newcastle disease virus

between a chick embryo fibroblast processing protease and mammalian subtilisin-

like proteases. Microbiology and Immunology, 43:133-40.

Fuller, C. M.; Collins, M. S. and Alexander, D. J. (2009). Development of a real-time

reverse transcription PCR for the detection and simultaneous pathotyping of

Newcastle disease virus isolates using a novel probe. Archive of Virology, 154:

929-937.

Garten, E; Burke, W.; Nagai, Y.; Rott, R. and Klenk, H. D. (1980). Mutational changes of

the protease susceptibility of glycoprotein F of Newcastle disease virus: Effects on

Pathogenicity. Journal of General virology, 50: 135-147.

Glaser, L. C.; Barker, I. K.; Chip Weseloh, D. V.; Ludwig, J.; Windingstad, R. M.; Key,

D. W. and Bollinger, T. K. (1999). The 1992 epizootic of Newcastle disease in

  53

double-crested comorants in North America. Journal of Wildlife Disease, 35: 319-

330.

Glickman, R. L.; Syddall, R. J.; Iorio, R. M.; Sheehan, J. P. and Bratt, M. A. (1988).

Quantitative basic residue requirements in the cleavage-activation site of the fusion

glycoprotein as a determinant of virulence for Newcastle disease virus. Journal of

Virology, 62: 354-356.

Gohm, D. S.; Barbara, T. and Hofmann, M. A. (2000). Detection of Newcastle disease

virus in organs and feces of experimentally infected chickens using RT-PCR.

Avian Pathology, 29: 143-152.

Gomez-Lillo, M.; Bankowski, R. A. and Wiggins, A. D. (1974). Antigenic relationship

among viscerotropic velogenic and domestic strains of Newcastle disease virus.

American Journal of Veterinary Research, 35: 471-475.

Gould, A. R.; Hansson, E.; Selleck, K.; Kattenbelt, J. A.; Mackenzie, M. and Della- Porta,

A. J. (2003). Newcastle disease virus fusion and haemagglutinin-neuraminidase

gene motifs as markers for viral lineage. Avian Pathology, 32: 361-373.

Gould, A. R.; Kattenbelt, J. A.; Selleck, P.; Hansson, E.; Della-Porta, A. and Westbury, H.

A. (2001). Virulent Newcastle disease in Australia: Molecular epidemiological

analysis of viruses isolated prior to and during the outbreaks of 1998–2000. Virus

Research, 77: 51-60.

Hamid, H.; Campbell, R. S. F. and Lamichhane, C. (1990). The pathology of infection of

chickens with the lentogenic V4 strain of Newcastle disease virus. Avian

Pathology, 19: 687-696.

Hanson, R. P. (1956). An intracerebral inoculation test for determining the safety of NDD

vaccines. American Journal of Veterinary Research, 17:16-17.

Hanson, R. P. (1988). Heterogeneity within strains of Newcastle disease virus: Key to

survival. In: Alexander (ed.). Newcastle disease. Kluwer Academic Publishers,

Boston, MA, pp. 113-130.

  54

Hanson, R. P.; Spalatin, J. and Jacobson, G. S. (1973). The viscerotrophic pathotype of

Newcastle disease virus. Avian Disease, 17: 354-361.

Hassan, W.; Ahmed, S.; Khair, M; Mochotlhoane, B. and Abolnik, C. (2010). Newcastle

disease outbreaks in the Sudan from 2003 to 2006 were caused by viruses of

genotype 5d. Virus Genes, 40: 106-110.

Heckert, R. A.; Collins, M. S.; Manvell, R. J.; Strong, I.; Pearson, J. E. and Alexander, D.

J. (1996). Comparison of Newcastle disease viruses isolated from cormorants in

Canada and the USA in 1975, 1990 and 1992. Canadian Journal of Veterinary

Research, 60: 50-54.

Herczeg, J.; Pascucci, S.; Massi, P.; Luini, M.; Selli, L.; Capua, I. and Lomniczi, B.

(2001). A longitudinal study of velogenic Newcastle disease virus genotypes

isolated in Italy between 1960 and 2000. Avian Pathology, 30: 163-168.

Herczeg, J.; Wehmann, E.; Bragg, R. R.; Travassos, D. P. M.; Hadjiev, G.; Werner, O. and

Lomniczi, B. (1999). Two novel genetic groups (VIIb and VIII) responsible for

recent Newcastle disease outbreaks in southern Africa, one (VIIb) of which

reached southern Europe. Archives of Virology, 144: 2087-2099.

Hu, B.; Huang, Y.; He, Y.; Xu, C.; Lu, X.; Zhang, W.; Meng, B.; Yan, S. and Zhang, X.

(2010). Avian influenza virus and Newcastle disease virus (NDV) surveillance in

commercial breeding farm in China and the characterization of class I NDV

isolates. Veterinary Microbiology, 144: 82-86.

Islam, M. A.; Ito, T. and Kida, H. (1995). Comparison of the hemagglutinin pattern and

pathotype activities of some Japanese isolates of Newcastle disease virus with

reference strains. Bangladesh Veterinary Journal, 29:1-8.

