Eur Food Res Technol (2012) 234:853–861

DOI 10.1007/s00217-012-1688-9

ORIGINAL PAPER

Molecular diagnostics of Lemon Myrtle (Backhousia citriodora versus Leptospermum citratum)

Thomas Horn · Anna Barth · Michael Rühle · Annette Häser · Gabriele Jürges · Peter Nick

Received: 20 October 2011 / Revised: 1 February 2012 / Accepted: 8 February 2012 / Published online: 29 February 2012© Springer-Verlag 2012

Abstract ‘Lemon Myrtle’ is becoming increasingly pop-ular in Europe both for use in cuisine and phytotherapy.However, this common name covers two completely diVer-ent species, Backhousia citriodora F. Muell. and Lepto-spermum citratum Challinor, Cheel & A.R.Penfold. Thesespecies diVer with respect to secondary compounds andeven can cause, if mixed up and applied in high dose, toxiceVects. We describe how the two species can be discrimi-nated microscopically making use of diVerences in the mor-phology of leaf pavement cells and the relative size ofpalisade parenchyma. Based on the large subunit of ribu-lose-1,5-bisphosphate carboxylase oxygenase (rbcL) asmolecular marker, the phylogenetic position of the two spe-cies within the Myrtaceae could be clariWed. This sequenceinformation was used to develop a simple assay to discrim-inate the two species even in dried and highly fragmentedmixtures as typically occurring in commercial samples.This assay utilises the occurrence of single-nucleotideexchanges between those species that produce diVerentfragments when the rbcL ampliWcates are restricted withSac II.

Keywords Backhousia citriodora F.Muell · Lemon Myrtle · Leptospermum citratum Challinor, Cheel & A.R.Penfold · Molecular identiWcation · Polymerase chain reaction (PCR) · Ribulose-bisphosphate carboxylase oxygenase large subunit (rbcL)

Introduction

As part of the trend for functional foods and dietary/healthsupplements numerous plant products derived from tradi-tional herbal medicine of foreign cultures enter the Europeanmarket. In the public perception, herbal products are consid-ered to be ‘natural’ and therefore a priori harmless since theyhad been used traditionally. However, this perception ignoresthe fact that in most cases, there exists a speciWc cultural andmedical tradition that safeguards against undesired sideeVects, adverse interactions, toxicity, and adulteration. Whenthe use of these plants becomes isolated from this traditionalcontext, health risks may result (reviewed in [1]). Many ofthese novel herbs are located somewhere at the interfacebetween health and food supplements, and only few are clas-siWed as medicines and fall within the remit of the EU Tradi-tional Herbal Medicinal Products Directive. Most herbalpreparations that do not have a long historical record of usein the EU, or which do not have a deWned medicinal use fallunder the legislation of the Novel-Food-Regulation of theEuropean Union [2]. Such food products require an explicitadmission, before they can be commercialised. This includesthat these products and their components can be unequivo-cally identiWed to exclude potential health risks. Thus, robustand reliable diagnostics of these plants and their parts in foodpreparations is a prerequisite for the control and surveillanceof the Novel-Food-Regulation.

Food monitoring has the aim to safeguard consumersagainst deception and misinformation and is pivotal forconsumer trust [3]. The non-standardised traditionalnomenclature for novel herbs in combination with the prev-alence of dried herbal mixtures poses special challenges tofood monitoring. So far, microscopic diagnostics has beenthe most reliable way to test multi-component specimenssuch as those typical for herbal mixtures. There exists a

T. Horn · A. Barth · M. Rühle · A. Häser · G. Jürges · P. Nick (&)Molecular Cell Biology, Botanical Institute, Karlsruhe Institute of Technology, Kaiserstr. 2, 76128 Karlsruhe, Germanye-mail: peter.nick@kit.edu

123

854 Eur Food Res Technol (2012) 234:853–861

wealth of technical literature that describes and illustratesfood plants commonly used in Europe, for example, toassist microscopical diagnostics [4]. However, for most ofthe introduced novel species, such information is com-pletely lacking. This is not surprising—diagnostic assays ofthose plants have not been in the focus of the traditionalmedical systems that use those plants, but mainly deal withthe medical and beneWcial eVects of these herbs.

