molecular characterization of the iron signaling pathway

Molecular Characterization of the Iron Signaling Pathway by Plant Growth

Promoting Rhizobacteria GBO3

by

Gardiyawasam Kalpana, B.S.

A Thesis

In

Chemistry

Submitted to the Graduate Faculty

of Texas Tech University in

Partial Fulfillment of

the Requirement for

the Degree of

MASTER OF SCIENCE

Approved

Dr. Paul W Pare

Chair of Committee

Dr. David B Knaff

Mark Sheridan

Dean of the Graduate School

August, 2014

Texas Tech University, Gardiyawasam Kalpana, August 2014

ii

ACKNOWLEDGEMENTS

I would like to express my sincere gratitude towards my advisor Dr. Paul W.

Paré for his generous support, thoughtful advice and patience throughout my time at

Texas Tech University. His words and actions not only guided me to successfully

complete this thesis work, also to achieve many goals in life. Thank you sir for all the

time and words you generously spent on me.

I would like to express appreciation to my graduate committee member Dr.

David B. Knaff for his kind support throughout my stay here. During my research

exam and thesis defense, his kind attitude was greatly appreciated.

I would like to recognize all the current and past members of the lab, Mina

Aziz, Rangith Nadipalli, May Chou, Shirley Xin Shen and Wael Elmasri for their

support and encouragements during my stay in the lab. They have been a great relief

during bitter times in the graduate life. My special gratitude goes to Mina Aziz for

teaching me basic fundamentals in the lab and helping me to stabilize and survive in

the lab.

My heartiest gratitude goes to my parents back in Sri Lanka for being

supportive and encouraging during my stay in USA. They are the two great pillars in

my life that bear all my ups and downs and this achievement would not have been

possible without their hard work and dedication.


iii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ii

ABSTRACT v

LIST OF FIGURES vi

I INTRODUCTION 1

1.1 Soil iron uptake strategies by plants 1

1.2 Plant growth promoting rhizobacteria (PGPR) in plant iron uptake 3

1.2.1 Bacillus subtilis GBO3 4

1.3 Forward genetics and map based cloning 5

1.3.1 EMS mutagenesis 6

1.3.2 Mutant screening 6

1.3.3 Map-based cloning 8

II MATERIALS AND METHODS 9

2.1 Plant materials 9

2.2 Bacterial cultures and treatments 9

2.3 Plant growth medium preparation 10

2.4 Iron content measurement 10

2.5 Chlorophyll level measurement 11

2.6 Reverse transcriptase PCR 11

2.6.1 RNA isolation 11

2.6.2 Complementary DNA (cDNA) synthesis 12

2.6.3 Polymerase chain reaction (PCR) analysis 12


iv

2.7 Luciferase bioluminescence imaging and screening 12

2.8 Mutant identification 13

2.9 Statistical analysis 13

III RESULTS AND DISCUSSION 14

3.1 GBO3 induce growth promotion in cpl1-6/Col-0 line 14

3.2 GBO3 induce iron deficiency response in plants 14

3.3 GBO3 induced FIT1-LUC expression in FIT1::LUC/cpl1-6 line 15

3.4 False positive mutant as a control for true mutant identification 15

3.5 1M14, a preliminary positive mutant 16

IV FUTURE STUDIES 28

REFERENCES 29


v

ABSTRACT

Bacillus subtilis GBO3 is a soil bacterium that regulates several plant responses

related to growth and development. GBO3 emits an array of volatile organic

compounds capable of affecting signal pathways including iron deficiency induced

responses. GBO3 has been shown to increase iron accumulation by overexpressing the

plant’s own iron uptake machinery, however the GBO3-activated signaling pathway

operative in Arabidopsis has yet to be characterized. The aim of this work was to

establish an experimental procedure to identify and characterize signaling

intermediates in the inducible-iron signaling pathway via a forward genetics approach.

A transgenic Arabidopsis line capable of GBO3-induced growth promotion and other

iron related responses similar to Col-0, FIT1-LUC/cpl1-6, was utilized. An EMS

mutagenized population of 3500 seeds was screened via luciferase bioluminescence to

identify mutants with compromised GBO3-induced iron signaling. After several

confirmation re-screens, a preliminary positive mutant, 1M14 that displayed a reduced

luciferase bioluminescence phenotype was identified. Future studies will map the

mutation location for gene identification.


vi

LIST OF FIGURES

1.1 Process of generating the FIT-LUC/cpl1-6 background 7

3.1 GBO3 VOCs trigger growth promotion in Arabidopsis 17

3.2 GBO3 VOCs increase chlorophyll content 18

3.3 Time course of elevated IRT1 gene expression ratio in Arabidopsis 19

3.4 Elevated FRO2 gene expression in Arabidopsis cpl1-6 line 20

3.5 GBO3 VOCs increase the shoot iron content in cpl1-6 line 21

3.6 GBO3 VOCs induce the FIT1-LUC bioluminescence in FIT1-LUC/cpl1-6

line 22

3.7 The FIT1-LUC bioluminescence intensity of 2M9E and

FIT1::LUC/cpl1-6 23

3.8 The functional characterization of 2M9E 24

3.9 The FIT1-LUC bioluminescence intensity of 1M14 mutant with GBO3 25

3.10 The functional characterization of 1M14 mutant 27


1

CHAPTER I

INTRODUCTION

Being one of the seven micronutrients required for plant growth, iron is an

essential element for plants (Curie and Briat, 2003). It is a cofactor in many cellular

enzymes required for chlorophyll production, photosynthesis and electron transport.