Islam, M. R.; Giasuddin, M.; Samad, M. A.; Taimur, M. J. F. A.; Baqui, M. A.; Mahbub-

E-Elahi, A.T.M. and Amin, M. M. (2008). Phylogenetic analysis of highly

pathogenec avian influenza (H5N1) virus isolates of Bangladesh. A sutdy on

highly pathogenic avian influenza in Bangladesh Livestock Research Institute

Savar, Dhaka.

  55

Jarecki Black, J. C.; Bennett, J. D. and Palmieri, S. (1992). A novel oligonucleotide probe

for the detection of Newcastle disease virus. Avian Diseases, 36: 134-138.

Jarecki-Black, J. C. and King, D. J. (1993). An Oligonucleotide probe that distinguishes

isolates of low virulence from the more pathogenic strains of Newcastle disease

virus. Avian Disease, 37: 724-730.

Jestin, V. and Cherbonnel, M. (1992). Use of monoclonal antibodies and gene

amplification (PCR) for characterisation of a-PMV–1 strains. Proceedings CEC

Workshop on Avian Paramyxoviruses, Rauischholhausen, Institut

Geflugelkrankheiten, Giessen, (pp. 157–166).

Jestin, V. and Jestin, A. (1991). Detection of Newcastle disease virus RNA in infected

allantoic fluids by in vitro enzymatic amplification (PCR). Archives of Virology,

118, 151–161.

Jestin, V.; Cherbonnel, M. and Arnauld, C. (1994). Direct identification and

characterization of A-PMV1 from suspicious organs by nested PCR and automated

sequencing. Proceedings of the Joint First Annual Meetings of the National

Newcastle Disease and Avian Influenza Laboratories of the European

Communities, 1993 (pp. 89-97). Brussels, Belgium.

Jindal, N.; Chander, Y.; Chockalingam, A. K.; de Abin, M.; Redig, P. T. and Goyal, S. M.

(2009). Phylogenetic analysis of Newcastle disease viruses isolated from

waterfowl in the upper Midwest region of the United States. Virology Journal, 6:

191; doi: 10.1186/1743-422X-6-191.

Jordan, I. K.; Sutter IV, B. A. and McClure, M. A. (2000). Molecular evolution of the

paramyxoviridae multiple-protein-encoding P gene. Molecular biology and

evolution, 17: 75-86.

Jørgensen P. H.; Herczeg, J.; Lomniczi, B.; Manvell, R. J.; Holm, E. and Alexander D. J.

(1998). Isolation and characterization of avian paramyxovirus type 1 (Newcastle

disease) viruses from a flock of ostriches (Struthio camelus) and emus (Dromaius

novaehollandiae) in Europe with inconsistent serology. Avian Pathology, 27: 352-

8.

  56

Jungherr, E. L. (1964). Pathogenicity of NDV for the chicken. In: Hanson, R. P. (ed).

Newcastle disease virus. An evolving Pathogens. University of Wisconsin,

Medison. pp. 257-272.

Jungherr, E. L. and Terrell, N. (1946). Observation on the spread of ND. Proceeding in

Annual Meeting in US Livestock Sanitary Association. 50: 158-171.

Kafi, M. A.; Rahman, M. B.; Amin, M. M.; Islam, M. R.; Rahman, M. M. and Rahman,

M. K. (2003). Comparative serological responses and protection conferred by

vaccination with V4HR and BCRDV in chickens. Bangladesh Journal of

Veterinary Medicine, 1: 25-27.

Kaleta, E. F. and Baldauf, C. (1998). Newcastle disease in free-living and pet birds. In:

Alexander, D. J. (Ed.), Newcastle Disease. Kluwer Academic Publishers, Boston,

pp. 184-196.

Kant, A.; Koch, G.; Van Riizelaar, D. J.; Balk, F. and Ter Huurne, A. (1997).

Differentiation of virulent and non-virulent strains of Newcastle disease virus

within 24 hours by polymerase chain reaction. Avian Pathology, 26: 837-849.

Kathryn, A. G. and Turdy, G. M. (2003). Interacting domains of the HN and F proteins of

Newcastle disease virus. Journal of virology, 77: 11040-11049.

Kattenbelt, J. A.; Meers, J. and Gould, A. R. (2006). Genome sequence of the

thermostable Newcastle disease virus (strain I-2) reveals a possible phenotypic

locus. Veterinary Microbiology, 114: 134-141.

Ke, G. M.; Yu, S. W.; Ho, C. H.; Chu, P. Y.; Ke, L. Y.; Lin, K. H.; Tsai, Y. C.; Liu, H. J.

and Lin, M. Y. (2010). Characterization of newly emerging Newcastle disease

viruses isolated during 2002-2008 in Taiwan. Virus Research, 147: 247-257.

Kho, C. L.; Mohd Azmi, M. L.; Arshad, S. S. and Yusoff, K. (2000). Performance of an

RT-nested PCR ELISA for detection of Newcastle disease virus. Journal of

Virological Methods, 86: 71-83.