The economic payoV that can be achieved by trendyherbal preparations, the limitations of supply for these exoticherb, and the diYculty to reliably address these ingredients infood diagnostics provide ideal conditions for the spread ofsurrogate or adulterated preparations. This problem warrantsnovel diagnostic methods that allow the identiWcation of theindividual components in these herbal mixtures. These meth-ods have to be reliable, versatile, and cost-eVective.

An example for the conXict between traditional nomen-clature and the diYculty to warrant consumers againstpotential hazards is the novel trend herb ‘Lemon Myrtle’derived from traditional medicine of the Australian Aborig-ines and presently popularised as ‘Queen of the LemonHerbs’ as major ingredient of so called Bushfood Flavours.‘Lemon Myrtle’ actually comprises two diVerent species ofthe Myrtaceae: Backhousia citriodora F.Muell (commonnames ‘Lemon Myrtle’, ‘Lemon Scented Myrtle’, ‘LemonScented Ironwood’ [5]), and Leptospermum citratum (ex.J.F.Bailey & C.T.White) Challinor, Cheel & A.R.Penfold(the taxonomy of this genus has been revised several times,therefore there exist several traditional synonyms that arestill in use: Leptospermum petersonii subsp. petersonii,Leptospermum petersonii F.M.Bailey, and LeptospermumXavescens var. citratum J.F.Bailey & C.T.White; commonnames ‘Lemon Myrtle’, ‘Lemon Tea Tree’, ‘LemonScented Tea Tree’ [6]). Both species originate from NorthWest Australia (Queensland) are found as shrubs or smalltree and are rich in aromatic oils.

The Australian Aborigines have used ‘Lemon Myrtle’for both cooking and healing. The leaves are often used asdried Xakes, or in the form of an encapsulated Xavouressence for enhanced shelf-life and are used as Xavours inshortbread, pasta, and macadamia and vegetable oils. How-ever, the main use is teas, mostly in mixtures. In addition,‘Lemon Myrtle’ is used as lemon Xavour replacement inmilk-based foods, such as cheesecake or ice-cream to avoidcurdling associated with acidity of lemon fruits. In additionto its aromatic properties, extracts of ‘Lemon Myrtle’ pos-sess a strong antimicrobial activity [7], are used as insectrepellents [8], cure certain viral diseases such as molluscumcontagiosum [9] and recently have acquired interest aseYcient antifungal compound in the treatment of skin dis-eases [10] and food protection [11].

Leaves of ‘Lemon Myrtle’ are unusually rich in aromaticoils (typically up to 5%), with citral as dominating com-

pound with additions of neral, geranial, myrcene, linalool,citronellal, cyclocitral and methyl-heptenone. However,rare chemotypes with a high content of L-citronellal existas well, at least in B. citriodora [12]. Despite the generallypositive eVects of ‘Lemon Myrtle’, toxicity on mammaliancells [13], especially skin cells [14] have been reported,depending on concentration and composition of the extract.This underlines the need to control the use of ‘Lemon Myr-tle’ and to discriminate at least between the two speciescommercialised as ‘Lemon Myrtle’. To address not only thecommon tea mixtures, but also more processed forms ofthis product, we combined traditional microscopic analysiswith molecular identiWcation based on the large subunit ofribulose-1,5-bisphosphate carboxylase oxygenase (rbcL).This marker has been recently proposed by an internationalconsortium together with the matK marker as identiWer forgenetic bar coding of plants due to high coverage, sequenc-ing accessibility and discriminative power [15]. Using thismarker, we can clearly locate the position of the two spe-cies of ‘Lemon Myrtle’ within the Myrtaceae, and we candevelop a simple assay to discriminate the two species evenin dried and highly fragmented mixtures as typically occur-ring in commercial samples by combining PCR with arestriction digest.

Materials and methods

Plant material and samples

Since vegetative plant morphogenesis is variable dependingon environmental factors, mainly light quantity and quality,the specimens were cultivated in parallel under identical con-ditions (substrate Floraton 3, day temperature 18–25 °C,night temperature 15 °C, illumination time 10 h) in theBotanical Garden of the Karlsruhe Institute of Technology.The specimens were purchased from a commercial source(Rühlemanns, Horstedt, Germany), and their identity veriWedby the morphology of Xowers and leaves based on the taxo-nomic literature [16]. They are maintained as living specimensunder the IPEN codes xx-0-UNKAR-2012-1844-Baccit-01(B. citriodora F.Muell) and xx-0-UNKAR-2012-1845-Lepcit-01 (L. citratum (ex. J.F.Bailey & C.T.White) Challinor,Cheel & A.R.Penfold). Four commercial tea samples wereused for validation of the assay and partially sorted and iden-tiWed based on the microscopic criteria developed during thecurrent study prior to molecular analysis. The composition ofthese samples is given in Table 2.