Although it is the fourth most abundant element on the earth’s crust, the absorption

can be limited by root systems since most of the iron in soil exits as iron phosphates or

hydroxides that are insoluble under alkaline conditions (Kim and Guerinot, 2007).

Iron deficiency causes leaf chlorosis since iron is essential for chlorophyll

synthesis. Plants respond to this by overexpressing proteins involved in root iron

uptake thus, facilitating its absorption (Curie and Briat, 2003). This iron deficiency

response is also inducible by the beneficial soil bacterium Bacillus subtilis GBO3

(Huiming et al., 2009). GBO3 induces expression of iron uptake machinery although

signal perception, and downstream transduction pathway components have yet to be

characterized. The aim of this project is to establish an experimental procedure to

identify and characterize signaling intermediates in the inducible iron signaling

pathway activated by GB03 via a forward genetics approach.

1.1 Soil iron uptake strategies by plants

Under iron deficient conditions, plants have evolved two strategies for iron uptake

from soil. In dicotyledonous and non-graminaceous plant species like Arabidopsis,

tomato and sunflower, iron absorption takes place by a reduction-based strategy I

which consists of three steps, and in graminaceous plants like rice, maize, barley and

corn, a chelation-based strategy II is used for iron uptake (Curie and Briat, 2003).

Strategy II will not be detailed here, as this work has focused on Arabidopsis where

strategy I is functional (Curie and Briat, 2003).


2

In strategy I, a plasma membrane bound H+-ATPase excretes protons into the

rhizosphere thus lowering the pH of the root vicinity and increasing the solubility of

Fe3+-chelates in the soil. The exact H+-ATPase involved has not yet been characterized

but several members of the Arabidopsis AHA (Arabidopsis H+-ATPase) family have

been suggested to be involved in this process (Colangelo and Guerinot, 2004).

A plasma membrane bound reductase reduces Fe3+ into a more soluble Fe2+

form as the second step, facilitating iron transport via a root iron transporter system.

This step is considered the rate limiting step in strategy I process (Kim and Guerinot,

2007). The reductase involved in this process, FRO2 (ferric chelate reductase oxidase

2), has been extensively studied in plants. It is 725 amino acids in length with 6

putative hydrophobic domains and has conserved binding sites for FAD and NADPH

cofactors (Connolly et al., 2003). It is expressed in root epidermal cells under iron

deficient conditions and was initially identified using the Arabidopsis mutant frd1

(ferric chelate reductase defective I) which lacks inducible chelate reductase activity

and develops chlorosis with limited iron conditions. This FRO2 reductase belongs to

an eight member FRO family in Arabidopsis. The different cellular positioning of

FRO members including, FRO2, FRO3 and FRO5 localized in roots and FRO6, FRO7

and FRO8 in shoots, implicate the involvement of FRO reductases in iron uptake and

endogenous distribution in plants (Kim and Guerinot, 2007).

Once iron is reduced by FRO2, it is transported into the roots. The main iron

transporter responsible for root iron uptake is IRT1 (iron-regulated transporter 1); a

347 amino acid polypeptide with eight putative transmembrane domains. The protein

is localized to the plasma membrane of root epidermal cells (Curie and Briat, 2003).

The IRT1 null mutant is lethal under iron deficient conditions implicating its function

as the major root iron transporter in Arabidopsis (Vert et al., 2002). In addition to Fe2+,

IRT1 has broad substrate specificity for Zn, Mn, Cd and Co (Curie and Briat, 2003). It

is the founding member of a large metal transporter family in Arabidopsis, ZIP (ZRT,

IRT-like proteins), which includes 14 other members, IRT2, IRT3, ZIP1 through

ZIP12. IRT2 also expressed in the root epidermis under Fe deficiency


3

conditions has remarkable molecular and functional similarities to IRT1, but it is

unable to complement the chlorotic symptoms exhibited in the Arabidopsis irt1

mutant, suggesting a secondary function in iron uptake and homeostasis (Curie and

Briat, 2003).

FRO2 and IRT1 are transcriptionally and post-transcriptionally regulated by an

upstream basic helix-loop-helix transcription factor, Fe deficiency-induced

transcription factor 1 (FIT1) (Vert et al., 2003; Colangelo and Guerinot, 2004; Yuan et

al., 2005). The FIT1 was initially identified in a tomato fer mutant, where strategy I

iron uptake under iron deficient conditions was not observed (Brown et al., 1971). In

Arabidopsis, the possible bHLH transcription factor was identified by microarray

analysis and named FIT1. The bHLH family is the second largest transcription-factor

family in plants and regulates important physiological processes. FIT1 plays an

important role in plant iron uptake by regulating more than 70 iron-related genes

including IRT1, FRO2, AHA7 and nicotianamine synthase (NAS) (Colangelo and

Guerinot, 2004). Iron signaling upstream of FIT1 remains unknown although

dimerization of FIT1 with other bHLH factors such as AtbHLH38 and AtbHLH39

have been proposed (Yuan et al., 2008).

Several iron assimilation components including the iron reductase, FRO2 and

iron transporter, IRT1 are induced by the beneficial soil microbe GBO3. Indeed,

GBO3 and several other soil bacteria are capable of regulating plant responses

associated with growth and defense are generally termed as plant growth promoting

rhizobacteria (PGPR).

1.2 Plant growth promoting rhizobacteria (PGPR) in plant iron uptake

The thin zone of soil around roots are generally referred as the rhizosphere and this

area is highly enriched in nutrients due to the synthesis and secretion of root exudates

by plants. These chemicals can act as either attractants for beneficial soil bacteria or

repellants for pathogenic bacteria or other competent plant species. As a result, the


4

rhizosphere is an enriched ecosystem for diverse bacterial communities. In 1981,

Kloepper and Schroth termed these beneficial rhizobacteria which are competent to

colonize root environments and enhance plant growth as plant growth promoting

rhizobacteria (PGPR) (Kloepper and Schroth, 1981). PGPR most often have the

following characteristics; an ability to compete and colonize the rhizosphere and the

ability to promote plant growth.