  57

Kim, L. M.; King, D. J.; Curry, P. E.; Suarez, D. L.; Swayne, D. E.; Stallknecht, D. E.;

Slemons, R. D.; Pedersen, J. C.; Senne, D. A.; Winker, K. and Afonso, C. L.

(2007a). Phylogenetic diversity among low-virulence Newcastle disease viruses

from waterfowl and shorebirds and comparison of genotype distributions to those

of poultry-origin isolates. Journal of Virology, 81: 12641-12653.

Kim, L. M.; King, D. J.; Suarez, D. L.; Wong, C. W. and Afonso, C. L. (2007b).

Characterization of class I Newcastle disease virus isolates from Hong Kong live

bird markets and detection using real-time reverse transcription-PCR. Journal of

Clinical Microbiology, 45: 1310-1314.

King, D. J. and Seal, B. S. (1997). Biological and molecular characterization of Newcastle

disease virus isolates from surveillance of live bird markets in the northeastern

United States. Avian Diseases, 41: 683-689.

Kommers, G. D.; King, D. J.; Seal, B. S.; Carmichael, K. P. and Brown, C. C. (2002).

Pathogenesis of Six Pigeon-Origin Isolates of Newcastle Disease Virus for

Domestic Chickens. Veterinary Pathology, 39: 353-362.

Kou, Y. T.; Chueh, L. L. and Wang, C. H. (1999). Restriction fragment length

polymorphism analysis of the F gene of Newcastle disease viruses isolated from

chickens and an owl in Taiwan. Journal of Veterinary Medical Science, 61: 1191-

1195.

Krapež, U.; Steyer, A. F.; Slavec, B.; Barlič-Maganja, D.; Dovč, A.; Račnik, J. and Rojs,

O. Z. (2010). Molecular characterization of avian paramyxovirus type 1

(Newcastle disease) viruses isolated from pigeons between 2000 and 2008 in

Slovenia. Avian Diseases, 54: 1075-1080.

Krishnamurthy, S. and Samal, S. K. (1997). Nucleotide sequences of the trailer,

nucleocapsid protein genome sequence. Journal of General Virology, 79: 2419-24.

Kuiken, T.; Wobeser, G.; Leighton, F. A.; Haines, D. M.; Chelack, B.; Bogdan, J. B.;

Hassard L.; Heckert, R. A. and Riva, J. (1999). Pathology of Newcastle Disease in

Double-Crested Cormorants from Saskatchewan, with comparison of diagnostic

methods. Journal of Wildlife Diseases, 35: 8-23.

  58

Kwon, H. -J.; Cho, S. -H.; Ahn, Y. -J.; Seo, S. -H.; Choi, K. -S.; Kim, S. -J. (2003).

Molecular epidemiology of Newcastle disease in the Republic of Korea. Veterinary

Microbiology, 95: 39-48.

Lam, K. M. and Vasconcelos, A. C. (1994). Newcastle disease virus-induced apoptosis in

chicken peripheral blood lymphocytes. Veterinary Immunology and

Immunopathology, 44: 45-56.

Lamb, R. A. and Kolakofsky, D. (1996). Paramyxoviridae: The viruses and their

replication, p. 557–604. In: Fundamental virology. (Fields B. N.; Knipe D. M. and

Howley P. M. eds.) Lippincott-Raven, Philadelphia, PA.

Lamb, R. A. and Kolakofsky, D. (2001). Paramyxoviridae: the viruses and their

replication. In: Knipe, D.M. and Howley, P.M. (ed), Fields virology, 3rd edi, vol. 1.

Lippincott Wilkins, Philadelphia, Pa. pp. 1305-1340.

Lancaster, J. E. (1966). Newcastle disease - A review 1926-1946. Monograph No.3.

Canadian Department of Agriculture, Ottawa.

Lancaster, J. E. and Alexander, D. J. (1975). Newcastle disease virus and spread.

Monograph No.11, Candian Department of Agriculture, Ottawa.

Lee, E. K.; Jeon, W. J.; Kwon, J. H.; Yang, C. B.; Choi, K. S. (2009). Molecular

epidemiological investigation of Newcastle disease virus from domestic ducks in

Korea. Veterinary Microbiology, 134: 241-248.

Lee, Y. J.; Sung, H. W.; Choi, J. G.; Kim, J. H. and Song, C. S. (2004). Molecular

epidemiology of Newcastle disease viruses isolated in South Korea using

sequencing of the fusion protein cleavage site region and phylogenetic

relationships. Avian Pathology, 33: 482-491.

Liang, R.; Cao, D. J.; Li, J. Q.; Chen, J.; Guo, X.; Zhuang F. F. and Duan, M. X. (2002).

Newcastle disease outbreaks in western China were caused by the genotypes VIIa

and VIII. Veterinary Microbiology, 87: 193-203.

  59

Lien, Y. Y.; Lee, J. W.; Su, H. Y.; Tsai, H. J.; Tsai, M. C.; Hsieh, C. Y. and Tsai, S. S.