Extraction of genomic DNA

Fresh leaf material (preferably young leaves) was har-vested from healthy plants. About 40 mg of the sample were

123

Eur Food Res Technol (2012) 234:853–861 855

transferred into a reaction tube (2 ml, Eppendorf) togetherwith one stainless steel bead (diameter 5 mm) and shockfrozen in liquid nitrogen. The frozen sample was thenground three times for 15 s at 20 Hz (Tissuelyser, Qiagen,Hildesheim, Germany). After each individual grinding step,the sample was returned into liquid nitrogen to ensure thatthe powder did not thaw during the extraction. GenomicDNA was extracted using a modiWed extraction methodbased on cetyl trimethyl ammonium bromide (CTAB, [17])using about 25 mg ground and frozen leaf tissue. The pow-der was complemented with 1-ml pre-warmed extractionbuVer (3% w/v CTAB) containing 8 �l/ml mercaptoethanoland incubated for 30 min at 55 °C followed by a centrifuga-tion to remove debris. Subsequently, the sample wasdigested with proteinase K (55 °C, 30 min), then mixedwith 750 �l of chloroform/isoamylalcohol (24:1) and thenspun down for 10 min (14,000 g, 25 °C), and the aqueousupper phase (containing the DNA) was transferred into afresh reaction tube; the DNA was precipitated with 0.65volumes of isopropanol, collected by centrifugation (10 min,14,000 g), washed with 70% EtOH and dissolved in 50 �lddH2O. The concentration of the eluted DNA was deter-mined photometrically (NanoDrop ND-100, peqlab). TheE260/E280 of the extracted DNA was between 1.7 and 2.1.The quality of the DNA extracts was controlled by electro-phoresis on a 1.5% agarose gel supplemented with 5% v/vof the Xuorescent dye SYBR Safe (Invitrogen).

PCR-ampliWcation and restriction digestion of rbcL

A partial sequence of the large subunit of the ribulose-bis-phosphate carboxylase gene (rbcL), rbcLa, was ampliWed byPCR in a 10-�l reaction using 50 ng of genomic DNA astemplate and a reaction mix containing single-strength buVer(thermopol, NEB), 200 �M mixed dNTPs (NEB), 200 nM ofeach primer (rbcLa_F/rbcLa_R, Invitrogen), 0.4 units Taqpolymerase (NEB) and 10 mg/ml bovine serum albumine(Sigma-Aldrich, Deisenhofen, Germany). The ampliWcateswere separated by electrophoresis in a 1.5% agarose gel andtheir size veriWed using a 100-bp DNA ladder (NEB) afterXuorescent staining with SYBR Safe (Invitrogen). TheampliWcates were extracted from the gel using the Nucleo-Spin® Extract II kit (Macherey–Nagel, Karlsruhe), followingthe protocol of the producer, and then sequenced (GATCBiotech, Konstanz). The sequences were veriWed by BLASTsearch and alignment with related rbcL-sequences (ClustalX,http://www.clustal.org) and are deposited in Genebank underthe accession numbers JN676919 (L. citratum) andJN676920 (B. citriodora). To discriminate the two species,6 �l of the rbcLa PCR were digested overnight at 37° C in a25-�l reaction volume consisting of 2.5 �l 10£ enzymebuVer (NEB, No. 4), 2.0 �l Sac II enzyme (NEB) and 14.5 �lbidestilled water. The digested ampliWcates were separated

by electrophoresis in a 1.5% agarose gel along with a 100-bpDNA ladder as size marker (NEB).

Phylogenetic analysis of the rbcL sequence

The rbcL sequences were used as input for a BLAST searchfor Myrtaceae rbcL, the retrieved 16 sequences were auto-matically aligned using the ClustalX algorithm in MEGA4.0 [18] and the evolutionary relationships were inferred bymeans of the neighbour-joining algorithm [19] with boot-strap values based on 500 replicates [20]. Branches corre-sponding to partitions reproduced in less than 50%bootstrap replicates were collapsed. All positions (bothcoding and non-coding) were included; gaps and missingdata were eliminated from the dataset.

