Molecular diagnosis of heterogeneous Molecular diagnosis of heterogeneous genetic diseases: the example of genetic diseases: the example of muscular dystrophiesmuscular dystrophies

Vincenzo NigroVincenzo Nigro

Dipartimento di Patologia Dipartimento di Patologia Generale, Seconda Università Generale, Seconda Università degli Studi di Napolidegli Studi di Napoli

Telethon Institute of Genetics and Telethon Institute of Genetics and Medicine (TIGEM)Medicine (TIGEM)

What is a mutation?What is a mutation?

A variation of the DNA sequenceA variation of the DNA sequence that is only found in affected individualsthat is only found in affected individuals that is never found in non affected that is never found in non affected

individualsindividuals that accounts for the pathological that accounts for the pathological

process/statusprocess/status that, when corrected in time, disease is that, when corrected in time, disease is

rescuedrescued

..that is only found in affected ..that is only found in affected andand that is never found in non that is never found in non affected affected

incomplete penetranceincomplete penetrance

that is more often found in affectedthat is more often found in affectedthan in non affected...than in non affected...

50.000 private variants = 50.000 private variants = innocuous differences belonging to innocuous differences belonging to one familyone family

CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACCCCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTTGCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCGGCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAGGCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAAAAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTCTAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAAAGAATGTTAACAATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCTCAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAATGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCTTCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGGGGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCAGGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTGTTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCATTTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAAGGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATCCCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTGCTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTTGTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAATAAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATGTGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAACACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAATTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCTGTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAGTGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAGAAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTATAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGATCCAAAGCTCTTGCTTTGTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAGGGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGGAGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCCTGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAACTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGATCTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC

CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACCCCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTTGCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCGGCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAGGCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAAAAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTCTAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAAAGAATGTTAACTATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCTCAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAATGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCTTCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGGGGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCAGGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTGTTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCATTTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAAGGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATCCCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTGCTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTTGTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAATAAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATGTGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAACACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAATTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCTGTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAGTGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAGAAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTATAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGCTCCAAAGCTCTTGCTTTGTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAGGGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGGAGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCCTGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAACTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGATCTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC

1-allele diseases1-allele diseases

monoallelic mutations may be monoallelic mutations may be responsible for responsible for dominantdominant or or X-X-linkedlinked disorders disorders

new new randomrandom mutations are the mutations are the rule with an unpredictable pattern rule with an unpredictable pattern of distributionof distribution

Gender effect in Gender effect in mutationsmutations For mutations other than point mutations, For mutations other than point mutations,

sex biases in the mutation rate are very sex biases in the mutation rate are very variablevariable

Small Small deletionsdeletions are more frequent in females are more frequent in females Germline Germline base substitutionbase substitution mutations occur mutations occur

more frequently in males than in females, more frequently in males than in females, especially in older malesespecially in older males

Point mutations at some loci occur almost Point mutations at some loci occur almost exclusively in males, whereas others occur exclusively in males, whereas others occur ten times more than in femalesten times more than in females

Relative frequency of Relative frequency of de novode novo achondroplasia for achondroplasia for different paternal agesdifferent paternal ages

  Relative frequency of Relative frequency of de novode novo neurofibromatosis for different paternal neurofibromatosis for different paternal agesages

the number of male germ-the number of male germ-cell divisionscell divisions

2-allele diseases2-allele diseases

novel mutations are rare, usually mutations novel mutations are rare, usually mutations have a long history (100-1000 generations)have a long history (100-1000 generations)

mutations have an mutations have an ethnical signatureethnical signature with a with a predictable pattern of distribution and predictable pattern of distribution and frequencyfrequency

biallelic mutations may be responsible for biallelic mutations may be responsible for autosomal recessiveautosomal recessive disorders disorders

polymorphisms and private variants are polymorphisms and private variants are more easily discriminated vs true mutationsmore easily discriminated vs true mutations

2-allele diseases2-allele diseases

consanguineity is a risk factor for consanguineity is a risk factor for homozygosityhomozygosity high carrier frequency is a risk factor for high carrier frequency is a risk factor for

compound heterozygositycompound heterozygosity

The effect of an alleleThe effect of an allele

null or amorph = no productnull or amorph = no product hypomorph = reduced amount / activityhypomorph = reduced amount / activity

hypermorph = increased amount / hypermorph = increased amount /

activityactivity neomorph = novel product / activityneomorph = novel product / activity antimorph = antagonistic product / antimorph = antagonistic product /

activityactivity

Dominant or recessive Dominant or recessive phenotype?phenotype?