Certain rhizobacteria induce root iron uptake by secreting bacterial

siderophores. They are low molecular weight, water soluble iron chelators that have a

high affinities for iron, thus they are capable of solubilizing iron from insoluble ferric

hydroxides, the abundant form of iron in soil. Plants as well as bacteria are able to

bind these siderophores and internalize iron. Once the metal is released, siderophores

can be reused or are destroyed (Mani et al., 2010). Bacillus subtilis GBO3 is a

rhizobacteria with the ability of inducing iron uptake by siderophores production as

well as inducing iron-uptake mechanisms by the plant.

1.2.1 Bacillus subtilis GBO3

Bacillus subtilis GBO3, a variant of Bacillus subtilis A13 was first discovered in

Australia in the 1930s and it was the first commercialized biopesticide in US under the

trade name of Kodiak (Gustafson, Dallas, USA). This PGPR strain has been reported

to emit a complex blend of volatile organic compounds, which promote growth in

Arabidopsis without a direct physical contact with the plant (Farag et al., 2006). In

addition to promoting growth, the GBO3 volatile exposure results in differential

expression of approximately 600 gene transcripts involved in cell wall modifications,

primary and secondary metabolism, plant stress responses, hormone regulation and

expression of other proteins (Zhang et al., 2007).

GBO3 has the ability to increase endogenous iron content in plant,

Arabidopsis, under the absence of direct physical contact with the plant (Zhang et al.,

2009). When Arabidopsis is exposed to GBO3, induced iron deficiency like responses


5

and enhanced endogenous iron levels are observed. GBO3 exposure results in elevated

strategy I iron uptake components including elevated gene expression of IRT1 and

FRO2 at the transcription level and increased acidification of the rhizosphere resulting

in increased iron mobilization and uptake into the plant. As a result of this enhanced

iron acquisition, GBO3 exposed plants show increased accumulation of iron in shoots

and whole plant levels (Zhang et al., 2009). Even though iron content is elevated,

GBO3 induced plants do not exhibit iron toxicity, suggesting that GBO3 has the

ability to regulate transport and compartmentalization so as to maintain appropriate

iron homeostasis within the plant.

As iron is a building block of chlorophyll biosynthesis, perhaps it is not

surprising that GBO3 induced plants have elevated chlorophyll levels accompanying

increased iron accumulation. Moreover, enhanced photosynthetic capacity is observed

in GBO3 activated plants.

This GBO3 induced iron accumulation is compromised in the fit1-2 mutant

indicating that GBO3 activation of iron uptake is FIT1 mediated. Other signaling

components operative upstream of FIT1 are yet to be reported. There are different

approaches can be followed to characterize this iron signaling pathway. Forward

genetics approach is one such method to identify genes corresponds to a particular

interesting phenotype.

1.3 Forward genetics and map based cloning

Forward genetics is a well-established genetic tool that has been effectively employed

to characterize many fundamental developmental processes in plants including

circadian systems, hormone signaling pathways and stress responses (Millar et al.,

1995; Meier et al., 2001). In fact, FRO2 was identified via a forward genetic approach.

As mentioned previously, the actual protein responsible for iron reduction was isolated

and characterized in an Arabidopsis ferric chelate reductase defective mutant frd1

where iron uptake was greatly compromised under iron deficient conditions with only


6

oxidized iron present (Yi and Guerinot, 1996). A forward genetics approach is also

being employed in this project to elucidate upstream components of FIT1 in GBO3-

inducible iron uptake.

A typical forward genetic experiment consists of three phases, mutagenesis,

mutant screening and map-based cloning. These steps are briefly outlined below.

1.3.1 EMS mutagenesis

Mutagenesis, a tool used in forward and reverse genetic approaches, is the process of

generating heritable changes in a genome. Mutagen can be of three main groups

chemical, physical and biological (Maple and Møller, 2007). Ethyl methanesulfornate

(EMS) is the most common mutagen used in plants. It is a chemical reagent that

induces nucleotide-base alkylation. Specifically EMS induced G/C to A/T transitions

by alkylating guanine to O6-ethylguanine, which base pairs with thymine instead of

cytosine (Kim et al., 2006). Due to high mutagenicity and low mortality, EMS permits

a mutagenesis saturation with ca. 50,000 M1 plants with point mutations every 200-

300 kb (Greene et al., 2003; Jander et al., 2003). These point mutations can have

different degree of expressions rather than a loss of function allowing the analysis of

essential genes (Maple and Møller, 2007).

1.3.2 Mutant screening

The genetic background is important for a successful screening process. Generally,

Col-0 background is used for mutant identification in Arabidopsis. Modified genetic

backgrounds are required when screening for mutants in redundant genes, suppresser

or enhancer screening, or for gene mutations that does not cause a phenotypical or

biochemical response (Page and Grossniklaus, 2002). The mutant identification

process should be simple and tight in order to avoid false positives and to screen a

large M1 populations.


7

Since assaying for functional GBO3 induced iron signaling is laborious in Col-

0, a modified background, FIT1-LUC/cpl1-6, which was generated by Dr. Hisashi

Koiwa (Texas A and M University) was used in this work (Figure 1.1).