Light microscopy

Leaves and shoots of all specimens were documented macro-scopically (Exilim Z750, Casio) and by stereo microscopy(M420, Leica; Bensheim) equipped with a digital camera(DFC 500, Leica; Bensheim) both in the fresh state and afterdrying. In addition, tangential hand sections from the adaxialand the abaxial surface of completely developed leaves werebrightened with 60% chloral hydrate and then analysed under alight microscope (Axioskop, Zeiss; Jena) equipped with a digi-tal image acquisition system (Axio-Cam, Zeiss; Jena). Cross-sections obtained after Wxation for 50 min in paraformaldehyde(4% w/v) in 50 mM 1,4-piperazine-di-ethanesulfonic acid(PIPES) with 3 mM ethylene glycol-bis (�-aminomethylether)-N,N,N�,N�-tetraacetic acid (EGTA), adjusted to pH 6.8with NaOH. After Wxation, the specimens were washed threetimes for 10 min in Wxation buVer without paraformaldehydeand subsequently dehydrated by a ethanolic series (50, 70, 90,100, 100%; 30 min in each step). For embedding in LR White(Plano, Wetzlar, Germany), the specimens were led through aseries with increasing proportions of LR White over EtOH onan orbital shaker (ratio 1:2 over night, 1:1 for 4 h, 2:1 overnight, pure LR White over the day). Subsequently, the LRWhite embedded specimens were transferred into gelatine cap-sules used for electron microscopy and were then hardenedover night in a drying oven. The embedded specimens werethen sectioned on a microtome, collected on a slide and stainedby toluidine blue [21], labelling non-ligniWed cell walls violet.

Results and discussion

Morphological and histological characteristics of B. citriodora and L. citratum

Plants of the two species can be clearly discriminated byhabitus and morphology. Plants of B. citriodora show a

123

856 Eur Food Res Technol (2012) 234:853–861

clearer apical dominance, whereas in L. citratum sidebranches compete with the main axis producing a shrub-like appearance (Fig. 1a). Leaves of B. citriodora exhibit abroader lamina, with young leaves being slightly tinted byanthocyanins (Fig. 1b), whereas leaves of L. citratum aresmaller and narrower with an eliptoidical shape and anintensely green colour (Fig. 1c).

Although it is easy to discern the two species, whenwhole plants are considered, the discrimination of commer-cial products based on these species is much more diYcult.Both species share typical features of Myrtaceae such asnumerous schizogenic oil cavities (Fig. 2c, d), idioblasts,Wlled with calcium oxalate druses and cells with single cal-cium oxalate crystals lining the vascular bundles (Table 1).Moreover, leaves of both species are covered with numer-ous unicellular, unbranched trichomes.

However, the two species can be discriminated fromcross-sections of the shoots (Fig. 2c, d). In B. citriodora, thecross-section is round. In both cases, numerous oil cavitiesare embedded in the cortical parenchyma. In B. citriodora,the cortical parenchyma is separated into a external layer richin chloroplasts, and an inner, chloroplast-depleted layer. Thecortical parenchyma is subtended by a massive ring ofphloëm Wbers delineating phloëm, cambium and xylem, sur-rounding the extensive central pith parenchyma. In contrast,the cross-section of the shoot is triangular in L. citratum, andthe central pith parenchyma is narrower in relation to the cor-tical parenchyma outside of the xylem ring.

The leaf of B. citriodora is bifacial with one tier of pali-sade parenchyma, subtended by a conventional spongyparenchyma with large intercellular spaces (Fig. 2a). Incontrast, L. citratum is equifacial, with two tiers of palisadeparenchyme at the upper, adaxial and one tier at the lower,abaxial side of the leaf, separated by one or two tiers ofspongy parenchyma (Fig. 2b).