(2007). Phylogenetic characterization of Newcastle disease viruses isolated in

Taiwan during 2003–2006. Veterinary Microbiology, 123: 194-202.

Liu, H.; Chen, F.; Zhao, Y.; Zheng, D.; Li, J.; Xu, T.; Qi, L. and Wang, Z. (2010).

Genomic characterization of the first class I Newcastle disease virus isolated from

the mainland of China. Virus Genes, 40: 365-371.

Liu, H.; Wang, Z.; Wu, Y.; Zheng, D.; Sun, C.; Bi, D.; Zuo, Y. and Xu, T. (2007).

Molecular epidemiological analysis of Newcastle disease virus isolated in China in

2005. Journal of Virological Methods, 140: 206-211.

Liu, H.; Zhao, Y.; Zheng, D.; Lv, Y.; Zhang, W; Xu, T.; Li, J. and Wang, Z. (2011).

Multiplex RT-PCR for rapid detection and differentiation of class I and class II

Newcastle disease viruses. Journal of Virological Method, 171: 149-155.

Liu, X. F.; Wan, H. Q.; Ni, X. X.; Wu, Y. T. and Liu, W. B. (2003). Pathotypical and

genotypical characterization of strains of Newcastle disease virus isolated from

outbreaks in chicken and goose flocks in some regions of China during 1985-2001.

Archives of Virology, 148: 1387-1403.

Liu, X.; Wang, X.; Wu, S.; Hu, S.; Peng, Y. and Xue, F. (2009). Surveillance for avirulent

Newcastle disease viruses in domestic ducks (Anas platyrhynchos and Cairina

moschata) at live bird markets in Eastern China and characterization of the viruses

isolated. Avian Pathology, 38: 377-391.

Lomniczi, B.; Wehmann, E.; Herczeg, J.; Ballagi-Pordany, A.; Kaleta, E. F.; Werner, O.;

Meulemans, G.; Jorgensen, P. H.; Mante, A. P.; Gielkens, A. L. J.; Capua, I. and

Damoser, J. (1998). Newcastle disease outbreaks in recent years in Western

Europe were caused by an old (VI) and a novel genotype (VII). Archive of

Virology, 143: 49-64.

Lorence, R. M.; Roberts, M. S.; Groene, W. S. and Rabin, H. (2001). Replication-

competent, oncolytic Newcastle disease virus for cancer therapy. In: Driever PH,

Rabkin SD (eds): Replication-competent viruses for cancer therapy. Monographs

in Virology, 22: 160-182.

  60

Marin, M. C. (1996). Virus characterization and sequence of the fusion protein gene

cleavage site of recent Newcastle disease virus field isolates from the southeastern

United States and Puerto Rico. Avian Disease, 40: 382-390.

Marin, M. C.; Villegas, P.; Bennett, J. D. and Seal, B. S. (1996). Virus characterization

and sequence of the fusion protein gene cleavage site of recent Newcastle disease

virus field isolates from the southeastern United States and Puerto Rico. Avian

Diseases, 40: 382-390.

Martin, P. A. J. (1992). The epidemiology of Newcastle disease in village chickens. In:

Spardbrow, P. B. (Ed.), Newcastle Disease in Village chickens, Control with

Thermostable Oral Vaccines. In: Proceedings, International Workshop held in

Kaula Lumpur, Malaysia, 6-10 October 1991, Australian Centre for International

Agriculture Research (ACIAR), Canberra, pp. 40-45.

Mase, M.; Imai, K.; Sanada, Y.; Sanada, N.; Yuasa, N.; Imada, T.; Tsukamoto, K. and

Yamaguchi, S. (2002). Phylogenetic analysis of Newcastle disease virus genotypes

isolated in Japan. Journal of Clinical Microbiology, 40: 3826-3830.

Mase, M.; Inoue, T. and Imada, T. (2009). Genotyping of Newcastle Disease Viruses

Isolated from 2001 to 2007 in Japan. Journal of Veterinary Medical Science, 71:

1101-104.

Mayo, M. A. (2002). A summary of taxonomic changes recently approved by ICTV.

Archive of Virology, 147: 1655-1663.

Mazumder A. C. (2010). Pathological and Virological Investigation of Avian Respiratory

Disease. MS Thesis, Department of Pathology, Bangladesh Agricultural

University, Mymensingh.

McFerran, J. B. and McCracken, R. M. (1988). Newcastle disease. In: Alexander, D.J.

(ed.). Newcastle disease. Kluwer Academic Publishers, Boston, MA, pp.161-183.

McGinnes, L.; McQuain, C. and Morrison, T. (1998). The P protein and the nonstructural

38K and 29K proteins of Newcastle disease virus are derived from the same open

reading frame. Virology, 164: 256-264.

  61

Melnick, J. L. (1982). Taxonomy and nomenclature of viruses. Progress in Medical

Virology, 28: 208-221.