Figure 1.1 Process of generating the FIT-LUC/cpl1-6 background

A gene family of Arabidopsis c-terminal domain phosphatase-like (CPL) were

identified as negative regulators in stress-responsive gene expression and more than 20

members have been reported thus far (Bang et al., 2008). The plant-specific CPL1

regulates multiple environmental stress responses including osmotic-stress, abscisic

acid (ABA) and iron-deficiency stress. Arabidopsis cpl1 exhibits induced iron-

deficiency responses under sufficient iron conditions (Jeong et al., 2013). To further

enhance iron-deficiency signaling, cp1l was used in the modified background

generated to identify mutants in iron signaling by GBO3.


8

1.3.3 Map-based cloning

Map-based cloning or positional cloning is the process of identifying the physical

location of a gene or mutation by measuring genetic linkage to markers whose

physical location in the genome is known (Jander et al., 2002). As it is a laborious and

time consuming process, alternative yet expensive approaches as next generation

sequencing (whole genome sequencing) and microarrays can be employed (Lukowitz

et al., 2000; Baaj et al., 2008; Gupta et al., 2008; Lister et al., 2009). Main advantage

of positional cloning is that any prior knowledge or assumption is not required. This

can be used to identify new genes or to assign functions to previous genes, or to genes

not previously annotated as is the case for approximately 40% of the genes in

Arabidopsis (The Arabidopsis Genome Initiative, 2000).

Mapping has two consecutive phases, rough and fine (Lukowitz et al., 2000;

Jander, 2006). During rough mapping, a mapping resolution of up to 1250 kb can be

acquired and by fine mapping the resolution can be further increased up to 40 kb.

Theoretically a mutation can be mapped in to a single gene but due to practical

difficulties, a resolution of 40 kb is considered reasonable. Generally 2-10 genes can

reside in this interval in Arabidopsis. DNA sequencing or molecular complementation

of candidate genes in the region is the last step to locate the mutation.


9

CHAPTER II

MATERIALS AND METHODS

2.1 Plant materials

Arabidopsis thaliana seeds were surface sterilized by following protocol. Roughly

100 seeds were taken into a 1.5 ml microcentrifuge tube and mixed with 1 ml of 70%

(v/v) ethanol for 1 min while inverting continuously. Then, the seeds were mixed

with 1 ml of 1% (v/v) sodium hypochlorite (bleach) solution and leave there for 20

min while occasional mixing of the content. After the incubation, seeds were rinsed

with sterile milliQ water for 5-6 times to ensure complete removal of bleach. After

the rinses, seeds were suspended in 1 ml of sterile milliQ water and the tube was

incubated at 4oC for 48 hours in the absence of light for seed vernalization.

2.2 Bacterial cultures and treatments

Bacterial glycerol stock tubes were prepared as follows. Previously prepared B.

subtilis GBO3 glycerol stock tube was used to make a LB streak plate and it was

incubated at 30oC for 48 hours until isolated colonies developed. Then one colony

from this plate was used to inoculate a LB broth and the flask was left overnight in a

shaker with controlled temperature. The absorbance was measured at 600 nm until an

OD of 0.7 was obtained. This culture was used to prepare glycerol stocks (500 µl of

50% glycerol and 500 µl of culture) and stored at -70oC.

Bacterial treatments were prepared according to the type of experiment. For all

the experiments except for luciferase imaging experiment, treatments were prepared

as follows. A volume of 20 µl from B. subtilis GBO3 glycerol stock was placed as

spots on a LB agar plates and they were incubated at a 30oC incubator for 24 hours

until each spot develops into an individual bacterial colony. On the day of treatment,

each colony was cut into small squares and these bacterial LB squares were placed on

the empty side of the I-plate containing half strength MS media. Usually treatment


10

were added after incubating plant plates for 5 days at the growth chamber to ensure

optimum germination and growth.

For luciferase imaging experiment, GBO3 glycerol stock (20 µl) was incubated

on LB agar plates at a 30oC for 24 hours until spots developed into a colony. Colonies

were dissolved in 10 ml of sterile milliQ water and a diluted to an OD of 0.7 at 600

nm wavelength. Diluted bacterial suspension was spotted on a LB agar plates and

they were incubated at a 30oC incubator for 24 hours until each spot develops into an

individual bacterial colony. On the day of treatment, colonies were placed on the

empty side of the I-plate containing half strength MS media. Usually treatment were

added after incubating plant plates for 4 days at the growth chamber to ensure

optimum germination and growth.

2.3 Plant growth medium preparation

Arabidopsis plants were grown on half-strength Murashige and Skoog medium that

contain 0.2215% (w/v) MS medium and 1.5% (w/v) sucrose. In addition 0.8% (w/v)

agar was used as the solidifying agent. For luciferase assay experiment, 1.5% (w/v)

agar was used since plates has to be in a vertical position. The pH of the medium was

adjusted to 5.7-5.8 and it was autoclaved using the liquid cycle.

2.4 Iron content measurement

The iron content in Arabidopsis samples was determined according to Lobreaux et al.

(1991) with some modifications. Initially, a standard curve for iron was obtained

using sodium EDTA iron reagent. Arabidopsis leaves were placed in a 1.5 ml

microcentrifuge tube to get a fresh weight of 1 mg of tissue. Then 150 µl of milliQ

water was added and the sample was ground with a micro pestle to obtain a

homogenous suspension. Then 20 µl of 98% sulfuric acid was added followed by 50

µl of 5% (v/v) thioglycolic acid (mercapto acetic acid). The content was mixed


11

properly and incubated at room temperature for 10 minutes. After the incubation, 400

µl of saturated sodium acetate and 500 µl of 4,7-diphenyl-1,10-phenanthroline, which

was prepared by adding 200 mg of 4,7-diphenyl-1,10-phenanthroline into 250 ml of

isoamyl alcohol, were added and the content was mixed by vortexing vigorously to

extract iron into the upper organic layer. At this stage the organic layer should be

pink or light purple indicating the presence of iron. The content was centrifuged at

3000 rpm for 2 minutes to separate layers and 400 µl of the upper organic layer was

used to measure the absorbance at 535 nm using isoamyl alcohol as the blank. The

iron concentrations were determined using the standard curve and content was

reported as µg of iron per g FW. All the reagents used above were prepared freshly

before experiment.