Loss of function mutations in the Loss of function mutations in the PAX3 gene (Waardenburg syndrome)PAX3 gene (Waardenburg syndrome)haploinsufficiencyhaploinsufficiency

amorph / hypomorph (1)amorph / hypomorph (1)

deletiondeletion– the entire genethe entire gene– part of the genepart of the gene

disruption of the gene structuredisruption of the gene structure– by insertion, inversion, translocationby insertion, inversion, translocation

promoter inactivationpromoter inactivation mRNA destabilizationmRNA destabilization splicing mutationsplicing mutation

– inactivating donor/acceptorinactivating donor/acceptor– activating criptic splice sitesactivating criptic splice sites

amorph / hypomorph (2)amorph / hypomorph (2)

frame-shift in translationframe-shift in translation– by insertion of n+1 or n+2 bases into by insertion of n+1 or n+2 bases into

the coding sequencethe coding sequence– by deletion of n+1 or n+2 bases into the by deletion of n+1 or n+2 bases into the

coding sequencecoding sequence nonsense mutationnonsense mutation missense mutation / aa deletionmissense mutation / aa deletion

– essential / conserved amino acidessential / conserved amino acid– defect in post-transcriptional processingdefect in post-transcriptional processing– defect in cellular localizationdefect in cellular localization

hypermorphhypermorph

trisomiatrisomia duplicationduplication amplification (cancer)amplification (cancer) chromatin derepression (FSH)chromatin derepression (FSH) trasposition under a strong promotertrasposition under a strong promoter

– leukemialeukemia overactivity of an abnormal proteinoveractivity of an abnormal protein

neomorphneomorph

generation of chimeric proteinsgeneration of chimeric proteins duplicationduplication amplification (cancer)amplification (cancer) missense mutationsmissense mutations inclusion of coding cryptic exonsinclusion of coding cryptic exons usage of alternative ORFsusage of alternative ORFs overactivity of an abnormal proteinoveractivity of an abnormal protein

antimorphantimorph

missense mutationsmissense mutations inclusion of coding cryptic exonsinclusion of coding cryptic exons usage of alternative ORFsusage of alternative ORFs

Mutation detectionMutation detection

mutation scanningmutation scanning– or resequencing methods for or resequencing methods for

identifying previously identifying previously unknownunknown mutationsmutations

genotypinggenotyping– methods for scoring previously methods for scoring previously

knownknown mutations or single mutations or single nucleotide polymorphisms (SNPs)nucleotide polymorphisms (SNPs)

Key questions for mutation detection strategy

expected mutations are monoallelic or biallelic?

is the gene well recognized for that disease? is the mutation pattern known? (deletion, dup,

small mutations, etc.) which is the complexity of the gene? how many patients must be examined? how many controls should be examined? how many mutations and how many variations

have already been identified in this gene? are there more members of the same gene

family (or pseudogenes) in the genome?

Gene size

Number ofpatients

XXNumber ofcontrols

Dimension of the mutation detection study

frequent mutations

are known?

mutationmutationscanningscanning

SEQUENCINGSEQUENCING

screeningscreeningof recurrentof recurrent mutationsmutations YESYES NONO

mutationsare identified?