Meteyer, C. U.; Docherty, D. E.; Glaser, L. C.; Franson, J. C.; Senne, D. A. and Duncan,

R. (1997). Diagnostic findings in the 1992 epornitic of neurotropic velogenic

Newcastle disease in double-crested cormorants from the upper Midwestern United

States. Avian Disease, 41: 171-180.

Millar N. S.; Chambers, P. and Emmerson, P. T. (1988). Nucleotide sequence of the fusion

and hemagglutinin-neuraminidase glycoprotein genes of Newcastle disease virus,

strain Ulster: molecular basis for variations in pathogenicity between strains.

Journal of General Virology, 69: 613-20.

Miller, P. J.; Decanini, E. L. and Afonso, C. L. (2010). Newcastle disease: evolution of

genotypes and the related diagnostic challenges. Infection, Genetics and Evolution,

10: 26-35.

Miller, P. J.; Kim, L. M.; Ip, H. S. and Afonso, C. L. (2009). Evolutionary dynamics of

Newcastle disease virus. Virology, 391: 64-72.

Mishra, S.; Kataria, J. M.; Sah, R. l.; Verma, K. C. and Mishra, J. P. (2000). Pathogenesis

of Newcastle disease virus isolates in pigeon. Indian Journal of Animal Science,

70: 1125-1126.

Mohamed, M. H. A.; Kumar, S.; Paldurai, A. and Samal, S. K. (2011). Sequence analysis

of fusion protein gene of Newcastle disease virus isolated from outbreaks in Egypt

during 2006. Virology Journal, 8: 237; doi: 10.1186/1743-422X-6-191.

Momayez, R.; Gharahkhani, P.; Pourbakhsh, S. A.; Toroghi, R.; Shoushtari, A. H. and

Banani, M. (2007). Isolation and pathogenicity identification of avian

paramyxovirus serotype 1 (Newcastle disease) virus from a Japanese quail flock in

Iran. Archive of Razi Institute, 62: 39-44.

Mushtaq, I.; Rizviand, F. and Ullah, M. S. (2006). Effect of Pigeon origin Newcastle

disease virus on various liver enzymes and associated pathological changes in

experimentally infected Pigeons. Pakistan Veterinary Journal, 26: 171-175.

  62

Nagai, Y.; Klenk, H-D and Rott, R. (1976). Proteolytic cleavage of the viral glycoproteins

and its significance for the virulence of Newcastle disease virus. Virology, 72: 484-

508.

Nakamura, K.; Ohtsu, N.; Nakamura, T.; Yamamoto, Y.; Yamada, M.; Mase, M. and Imai,

K. (2008). Pathologic and immunohistochemical studies of Newcastle disease

(ND) in broiler chickens vaccinated with ND: severe nonpurulent encephalitis and

necrotizing pancreatitis. Veterinary Pathology, 45: 928-33.

Nanthakumar, T.; Kataria, R. S.; Tiwari, A. K.; Butchaiah, G. and Kataria, J. M. (2000).

Pathotyping of Newcastle disease viruses by RT-PCR and restriction enzyme

analysis. Veterinary Research Communications, 24: 275-286.

Nguyen, T. D. (1992). Poultry production and Newcastle disease in Vietnam. In:

Spardbrow, P. B. (Ed.). Newcastle Disease in Village chickens, Control with

Thermostable Oral Vaccines. Proceedings, International Workshop held in Kaula

Lumpur, Malaysia, 6-10 October 1991, Australian Centre for International

Agriculture Research, ACIAR, Canberra, 169-170.

Nishikawa, K.; Isomura, S.; Suzuki, S.; Wanatabe, E.; Hamaguchi, M.; Yoshida, T. and

Negai, Y. (1983). Monoclonal antibody to the HN glycoprotein of Newcastle

disease virus. Biological characterization and use for strain comparisons. Virology,

130: 318-330.

Noor, M.; Rajib, D. M. M.; Chowdhury, E. H.; Islam, M. R. and Das, P. M. (2005).

Pathogenic characterization of Newcastle disease virus field isolates. Progressive

Agriculture, 16: 91-98.

Oberdorfer, A. and Werner, O. (1998). Newcastle disease virus: detection and

characterization by PCR of recent German isolates differing in pathogenicity.

Avian Pathology, 27: 237-243.

Office International des Epizootics (OIE). (2000). Newcaslte disease. In: Manual of

Standards for Diagnosis Test and Vaccine. 4th edi. OIE, Paris. Pp.189-207.

  63

Office International des Epizooties (OIE): Manual of Diagnostic Tests and Vaccines for

Terrestrial Animals. Paris 2009, Chapter 2.3.14: 576-589.

Okoye, J. O. A.; Agu, A. O.; Chineme, C. N. and Echeonwu, G. O. N. (2000). Pathologic

characterization in chickens of a velogenic Newcastle disease virus isolation from

Guinea fowl. Rev Med Vet Trop, 53: 325-330, Cited by Noor et al., 2005.

Panda, A.; Huang. Z.; Elankumaran, S.; Rockemann, D. D. and Samal, S. K. (2004). Role

of fusion protein cleavage site in the virulence of Newcastle disease virus.