2.5 Chlorophyll level measurement

Arabidopsis plants treated with the GBO3 or water for 7 or 14 days were used to

measure the chlorophyll content in leaves. Leaves were collected in to a 1.5 ml

microcentrifuge tube to get a fresh weight of 20 mg tissues. Then, 1 ml of the

extraction buffer (80% acetone in water) was added and the tissues were ground to

get a homogeneous solution. The content was centrifuged at 13000 rpm for 5 minutes

and the clear supernatant was used to measure the spectrophotometric absorbance at

646.8 nm and 663.2 nm wavelengths. The total chlorophyll was calculated using the

equation; chlorophyll a + b = (7.15 * A663.2 + 18.71 * A646.8) /1000/ fresh weight and

the levels were reported as mg Chl. Per g FW.

2.6 Reverse transcriptase PCR

2.6.1 RNA isolation

According to the experiment, 2 day or 4 day old seedlings or root samples were used

to extract total RNA using the Qiagen RNeasy plant mini kit (Cat. No. 74904). After


12

extraction, RNA samples were quantified by the Nanodrop ND-1000

spectrophotometer (Nyxor Biotech, http://www.nanodrop.com ).

2.6.2 Complementary DNA (cDNA) synthesis

First, 4-6 µg of RNA was taken to a tube and DEPC water was added to get a final

volume of 25 µl. The content was mixed and heated at 67oC for 10 minutes in a water

bath. After the incubation, the tube was transferred immediately to an ice bath and

kept there for 6 minutes. For the first strand cDNA synthesis, the master mixture

without the enzyme was prepared and added to each sample. Then the content was

mixed properly and incubated first at room temperature for 10 minutes and then in ice

for 5 minutes. A volume of 2 µl of MuMLV- RT enzyme was added and the tube was

incubated at 37oC for 1 hour to complete the synthesis.

2.6.3 Polymerase chain reaction (PCR) analysis

The PCR amplification analysis for IRT1, FRO2 and tubulin was performed using

following primers (5’ to 3’): [IRT1], CTCCGGATTTCTCGCTATGT and

AGCGATCCCTAACGCTATTC; [FRO2], TCTTCTTTGTCCTCCACGTC and

TCTCAAGACCGGATAATGGC.

After the PCR, samples were analyzed on 1.2% (w/v) agar gel in TAE (Tris

Acetate-EDTA) buffer. The gel was imaged with a Kodak gel logic 100 imaging

system.

2.7 Luciferase bioluminescence imaging and screening

Luciferin powder (Promega) was dissolved in water to get a stock concentration of

100 mM and this can be stored in -70oC for up to few years. A working solution (1

http://www.nanodrop.com/


13

mM) was prepared freshly before the analysis. The bioluminescence was imaged

using a thermoelectrically cooled charge-coupled device camera system.

Luciferase expressed plant lines were grown vertically on half strength MS

media for 7 days and then sprayed evenly with 1 mM luciferin and imaged with

exposure times of 5s, 10s, 15s and 20s. In addition, a light image was taken to

identify the position of the plants on the plate.

2.8 Mutant identification

During the initial screenings of mutagenized M2 seeds, seedlings that displayed

compromised luciferase bioluminescence intensities were selected for propagation on

soil. Once the M3 seeds were generated, each line was re-screened at least 3 times

using the same conditions and parameters to further confirm their deficient luciferase

expression. Lines that displayed deficient bioluminescence signal consistently in all

the screens were selected as plausible positive mutants deficient in GBO3 inducible

iron signaling pathway.

2.9 Statistical analysis

The Microsoft Excel software was used to perform all the statistical analysis.

Significant difference was based on a p values ≤ 0.05 between different treatments.


14

CHAPTER III

RESULTS AND DISCUSSION

3.1 GBO3 induce growth promotion in cpl1-6/Col-0 line

GBO3 emissions induce growth promotion in both Arabidopsis Col-0 and the cpl1-

6/Col-0 mutant line. GBO3-treated plants show statistically significant increases in

both fresh and dry weight with 5 days of treatment compared to water controls (Figure

3.1). GBO3-exposed plants were larger and greener.

3.2 GBO3 induce iron deficiency response in plants

Chlorophyll content was increased during 7- and 14- days of exposure to GBO3 in

cpl1-6 compared to Col-0 (Figure 3.2). Enhanced chlorophyll accumulation and

photosynthetic efficiency was associated with GBO3 growth promotion observed in

Col-0 (Zhang et al 2009). This augmented chlorophyll production in cpl1-6 may

indicate its capability to induce growth with GBO3 better than Col-0.

IRT1 and FRO2 gene expressions are GBO3 induced in both cpl1-6 and Col-0.

IRT1 expression ratio increased 2.0 and 2.5 fold at 48- and 72-hours respectively in

cpl1-6. A bell shaped expression curve was demonstrated by IRT1 with the maximum

expression after 72 hours post GB03 exposure (Figure 3.3). FRO2 gene expression

ratio also increased 1.5 fold after 96 hours exposure in cpl1-6 (Figure 3.4).