YESYES

NONO

General strategy for mutation detectionGeneral strategy for mutation detection

DMD Duchenne Muscular DMD Duchenne Muscular DystrophyDystrophy - 1/3,500 boys - 1/3,500 boysOnsetOnset -- Early childhood - about 2 to 6 years -- Early childhood - about 2 to 6 years– Laboratory -- Laboratory -- CK (50x to 1.000x), LDH5, CK (50x to 1.000x), LDH5,

ALT, AST, aldolase increaseALT, AST, aldolase increase

SymptomsSymptoms -- Generalized weakness and -- Generalized weakness and muscle wasting affecting proximal limb muscle wasting affecting proximal limb muscles first. Calves often enlarged. Heart muscles first. Calves often enlarged. Heart involvementinvolvementProgressionProgression -- Disease progresses slowly but -- Disease progresses slowly but will affect all voluntary muscles. Survival will affect all voluntary muscles. Survival possible beyond late twentiespossible beyond late twenties

BMD Becker Muscular DystrophyBMD Becker Muscular Dystrophy - 1/10,000 boys - 1/10,000 boysOnsetOnset -- Adolescence or adulthood -- Adolescence or adulthoodSymptomsSymptoms -- Almost identical to Duchenne but -- Almost identical to Duchenne but often much less severe. Heart involvementoften much less severe. Heart involvementProgressionProgression -- Slower and more variable than -- Slower and more variable than DMD with survival well into mid to late DMD with survival well into mid to late adulthoodadulthood

Carrier of a balanced reciprocal X-Carrier of a balanced reciprocal X-autosome translocationautosome translocation

Dystrophin gene: page 1/185

Dystrophin gene: page 2/185

Dystrophin gene: page 3/185

Dystrophin gene: page 185/185

more DNA

Telethon-UILDM

250/300DMD/BMD

Qualitative test

Quantitative test

rejected

80plex-PCR

Deletionsduplications

Point mutations

mRNA studymRNA studyFamily tests

DMDDMDAA BB

BMDBMDCC DD

DMD patient :DMD patient :groups A, B groups A, B

BMD patient :BMD patient :groups C, D groups C, D

Deletion ex 17-43Deletion ex 17-43 Duplication ex 13-23Duplication ex 13-23

Log-PCR = 4 multiplex-PCR (2x20+2x18) with uniform spacingand gel position according to chromosomal position

1 2 3 4 5 6

1: del ex 432: del ex 11, 17, 19, 213: del ex 17, 19, 214: del ex 50, 525: del ex 7, 11, 17, 196: del ex 61

1: no del 2: del ex 8, 12, 18, 20, 223: del ex 12, 18, 20, 224: del ex 46, 515: del ex 6, 8, 12, 186: del ex 62

large deletions in 377/506 DMD/BMD

74.5%

large duplications in 51/506 patients

10.1%

SALSA MLPA probes

Hybridysation

1. The MLPA probemix is added to denatured genomic DNA

2. The two parts of each probe hybridise to adjacent target sequences

Ligation

3. Probes are ligated by a thermostable ligase3. Probes are ligated by a thermostable ligase

PCR amplification

4.4. A universal primer pair is used to amplify all A universal primer pair is used to amplify all ligated probesligated probesThe PCR product of each probe has a unique The PCR product of each probe has a unique length (130 480 bp)length (130 480 bp)

Separation and quantification by capillary electrophoresis

Each peak is the amplification product of a specific probe.

Samples are compared to a control sample.

A difference in relative peak height or peak area indicates a copy number change of the probe target sequence

MRC-Holland b.v.

Triple X

Female

Male

283 bp 346 bp

Detection of Chr X copy numberX

MLPA discriminates sequences that differ in only a single nucleotide and can be used to detect known mutations.

Mismatch Perfect match

Ligation of the two probe oligonucleotides Amplification product

Mismatch at the probe ligation site No ligation, no amplification product

MRC-Holland b.v.