Microbial pathogenesis, 36: 1-10.

Parede, L. and Young, P. L. (1990). The pathogenesis of virulent Newcastle disease virus

of chickens of different ages and different level of immunity. Avian Disease, 34:

803-808.

Park, Man-Seong; Garcia-Sastre, A.; Cors, J. F.; Basler, C. F. and Palese, P. (2003).

Newcastle disease virus V protein is a determinant of host range restriction.

Journal of Virology, 77: 9522-9532.

Pedersen, J. C.; Senne, D. A.; Woolcock, P. R.; Kinde, H.; King, D. J.; Wise, M. G.;

Panigraphy, B and Seal, B. S. (2004). Phylogenetic relationships among virulent

Newcastle disease virus isolates form the 2002-2003outbreaks in California and

other recent outbreaks in North America. Journal of Clinical Microbiology, 42:

2329-2334.

Peeters B. P.; De Leeuw, O. S.; Koch, G. and Gielkens, A. L. (1999). Rescue of Newcastle

disease virus from cloned cDNA: evidence that cleavability of the fusion protein is

a major determinant for virulence. Journal of Virology, 73: 5001-9.

Pennington, T. H. (1978). Antigenic difference between strains of NDV. Archives of

Virology, 56: 345-351.

Perozo, F.; Villegas, P.; Estevez, C.; Alvarado, I. and Purvis, L. B. (2006). Use of FTA

filter paper for the molecular detection of Newcastle disease virus. Avian

Pathology, 35: 93-98.

  64

Pham, H. M.; Konnai, S.; Usui, T.; Chang, K. S.; Murata, S.; Mase, M.; Ohashi, K. and

Onuma, M. (2005). Rapid detection and differentiation of Newcastle disease virus

by real-time PCR with melting-curve analysis. Archive of Virology, 150: 2429-

2438.

Radhavan, V. S.; Kumanan, K.; Thirumurugan, G. and Nachimuthu, K. (1998).

Comparison of various diagnostic methods in characterizing Newcastle disease

virus isolates from Desi chickens. Tropical Animal Health and Production, 30:

287-293.

Richardson, C. D.; Scheid, A. and Choppin, P. W. (1980). Specific inhibition of

paramyxovirus and myxovirus replication by oligopeptides with amino acid

sequences similar to those at the N-termini of the F1 or HA2 viral polypeptides.

Virology, 105: 205-222.

Romer-Oberdorfer, A.; Werner, O.; Veits, J.; Mebatsion, T. and Mettenleiter, T. C. (2003).

Contribution of the length of the HN protein and the sequence of the F protein

cleavage site to Newcastle disease virus pathogenicity. Journal of General

Virology, 84: 3121-3129.

Rott, R. (1985). In vitro differenzierung von pathogenen und apathogenen aviaren

influenzaviren. Ber Munch Tieraerztl Wochenschr, 98: 37-39. Cited by Noor et al.,

2005.

Roy, P.; Venugopalan, A. T.; Selvarangam, R. and Ramaswamy, V. (1998). Velogenic

Newcastle disease virus in captive wild birds. Tropical Animal Health and

Production, 30: 299-303.

Russell, P. H. and Alexander, D. J. (1983). Antigenic variation of Newcastle disease virus

strains detected by monoclonal antibodies. Archive of Virology, 75: 243-253.

Saha, S; Islam, M. A.; Rahman, M. M. and Alam, K. H. T. (1998). Efficacy of an

inactivated Newcastle disease virus vaccine prepared from a local isolate.

Bangladesh Veterinary Journal, 32: 57-62.

  65

Samson, A. C.; Levesley, I. and Russell, P. H. (1991). The 36K polypeptide synthesized in

Newcastle disease virus-infected cells possesses properties predicted for the

hypothesized V protein. Journal of General Virology, 72: 1709-1713.

Schaper, U. M.; Fuller, F. J.; Ward, M. D.; Mehrotra, Y.; Stone, H. O.; Stripp, B. R. and

De Buysscher, E. V. (1988). Nucleotide sequence of the envelope protein genes of

a highly virulent, neurotropic strain of Newcastle disease virus. Virology, 165:

291-295.

Scheid, A. and Choppin, P. W. (1974). Identification of biological activities of

paramyxovirus glycoproteins. Activation of cell fusion, hemolysis, and infectivity

by proteolytic cleavage of an inactive protein of Sendai virus. Virology, 57: 470-

90.

Schloer, G.; Spalatin, J. and Hanson, R. P. (1975). Newcastle disease virus antigens and

strains variation. American Journal of Veterinary Research, 36: 505-508.

Seal B. S.; King D. J. and Bennett J. B. (1995). Characterization of Newcastle disease

virus isolates by RT-PCR coupled to direct nucleotide sequencing and

development of sequence database for pathotype prediction and molecular

epidemiologic analysis. Journal of Clinical Microbiology, 33: 2624-30.