Strategy I iron uptake pathway components are induced by GBO3 thus,

enhancing the iron accumulation. Their ability to induce iron uptake even under iron

sufficient conditions is of utmost importance since this can leads to generate iron

enriched plants without manipulating its genetic makeup.

The shoot-iron accumulation was measured to determine the actual level of

function of endogenous IRT1 and FRO2 in cpl1-6 and, there was a 1.5 fold increment


15

after 7 days of exposure (Figure 3.5). GBO3 does induce the expression and the

stability of the strategy I iron uptake components in cpl1-6, thus enhancing the iron

availability of the plant.

3.3 GBO3 induced FIT1-LUC expression in FIT1::LUC/cpl1-6 line

IRT1, FRO2 and FIT1 are the only known members of plant iron signaling pathway.

The root specific expression intensity of FIT1 can be measured to identify the

upstream components since an uninterrupted signal flow should results in a higher

level of FIT1 expression as opposed to a low level of expression in cases of

interruptions.

GBO3 signal does intensify the bioluminescence signal significantly as shown

in CCD images (Figure 3.6). Since the FIT1-LUC expression intensity was drastically

different with and without the GBO3 signal and the effect was consistent throughout

all the exposure times, this can be used as an indication of the signal flow. Hence, this

method can be used to identify the mutants which are deficient in the inducible iron

signaling between GBO3 and FIT1.

3.4 False positive mutant as a control for true mutant identification

The EMS mutagenesis procedure, used to generate the mutant population may create

some effects on the whole genome level in addition to the induced positional

mutations. In order to alleviate these differences between the EMS-treated and the

non-treated seeds, a false positive mutant identified during the initial screens, 2M9E,

was assayed as a more suitable control than the FIT1::LUC/cpl1-6 non-treated line for

the purpose of true mutant identification.

Similar luciferase bioluminescence intensities were observed with GBO3 for

both 2M9E and FIT1::LUC/cpl1-6 (Figure 3.7). This indicates 2M9E is a false

positive mutant where the inducible GBO3 signal flows without an interruption. A 3.0


16

fold increment in the chlorophyll content, and a 1.5 and 3.0 fold induction in the IRT1

and FRO2 gene expression ratios were observed with GBO3 respectively (Figure 3.8).

These results confirmed that 2M9E is a false positive mutant which behave similar to

FIT1::LUC/cpl1-6 and can be used as a better control in order to identify true mutants.

3.5 1M14, a preliminary positive mutant

Significantly lower bioluminescence intensities were observed for 1M14 mutant

compared to 2M9E control under all exposure times (Figure 3.9) and this was

consistent throughout all the 3 re-screens. Hence, the mutant 1M14 was considered as

a preliminary true mutant deficient in the GBO3 inducible iron signaling pathway.

Functional analysis was performed to further characterize the mutant in regards

to iron signaling. Chlorophyll accumulation was reduced by 70% with GBO3 for

1M14 compared to 2M9E (Figure 3.10). Without GBO3 treatment, both the

accumulations were similar in range. This may indicate that only the GBO3 inducible

signaling is compromised by the mutation while the endogenous iron signaling is

unaffected.

Shoot-iron accumulation in 1M14 was reduced by 37% with GBO3 compared

to water (Figure 3.10). Additionally, a global reduction was observed in IRT1 gene

expression ratios of 1M14 over the 2M9E control with a 57% reduction after 96 hours

of GBO3 exposure. This indicates that, IRT1 gene expression induction by the GBO3

signal is compromised in 1M14.

1M14 was identified as a positive mutant deficient in GBO3 inducible iron

signaling based on the preliminary data presented with Arabidopsis.


17

Figure 3.1 GBO3 VOCs trigger growth promotion in Arabidopsis FIT1::LUC/cpl1-6

line. A representation image showing the growth promotion induced by GBO3

volatiles after exposing for 5 days (left panel). A fresh weight (top right) and dry

weight (bottom right) data collected after exposing the seedlings to GBO3 volatiles

(solid line) or water (dashed line) for 3,5,7,9, or 12 days. The asterisk indicates p-

value ≤ 0.05 between GBO3 and water treatments (n =10, error bars represent standard

error).


18

Figure 3.2 GBO3 VOCs increase chlorophyll content in both cpl1-6 line and Col-0

ecotype when exposed to bacterial volatiles (black bars) compared to water treatment

(white bars) after 7 days (upper) and 14 days (bottom) of exposure. The asterisk

indicates p-value ≤ 0.05 between GBO3 and water treatments (n = 6, error bars

represent standard error).


19

Figure 3.3 Time course of elevated IRT1 gene expression ratio in Arabidopsis cpl1-6

line seedlings exposed to GBO3 bacterial volatiles. Gene expression ratios (GBO3

volatile treated versus water treated, n=3, error bars represent standard error) are

shown above RT-PCR gel images.


20

Figure 3.4 Elevated FRO2 gene expression in Arabidopsis cpl1-6 line seedlings

exposed to GBO3 bacterial volatiles for 96 hours. Gene expression ratios (GBO3

volatile treated versus water treated, n=3, error bars represent standard error) are

shown in left and RT-PCR gel images in right.


21

Figure 3.5 GBO3 VOCs increase the shoot iron content in cpl1-6 line after 7 days of

exposure to bacterial treatment (black bars) compared to the water treatment (white

bars). Iron content reported per gram fresh weight (n=8, error bars represent standard

error), asterisk indicates p values ≤ 0.05 for GBO3 treated versus water control.