Unmethylated Target

M

M

Methylated Target

Denaturation and Multiplex probe

hybridizationM

Only undigested (methylated) and ligated probes are exponentially amplified

Ligation and Digestion with

methylation sensitive

endonucleasesM

MS-MLPA

Limb-girdle weaknessLimb-girdle weakness

proximalproximal weakness: most common weakness: most common Lower extremitiesLower extremities

– difficulty climbing stairsdifficulty climbing stairs– arising from a low chair or toiletarising from a low chair or toilet– getting up from a squatted positiongetting up from a squatted position

Upper extremitiesUpper extremities– trouble lifting objects over their head trouble lifting objects over their head – brushing their hairbrushing their hair

distal weaknessdistal weakness– difficulty opening jars, inability to turn a key in the difficulty opening jars, inability to turn a key in the

ignition, or tripping due to foot dropignition, or tripping due to foot drop cranial weaknesscranial weakness

– dysarthria, dysphagia or ptosisdysarthria, dysphagia or ptosis

Genetics of limb-girdle muscular Genetics of limb-girdle muscular dystrophiesdystrophies

autosomal dominantautosomal dominant LGMD1ALGMD1A 5q31.25q31.2 myotilin (Hauser, 2000)myotilin (Hauser, 2000) LGMD1BLGMD1B 1q211q21 lamin A/C (Bonne, 1999)lamin A/C (Bonne, 1999) LGMD1CLGMD1C 3p25.33p25.3 caveolin 3 (Minetti, 1997)caveolin 3 (Minetti, 1997) LGMD1DLGMD1D 6q22 6q22 ?? LGMD1ELGMD1E 7q35 7q35 ?? LGMD1FLGMD1F 7q31.17q31.1 filamin Cfilamin C LGMD1GLGMD1G 4p214p21 ??

autosomal recessiveautosomal recessive LGMD2ALGMD2A 15q1515q15 calpain 3 (Richard, 1995)calpain 3 (Richard, 1995) LGMD2BLGMD2B 2p13.22p13.2 dysferlin (Bashir, Liu, 1998)dysferlin (Bashir, Liu, 1998) LGMD2CLGMD2C 13q1213q12 -sarcoglycan (Noguchi, 1995)-sarcoglycan (Noguchi, 1995) LGMD2DLGMD2D 17q21.3317q21.33 -sarcoglycan (Roberds, 1994)-sarcoglycan (Roberds, 1994) LGMD2ELGMD2E 4q124q12 -sarcoglycan (Bonnemann, Lim, -sarcoglycan (Bonnemann, Lim,

1995)1995) LGMD2FLGMD2F 5q335q33 -sarcoglycan (Nigro, 1996)-sarcoglycan (Nigro, 1996) LGMD2GLGMD2G 17q1217q12 telethonin (Moreira, 2000)telethonin (Moreira, 2000) LGMD2HLGMD2H 9q339q33.1.1 TRIM 32 (Frosk, 2002)TRIM 32 (Frosk, 2002) LGMD2ILGMD2I 19q13.319q13.3 FKRP (Brockington, 2001)FKRP (Brockington, 2001) LGMD2JLGMD2J 2q24.32q24.3 titin (Udd, 2002)titin (Udd, 2002) LGMD2KLGMD2K 9q34.19q34.1 POMT1 (Balci, 2005)POMT1 (Balci, 2005) LGMD2LLGMD2L 9q319q31 fukutin (Godfrey, 2006)fukutin (Godfrey, 2006) LGMD2MLGMD2M 11p13-p1211p13-p12 ??

autosomal dominant forms autosomal dominant forms (LGMD1) are generally milder(LGMD1) are generally milder

represent less than 10% of all represent less than 10% of all LGMDLGMD

marked heterogeneity for LGMD1, marked heterogeneity for LGMD1, one gene per one single family one gene per one single family

autosomal dominant

autosomal recessiveautosomal recessive

autosomal recessive forms (LGMD2) have an autosomal recessive forms (LGMD2) have an average prevalence of 1:14,000-1:20,000 at average prevalence of 1:14,000-1:20,000 at birthbirth

frequency differences among countriesfrequency differences among countries this depends on higher carrier frequencies of this depends on higher carrier frequencies of

single mutations, as 550delA for calpain 3 in single mutations, as 550delA for calpain 3 in Croatia, L276I for FKRP in Northern Europe, Croatia, L276I for FKRP in Northern Europe, 521delT for gamma-sarcoglycan in Northern 521delT for gamma-sarcoglycan in Northern AfricaAfrica