Seal, B. S. (1996). Analysis of matrix protein gene nucleotide sequence diversity among

Newcastle disease virus isolates demonstrates that recent disease outbreaks are

caused by viruses of psittacine origin. Virus Genes, 11: 217-224.

Seal, B. S.; King, D. J. and Sellers, B. S. (2000). The avian response to Newcastle disease

virus. Developmental Comparative Immunology, 24: 257-268.

Seal, B. S.; King, D. J.; Locke, D. P.; Senne, D. A. and Jackwood, M. W. (1998).

Phylogenetic relationships among highly virulent Newcastle disease virus isolates

obtained from exotic birds and poultry from 1989 to 1996. Journal of Clinical

Microbiology, 36: 1141-1145.

  66

Sergel-Germano, T; McQuain, C. and Morrison, T. G. (1994). Mutations in the fusion

peptide and heptad repeat regions of the Newcastle disease virus fusion protein

block fusion. Journal of Virology, 68: 7654-8.

Shengqing, Y.; Kishida, N.; Ito, H.; Kida, H.; Otsuki, K.; Kawaoka, Y. and Ito, T. (2002).

Generation of velogenic Newcastle disease viruses from a nonpathogenic

waterfowl isolate by passaging in chickens. Virology, 301: 206-211.

Singh, K.; Jindal, N.; Gupta, S. L.; Gupta, A. K. and Mittal, D. (2005). Detection of

Newcastle disease virus genome from the field outbreaks in poultry by Reverse

Transcription- Polymerase Chain Reaction. International Journal of Poultry

Science, 4: 472-475.

Spalatin, J.; Hanson, R. P. and Beard, P. D. (1970). The hemagglutination elution pattern

as marker in characterizing Newcastle disease virus. Avian disease, 14: 542-549.

Srinivasappa, G. B.; Snyder, D. B.; Marquardt, W. W. and King, D. J. (1986). Isolation of

a monoclonal antibody with specificity for commonly employed vaccine strains of

Newcastle disease virus. Avian Disease, 30: 562-567.

Stäuber, N.; Brechtbühl, K.; Bruckner, L. & Hofmann, M. A. (1995). Detection of

Newcastle disease virus in poultry vaccines using the polymerase chain reaction

and direct sequencing amplified DNA. Vaccine, 13: 360-364.

Steward, M.; Samson A. C.; Errington, W. and Emmerson, P. T. (1995). The Newcastle

disease virus V protein binds zinc. Archives of Virology, 140: 1321-1328.

Steyer, A. F.; Rojs, O. Z.; Krapež, U.; Slavec, B. and Barlič-Maganja, D. (2010). A

diagnostic method based on MGB probes for rapid detection and simultaneous

differentiation between virulent and vaccine strains of avian paramyxovirus type 1.

Journal of Virological Methods, 166: 28-36.

Talha, A. F. S. M.; Hossain, M. M.; Chowdhury, E. H.; Bari, A. S. M.; Islam, M. R. and

Das, P. M. (2001). Poultry diseases occurring in Mymensingh district of

Bangladesh. The Bangladesh Veterinarian, 18: 20-23.

  67

Tan, S. W.; Ideris, A.; Omar, A. R.; Yusoff, K. and Hair-Bejo, M. (2009). Detection and

differentiation of velogenic and lentogenic Newcastle disease viruses using SYBR

Green I real-time PCR with nucleocapsid gene-specific primers. Journal of

Virological Methods, 160: 149-156.

Tangredi B. P. (1985). Avian paramyxovirus type I infection in pigeons: clinical

observations. Avian Diseases, 29: 1252-1255.

Taylor, J.; Edbauer, C.; Rey-Senelonge, A.; Bouquet, J. F.; Norton, E.; Goebel, S.;

Desmettre, P. and Paoletti, E. (1990) . Newcastle disease virus fusion protein

expressed in a fowlpox virus recombinant confer protection in chickens. Journal of

Virology, 64: 1441-1450.

Toyoda, T.; Gotoh, B.; Sakaguchi, T.; Kida, H. and Nagai, Y. (1988). Identification of

amino acids relevant to three antigenic determinants on the fusion protein of

Newcastle disease virus that are involved in fusion inhibition and neutralization.

Journal of Virology, 62: 4427-4430.

Toyoda, T.; Sakaguchi, T.; Hirota, H.; Gotoh, B.; Kuma, K.; Miyata, T. and Nagai, Y.

(1989). Newcastle disease virus evolution. II. Lack of gene recombination in

generating virulent and avirulent strains. Virology, 169: 273-282.

Toyoda, T.; Sakaguchi, T.; Imai, K.; Inocencio, N. M.; Gotoh, B.; Hamaguchi, M. and

Nagai, Y. (1987). Structural comparison of the cleavage-activation site of the

fusion glycoprotein between virulent and avirulent strains of Newcastle disease

virus. Virology, 158: 242-247.

Tsai H. J.; Chang K. H.; Tseng, C. H.; Frost K. M.; Manvell R. J. and Alexander D. J.