22

Figure 3.6 GBO3 VOCs induce the FIT1-LUC bioluminescence expression in

FIT1::LUC/cpl1-6 line seedlings after 3 days of exposure to GBO3 volatiles compared

to water treated, under different CCD camera exposure times. The upper panel show

the water treated seedlings while the bottom panel show the GBO3 treated seedlings.


23

Figure 3.7 The FIT1-LUC bioluminescence intensity of GBO3 exposed 2M9E and

GBO3 exposed FIT1::LUC/cpl1-6 under different camera exposure times. The left

panel show the 2M9E signal while the right panel show the FIT1::LUC/cpl1-6 signal.


24

Figure 3.8 The functional characterization of 2M9E exposed to GBO3 volatiles for

different time periods. The chlorophyll accumulation in 2M9E with GBO3 treatment

for 7 days (top panel). GBO3 treated (black bars) versus water treated (white bars),

n=6, error bars represent standard error. Time course of elevated FRO2 and IRT1 gene

expressions in 2M9E seedlings exposed to GBO3 (bottom panels). Gene expression

ratios (GBO3 volatile treated versus water treated, n=3, error bars represent standard

error) are shown.


25

Figure 3.9 The FIT1-LUC bioluminescence intensity of 1M14 mutant with GBO3

(bottom row) compared to that of 2M9E control with GBO3 (top row) under different

CCD camera exposure times.


26


27

Figure 3.10 The functional characterization of 1M14 mutant exposed to GBO3.

Chlorophyll accumulation in 1M14 compared to 2M9E control after 7 days of GBO3

treatment (top panel). Asterisk indicates p values ≤ 0.05 for GBO3 treated (black bars)

versus water control (white bars). n=6, error bars represent standard error. Shoot iron

content in 1M14 after 7 days of exposure to bacterial treatment (black bars) or to water

treatment (white bars) (middle panel). Iron content reported per gram fresh weight

(n=8, error bars represent standard error). Time course of elevated IRT1 gene

expression ratios in 2M9E control (blue bars) and the 1M14 mutant (black bars)

exposed to GBO3 (bottom panels). Gene expression ratios (GBO3 volatile treated

versus water treated, n=2) are shown.


28

CHAPTER IV

FUTURE STUDIES

During this project, approximately 3500 of mutagenized M2 seeds of the background

FIT1::LUC/cpl1-6 were screened for the compromised luciferase bioluminescence

using a low light CCD camera system and a one mutant, 1M14, was selected as a

plausible positive mutant deficient in the GBO3 volatile inducible iron signaling

pathway. After initial identification of the mutant, the bioluminescence data were

confirmed with 3 re-screens. Following confirmation, a functional analysis comprised

of iron content measurement, chlorophyll level measurement and the gene expression

measurement of iron related genes were carried out. At the end, 1M14 was declared as

a plausible positive mutant deficient in the GBO3 volatile inducible iron signaling

pathway in Arabidopsis.

Upon completion of the mutant identification, the next step is to identify and

locate the mutation in the genome that is responsible for the observed phenotype. For

this purpose, the map-based cloning will be performed. This procedure is composed of

two main phases, the rough mapping and the fine mapping. During the rough

mapping, a genomic map with the resolution of up to 1250 kb will be generated.

Following this, a fine mapping should be carried out until obtain a resolution of 40 kb.

After the map-based cloning procedure, a genomic fragment with a resolution of 40 kb

should be obtained.

During the next step, this 40 kb DNA fragment will be sequenced to obtain the

full DNA sequence and the candidate genes can be identified based on the available

genetic information of Arabidopsis. Following the identification of the responsible

gene, it should be further confirmed by molecular complementation of the transgene.

After a successful complementation, the gene can be declared and named as a

component in the GBO3 volatile inducible iron signaling pathway in Arabidopsis.


29

REFERENCES

Baaj, Y., Magdelaine, C., Ubertelli, V., Valat, C., Talini, L., Soussaline, F.,

Khomyakova, E., Funalot, B., Vallat, J.-M., and Sturtz, F.G. (2008). A

highly specific microarray method for point mutation detection. Biotechniques

44, 119-126.

Bang, W.Y., Kim, S.W., Jeong, I.S., Koiwa, H., and Bahk, J.D. (2008). The C-

terminal region (640–967) of Arabidopsis CPL1 interacts with the abiotic

stress- and ABA-responsive transcription factors. Biochemical & Biophysical

Research Communications 372, 907-912.

Brown, J.C., Chaney, R.L., and Ambler, J.E. (1971). A new tomato mutant

inefficient in the transport of iron. Physiologia Plantarum 25, 48-53.

Colangelo, E.P., and Guerinot, M.L. (2004). The essential basic helix-loop-helix

protein FIT1 is required for the iron deficiency response. The Plant Cell 16,

3400-3412.

Connolly, E.L., Campbell, N.H., Grotz, N., Prichard, C.L., and Guerinot, M.L.

(2003). Overexpression of the FRO2 ferric chelate reductase confers tolerance

to growth on low iron and uncovers postranscriptional control. Plant

Physiology 133, 1102-1110.

Curie, C., and Briat, J.-F. (2003). Iron transport and signaling in plants. Annual

Review of Plant Biology 54, 183.

Farag, M.A., Ryu, C., Sumner, L.W., and Paré, P.W. (2006). GC-MS SPME

profiling of rhizobacterial volatiles reveals prospective inducers of growth

promotion and induced systemic resistance in plants. Phytochemistry 67, 2262-

2268.