At least 25% of families are excluded from At least 25% of families are excluded from any known locus and 40% of typical LGMD any known locus and 40% of typical LGMD cases have no mutation in any known genecases have no mutation in any known gene

Tools to address the Tools to address the diagnosis of LGMDdiagnosis of LGMD Clinical presentation (MRI)Clinical presentation (MRI) WB analysisWB analysis Segregation studySegregation study Mutation detection in patientsMutation detection in patients Mutation detection in normal Mutation detection in normal

subjectssubjects Homogeneous collection of Homogeneous collection of

mutations and polymorphismsmutations and polymorphisms

Segregation analysisSegregation analysis

Analysis of 30 polymorphic markers Analysis of 30 polymorphic markers linked to LGMD2A, 2B, 2C-2F, 2I in sib linked to LGMD2A, 2B, 2C-2F, 2I in sib pairspairs

To find homozigosity… To find homozigosity…

Calpain 3 24 exons

dysferlin 55 exons

-sarcoglycan 8 ex (10)

FKRP 4 esons (8)

Telethonin 2 exons (3)

TRIM32 1 exons (7)

Titin 363 ex (35)

-sarcoglycan 10 exons

-sarcoglycan 6 ex (7)

-sarcoglyican 9 exons

Myotilin 9 exons

Lamin A/C 13 exons

Caveolin 3 2 exons (3)

Case 1Case 1

The gene isThe gene is known known It is composed ofIt is composed of five small size exonsfive small size exons There areThere are 10 patients, 10 patients, sons of consanguineous sons of consanguineous

parentsparents Expected mutations areExpected mutations are homozygoushomozygous Mutations haveMutations have nevernever been identified in this been identified in this

genegene There isThere is nono other memberother member of the same gene of the same gene

families (or pseudogenes) in the genomefamilies (or pseudogenes) in the genome

Case 2Case 2

The gene isThe gene is known known The putative function of the gene product The putative function of the gene product

is to serve as a is to serve as a transcription factortranscription factor Expected mutations are Expected mutations are dominantdominant Mutations have Mutations have nevernever been identified in been identified in

this genethis gene There are There are other membersother members of the same of the same

gene families (or pseudogenes) in the gene families (or pseudogenes) in the genomegenome

SequencingSequencing

With the ongoing With the ongoing reduction of costsreduction of costs (today about 2-4 (today about 2-4 €€/run), sequencing of /run), sequencing of PCR products is applied for mutation PCR products is applied for mutation detectiondetection

Sequencing is often thought of as the Sequencing is often thought of as the 'gold standard''gold standard' for mutation detection. for mutation detection.

This perception is distorted due to the This perception is distorted due to the fact that this is the only method of fact that this is the only method of mutation identificationmutation identification, but this does , but this does not mean it is the best for mutation not mean it is the best for mutation detectiondetection

Sequencing artifactsSequencing artifacts

FALSE POSITIVE (specificity)FALSE POSITIVE (specificity)

–when searching for when searching for heterozygous DNA differencesheterozygous DNA differences there are a number of potential mutations, there are a number of potential mutations, together with sequence artifacts, compressions together with sequence artifacts, compressions and differences in peak intensities that must be re-and differences in peak intensities that must be re-checked with additional primers and costschecked with additional primers and costs

FALSE NEGATIVE (sensitivity)FALSE NEGATIVE (sensitivity)

–loss of information farther away or closer to the loss of information farther away or closer to the primerprimer

–does not detect a minority of mutant molecules in does not detect a minority of mutant molecules in a wild-type environmenta wild-type environment