(2004). Antigenic and genotypical characterization of Newcastle disease viruses

isolated in Taiwan between 1969 and 1996. Veterinary Microbiology, 104: 19-30.

Tsunekuni, R.; Ito, H.; Otsuki, K.; Kida, H. and Ito, T. (2010). Genetic comparisons

between lentogenic Newcastle disease virus isolated from waterfowl and velogenic

variants. Virus Genes, 40: 252-255.

  68

Ujvári, D. (2006). Complete nucleotide sequence of IT-227/82, an avian paramyxovirus

type-1 strain of pigeons (Columba livia). Virus Genes, 32: 49-57.

Usman, B. A. and Diarra, S. S. (2008). Prevalent Diseases and Mortality in Egg Type

Layers: An Overview. International Journal of Poultry Science, 7: 304-310.

Utterback, W. W. and Schwartz, J. H. (1973). Epizootology of velogenic viscerotropic

Newcastle Disease in Southern California 1971-1973. Journal of the American

Veterinary Medical Association, 163: 1080-1088.

Wan, S. X.; Gao, Q. Y. and Shao, Z. H. (1984). Pathomorphological model of

experimental infection with Beijing strain of Newcastle disease virus in chickens.

Chinese Journal of Veterinary Medicine, 10: 6-8.

Wang, L. C.; Pan, C. H.; Severinghaus, L. L.; liu, L. Y.; Chen, C. T.; Pu, C. E.; Huang, D.;

Lir, J. T.; Chin, S. C.; Cheng, M. C.; Lee, S. H. and Wang, C. H. (2008).

Simultaneous detection and differentiation of Newcastle disease and avian

influenza viruses using oligonucleotide microarrays. Veterinary Microbiology,

127: 217-226.

Wang, Z.; Liu, H.; Xu, J.; Bao, J.; Zheng, D.; Sun, C.; Wei, R.; Song, C. and Chen, J.

(2006). Genotyping of Newcastle Disease Viruses Isolated from 2002 to 2004 in

China. Annals of the New York Academy of Sciences, 1081: 228-239.

Wehmann, E.; Czegledi, A.; Werner, O.; Kaleta, E. and Lomniczi, B. (2003). Occurrence

of genotypes IV, V, VI and VIIa in Newcastle disease outbreaks in Germany

between 1939 and 1995. Avian Pathology, 32: 157-163.

Wehmann, E.; Herczeg, J.; Ballagi Pordany, A. and Lomniczi, B. (1997). Rapid

identification of Newcastle disease virus vaccine strains La Sota and B1 by

restriction site analysis of their matrix gene. Vaccine, 15: 1430-1433.

Weingartl, H. M.; Riva, J. and Kumthekar, P. (2003). Molecular characterization of avian

paramyxovirus I isolates collected from cormorants in Canada from 1995 to 2000.

Journal of Clinical Microbiology, 41: 1280-1284.

  69

Winslow, N. S.; Hanson, R. P.; Upton, E. and Brandly, C. A. (1950). Agglutination of

mammalian erythrocytes by Newcastle disease virus. Proceeding of Society for

Experimental Biology, 74:174-178.

Wise, M. G.; Suarez, D. L.; Seal, B. S.; Pedersen, J. C.; Senne, D. A.; King, D. J.;

Kapczynski, D. R. and Spackman, E. (2004). Development of a real-time reverse-

transcription PCR for detection of Newcastle disease virus RNA in clinical

samples. Journal of Clinical Microbiology, 42: 329-338.

Xu, F.; Zhong, D. and Yu, W. (2003). Cloning of the Newcastle Disease Virus (NDV) F

Gene and Construction of a Eukaryotic Expression Recombinant Plasmid

Containing NDV F Gene. Anhui Nongxueyuan Xuebao, 30: 280-284.

Yang, C. Y.; Shieh, H. K.; Lin, Y. L. and Chang, P. C. (1999). Newcastle disease virus

isolated from recent outbreaks in Taiwan phylogenetically related to viruses

(genotype VII) from recent outbreaks in Western Europe. Avian Disease, 43: 125-

130.

Yu, L.; Wang, Z.; Jiang,Y.; Chang, L. and Kwang, J. (2001). Characterization of newly

emerging Newcastle disease virus isolates from the People's Republic of China and

Taiwan. Journal of Clinical Microbiology, 39: 3512-3519.

Yusoff, K.; Nesbit, M.; McCartney, H.; Meulemans, G.; Alexander, D. J.; Collins, M. S.;

Emmerson, P. T. and Samson, A. C. (1989). Location of neutralizing epitopes on

the fusion protein of Newcastle disease virus strain Beaudette C. Journal of

General Virology, 70: 3105-3109.

Zhang, L.; Pan, Z.; Geng, S.; Chen, X; Hu, S.; Liu, H.; Wu, Y.; Jiao, X. and Liu, X.

(2010). Sensitive, semi-nested RT-PCR amplification of fusion gene sequences for

the rapid detection and differentiation of Newcastle disease virus. Research in

Veterinary Science, 89: 282-289.