Greene, E.A., Codomo, C.A., Taylor, N.E., Henikoff, J.G., Till, B.J., Reynolds,

S.H., Enns, L.C., Burtner, C., Johnson, J.E., Odden, A.R., Comai, L., and

Henikoff, S. (2003). Spectrum of chemically induced mutations from a large-

scale reverse-genetic screen in Arabidopsis. Genetics 164, 731-740.


30

Gupta, P.K., Rustgi, S., and Mir, R.R. (2008). Array-based high-throughput DNA

markers for crop improvement. Heredity 101, 5-18.

Jander, G. (2006). Gene identification and cloning by molecular marker mapping.

Methods In Molecular Biology (Clifton, N.J.) 323, 115-126.

Jander, G., Norris, S.R., Rounsley, S.D., Bush, D.F., Levin, I.M., and Last, R.L.

(2002). Arabidopsis map-based cloning in the post-genome era. Plant

Physiology 129, 440-450.

Jander, G., Gruys, K.J., Last, R.L., Gonzalez, K.A., Baerson, S.R., and Hudak,

J.A. (2003). Ethylmethanesulfonate saturation mutagenesis in Arabidopsis to

determine frequency of herbicide resistance. Plant physiology (Lancaster, Pa.)

Plant physiology 131, 139-146.

Jeong, I.S., Fukudome, A., Aksoy, E., Bang, W.Y., Kim, S., Guan, Q., Bahk, J.D.,

May, K.A., Russell, W.K., Zhu, J., and Koiwa, H. (2013). Regulation of

abiotic stress signalling by Arabidopsis C-terminal domain phosphatase-like 1

requires interaction with a K-homology domain-containing protein. PLoS ONE

8, 1-12.

Kim, S.A., and Guerinot, M.L. (2007). Mining iron: iron uptake and transport in

plants. FEBS Letters 581, 2273-2280.

Kim, Y., Schumaker, K.S., and Zhu, J.-K. (2006). EMS mutagenesis of

Arabidopsis. Methods In Molecular Biology (Clifton, N.J.) 323, 101-103.

Kloepper, J.W., and Schroth, M.N. (1981). Relationship of in vitro antibiosis of

plant growth-promoting Rhizobacteria to plant growth and the displacement of

root microflora. Phytopathology 71, 1020-1024.

Lister, R., Gregory, B.D., and Ecker, J.R. (2009). Next is now: new technologies

for sequencing of genomes, transcriptomes, and beyond. Current Opinion in

Plant Biology 12, 107-118.

Lukowitz, W., Gillmor, C.S., and Scheible, W.R. (2000). Positional cloning in

Arabidopsis. Why it feels good to have a genome initiative working for you.

Plant Physiology 123, 795-805.


31

Mani, R., Ae, N., Prasad, M.N.V., and Freitas, H. (2010). Potential of siderophore-

producing bacteria for improving heavy metal phytoextraction. Trends in

Biotechnology 28, 142-149.

Maple, J., and Møller, S.G. (2007). Mutagenesis in Arabidopsis. Methods In

Molecular Biology (Clifton, N.J.) 362, 197-206.

Meier, C., Bouquin, T., Nielsen, M.E., Raventos, D., Mattsson, O., Rocher, A.,

Schomburg, F., Amasino, R.M., and Mundy, J. (2001). Gibberellin response

mutants identified by luciferase imaging. Plant Journal 25, 509-519.

Millar, A.J., Chua, N.H., Kay, S.A., Carre, I.A., and Strayer, C.A. (1995).

Circadian clock mutants in Arabidopsis identified by luciferase imaging.

Science (Weekly) Science 267, 1161-1163.

Page, D.R., and Grossniklaus, U. (2002). The art and design of genetic screens:

Arabidopsis thaliana. Nature Reviews Genetics 3, 124-136.

Vert, G., Guerinot, M.L., Briat, J.F., Curie, C., Grotz, N., Dedaldechamp, F., and

Gaymard, F. (2002). IRT1, an Arabidopsis transporter essential for iron

uptake from the soil and for plant growth. Plant cell 14, 1223-1233.

Vert, G.A., Briat, J.-F., and Curie, C. (2003). Dual regulation of the Arabidopsis

high-affinity root iron uptake system by local and long-distance signals. Plant

Physiology 132, 796-804.

Yi, Y., and Guerinot, M.L. (1996). Genetic evidence that induction of root Fe(III)

chelate reductase activity is necessary for iron uptake under iron deficiency.

Plant journal : for cell and molecular biology 10, 835-844.

Yuan, Y., Wu, H., Wang, N., Li, J., Zhao, W., Du, J., Wang, D., and Ling, H.-Q.

(2008). FIT interacts with AtbHLH38 and AtbHLH39 in regulating iron uptake

gene expression for iron homeostasis in Arabidopsis. Cell Research 18, 385-

397.

Yuan, Y.X., Zhang, J., Wang, D.W., and Ling, H.Q. (2005). AtbHLH29 of

Arabidopsis thaliana is a functional ortholog of tomato FER involved in

controlling iron acquisition in strategy I plants. Cell Research 15, 613-621.


32

Zhang, H., Kim, M.-S., Krishnamachari, V., Payton, P., Sun, Y., Grimson, M.,

Farag, M.A., Ryu, C.-M., Allen, R., Melo, I.S., and Paré, P.W. (2007).

Rhizobacterial volatile emissions regulate auxin homeostasis and cell

expansion in Arabidopsis. Planta 226, 839-851.

Zhang, H., Yan, S., Xitao, X., Mi-Seong, K., Dowd, S.E., and Paré, P.W. (2009). A

soil bacterium regulates plant acquisition of iron via deficiency-inducible

mechanisms. Plant Journal 58, 568-577.

molecular characterization of the iron signaling pathway

Documents