Current mutation Current mutation scanning techniquesscanning techniques SSCP (single strand conformation SSCP (single strand conformation

polymorphism) polymorphism) HA (heteroduplex analysis)HA (heteroduplex analysis) CCM (chemical cleavage of mismatch)CCM (chemical cleavage of mismatch) CSGE (conformation sensitive gel CSGE (conformation sensitive gel

electrophoresis)electrophoresis) DGGE (denaturing gradient gel DGGE (denaturing gradient gel

electrophoresis)electrophoresis) DHPLC (denaturing HPLC)DHPLC (denaturing HPLC) PTT (protein truncation test)PTT (protein truncation test) DGCE (denaturing gradient capillary DGCE (denaturing gradient capillary

electrophoresis)electrophoresis) direct sequencingdirect sequencing

SSCP

Mutation detection by Mutation detection by

heteroduplex heteroduplex

analysis: the analysis: the mutant mutant

DNADNA must first be must first be

hybridized with the hybridized with the

wild-type DNAwild-type DNA

to form a mixture of to form a mixture of

two homoduplexes two homoduplexes

and two and two

hheetteerroodduupplleexxeess

Heteroduplex analysisHeteroduplex analysis

DHPLCdenaturing HPLCfrom Transgenomic

DHPLC analysis DHPLC analysis at different at different

temperatures of temperatures of the columnthe column

Analysis of dystrophin exon 59Analysis of dystrophin exon 59

Homoduplex Homoduplex DNADNA::PCR fragments PCR fragments are identicalsare identicals

0.49

3.65

3.85

6.39

0 1 2 3 4 5 6 7 8

Retention Time (min)

0.0

0.5

1.0

1.5

Intensity(mV)

0.49

3.88

6.41

0 1 2 3 4 5 6 7 8

Retention Time (min)

0.0

0.5

1.0

1.5

2.0

2.5

Intensity(mV)

Heteroduplex Heteroduplex DNA:DNA:

PCR fragments PCR fragments are differentare different

DHPLC analysis of the CAPN3 gene DHPLC analysis of the CAPN3 gene (exon 11) (exon 11)

UV

UV

00

22

FL

UO

FL

UO

00

100100

1:21:2 1:41:4 1:61:6 1:81:8 1:101:10

POOLED PLATESA+B

PLATE A PLATE B

DHPLC analysis

E3277X

c.1390 del C

missense

c.1603 delGTAinsCT

splicing

frame-shift

stop

c.94-1G>A

c.401_404 del CCAA

c.583 C>T R195X

c.433 C>T R145X

c.713_714 delTT

c.1180 del G

c.1292 G>A W431X

c.1482 delG

c.2125 C>T Q709X

R768X

c.2880_2884 del CAAAC

Q986X

Q1087X

c.3285_3288 del CAGT

c.4100 delA

Q1564X

R1577X

c.4871_4872 del AG

R1666X

c.5091del G

Q1737X

c.5690 ins A

E1925X

R1967X

c.6980 delA

c.7006 C>T Q2336X

c.8391-2 A>G

c.8732 insA

R2982X

c.9429_9430 del GC

C3337Y

c.10223+1 G>A

S805X

c.1332-9 A>G

c.2302 C>T c.4326 delG

9563+1 A>G

R1314X

Q1373X

c.6353 delA

3367 del E

R3370X

c.8668+3 A>T

c.530+1 G>A

R1844Xc.1062 G>A W354X

c.9926_9929 ins AAGCc.1300_1310 del CTCAGGGTAGC

c.4119 del G

c.3464_3471 del GTTTGGAG

Y3158X

K105X

S622X

c.3336 del G

Q242X

c.9204_9207 del CAAA

R2905X

S2008X

E3277X

c.1390 del C

missense

c.1603 delGTAinsCT

splicing

frame-shift

stop

c.94-1G>A

c.401_404 del CCAA

c.583 C>T R195X

c.433 C>T R145X

c.713_714 delTT

c.1180 del G

c.1292 G>A W431X

c.1482 delG

c.2125 C>T Q709X

R768X

c.2880_2884 del CAAAC

Q986X

Q1087X

c.3285_3288 del CAGT

c.4100 delA

Q1564X

R1577X

c.4871_4872 del AG

R1666X

c.5091del G

Q1737X

c.5690 ins A

E1925X

R1967X

c.6980 delA

c.7006 C>T Q2336X

c.8391-2 A>G

c.8732 insA

R2982X

c.9429_9430 del GC

C3337Y

c.10223+1 G>A

S805X

c.1332-9 A>G

c.2302 C>T c.4326 delG

9563+1 A>G

R1314X

Q1373X

c.6353 delA

3367 del E

R3370X

c.8668+3 A>T

c.530+1 G>A

R1844Xc.1062 G>A W354X

c.9926_9929 ins AAGCc.1300_1310 del CTCAGGGTAGC

c.4119 del G

c.3464_3471 del GTTTGGAG

Y3158X

K105X

S622X

c.3336 del G

Q242X

c.9204_9207 del CAAA

R2905X

S2008X

PTTPTTprotein truncation testprotein truncation test

Sensitivity Sensitivity 1000-bp fragment > 85% 1000-bp fragment > 85%

Detects only nonsense mutationsDetects only nonsense mutations Post PCR time: 48-72 hours Post PCR time: 48-72 hours

(translation/trascription, gel (translation/trascription, gel preparation, loading and run, analysis preparation, loading and run, analysis of results)of results)

Use of 35S radioactivityUse of 35S radioactivity No special equipment requiredNo special equipment required mRNA as starting templatemRNA as starting template

                              

                              

Applications of PTTApplications of PTT(% of truncating mutations)(% of truncating mutations)

Polycystic Kidney Disease Polycystic Kidney Disease PKD1PKD1 95% 95% Familial Adenomatous Polyposis Familial Adenomatous Polyposis APC APC 95% 95% Ataxia telangiectasia Ataxia telangiectasia ATM ATM 90%90% Hereditary breast and ovarian cancer Hereditary breast and ovarian cancer BRCA1-2BRCA1-2 90%90% Duchenne Muscular Dystrophy Duchenne Muscular Dystrophy DMDDMD 90%?90%? Fanconi anemia Fanconi anemia FAAFAA 80%80% Hereditary non-polyposis colorectal cancer Hereditary non-polyposis colorectal cancer hMSH1-2hMSH1-2 70%-80% 70%-80% Neurofibromatosis type 2 Neurofibromatosis type 2 NF2NF2 65%65% Hunter Syndrome Hunter Syndrome IDSIDS 50%50% Neurofibromatosis type 1 Neurofibromatosis type 1 NF1 NF1 50% 50% Cystic Fibrosis Cystic Fibrosis CFTRCFTR 15%15%

Molecular inversion probe (MIP) genotyping

•MIP genotyping uses circularizable probes with 5′ and 3′ ends that anneal upstream and downstream of the SNP site leaving a 1 bp gap•Polymerase extension with dNTPs and a non-strand-displacing polymerase is used to fill in the gap

•Ligation seals the nick, and exonuclease I is used to remove excess unannealed and unligated circular probes•The resultant product is PCR-amplified and the orientation of the primers ensures that only circularized probes will be amplified•The resultant product is hybridized and read out on an array of universal-capture probes

GoldenGate uses extension ligation between annealed locus-specific oligos (LSOs) and allele-specific oligos (ASOs)

An allele-specific primer extension step is used to preferentially extend the correctly matched ASO (at the 3′ end) up to the 5′ end of the LSO primer

Ligation then closes the nick

GoldenGate genotyping assay

A subsequent PCR amplification step is used to A subsequent PCR amplification step is used to amplify the appropriate product using common amplify the appropriate product using common primers to ‘built-in’ universal PCR sites in the primers to ‘built-in’ universal PCR sites in the ASO and LSO sequencesASO and LSO sequences

The resultant PCR products are hybridized and The resultant PCR products are hybridized and read out on an array of universal-capture probesread out on an array of universal-capture probes

GoldenGate genotyping assay

454 technology:DNA fragmentation and adaptor ligation

454 technology:a water-in-oil emulsion is created:a single molecule of DNA with a single bead

454 technology:Beads with clones are selected and assembled onto a planar substrate

454 technology:Sequencing by synthesispyrosequencing

Up to 100 Million bpin 8 hours can be readAmbiguities arise for homopolymeric tracts

7.4 x coverage

234 runs

24.5 billions bp

11 genetic diseases !!

NimbleGen sequence capture