For the discrimination in processed samples, such asdried tea mixtures, the shape of epidermal pavement cellsseems to be marker with the best discriminative power(Fig. 3a): In B. citriodora, only the lower, abaxial epider-mis harbours guard cells. These are anemocytic. Pavementcells are generally puzzle-shaped in both sides of theleaves, polygonoid cells are observed only above vascularbundles. Unicellular, thick-walled trichomes are found inboth leaf sides, whereby in the abaxial side, additionally,long hairs are found, in the adaxial side, trichomes appearslightly twisted (Fig. 3b). In L. citratum, pavement cellsare always polygonoid and unlobed on both sides of theleaf (Fig. 3a). In addition, distinct cuticular folds areobserved on both sides of the leaf that are absent in B.citriodora. Again, unicellular, thick-walled and slightlybent trichomes can be found on both leaf sides. However,here, the lower, abaxial face of the leaf the trichomes areless abundant as compared to the upper, adaxial face(Fig. 3b). Moreover, the long hairs met in B. citriodora areabsent in L. citratum. A summary of the discriminativetraits is given in Table 1.

Fig. 1 Habitus of ‘Lemon Myrtle’. a Young plant of B. citriodora and L. citratum in comparison. b Shoot tip and three leaves illustrating diVerentstages of expansion for B. citriodora. c as b for L. citratum. Size bar 50 mm

Backhousia citriodora

Leptospermumcitratum

Backh

ou

sia citriod

ora

Lep

tosp

ermu

m citratu

m

A B

C

123

Eur Food Res Technol (2012) 234:853–861 857

Fig. 2 Cross-sections through the aerial organs of ‘Lemon Myrtle’after staining with Toluidine Blue. a, b Cross-section through the leafblade in B. citriodora (a) and L. citratum (b). c, d Cross-section of the

shoot in B. citriodora (c) and L. citratum (d). Abbreviations: spongy pspongy parenchyma, palisade p palisade parenchyma, protx protoxy-lem ep epidermis, hr hair

B

C D

Backhousia citriodora Leptospermum citratum

50 µm50 µm

palisade p.spongy p.

oil

palisade p.

spongy p.

A

epidermal cells

0.2 mm0.2 mm

oil

ep

oil

cortex

xylem

protxy.

hr.

protxy.

xylem

ep

cortex

Table 1 Characteristic features observed in fully developed leaves of B. citriodora F.Muell and L. citratum Challinor, Cheel & A.R.Penfold

E-ad adaxial epidermis, E-ab abaxial epidermis

Backhousia citriodora Leptospermum citratum

Leaf type Bifacial Equifacial

E-ad Puzzle-shaped pavement cells, polygonoid cells above vascular bundles

Polygonal pavement cells, distinct cuticular folds

E-ab Like in E-ad Like E-ad, with cuticular folds

Guard cells E-ad None Tetracytic, anemocytic

Guard cells E-ab Anemocytic Tetracytic, anemocytic

Trichomes E-ad Unicellular, unbranched, weakly coiled Unicellular, unbranched, weakly coiled trichomes that are aligned

Trichomes E-ab Unicellular, unbranched, like in E-ad, in addition, more thick-walled and longer unicellular, unbranched, trichomes

Less than in E-ad

Mesophyll Numerous schizogenic oil cavitiesIdioblasts, calcium oxalate drusesCell Wles Wlled with single calcium oxalate

crystals lining vascular bundles

Numerous schizogenic oil cavitiesIdioblasts, calcium oxalate drusesCell Wles Wlled with single calcium oxalate crystals

lining vascular bundles

Palisade cells/pavement cell Mostly 6–8 Mostly 2–5

123

858 Eur Food Res Technol (2012) 234:853–861

ClariWcation of the phylogenetic position of the two species of ‘Lemon Myrtle’ based on the rbcL marker

The taxonomy of the genus Leptospermum has beenrevised several times [6] and is still obscured by the coexis-tence of diVerent synonyms, not to speak about the ambigu-ous common names used by commercial providers. Wetherefore used a partial sequence of rbcL proposed as oneof the central molecular markers for plant genetic bar cod-ing [15] to determine the position of L. citratum withrespect to B. citriodora and other Myrtaceae and to deWnesequence divergences that might be useful for moleculardiagnostics. We successfully obtained and veriWed a rbcLsequence for both L. citratum (Genebank accession

JN676919) and B. citriodora (Genebank accessionJN676920). As to be expected, both sequences were highlysimilar (Fig. 4a). Available rbcL-sequences of the coreMyrtaceae, Olinia emarginata and Strasbourgeria robustaas outgroup were used to determine the phylogenetic posi-tion of the two specimens of ‘Lemon Myrtle’ investigatedin the current study. B. citriodora rbcL was located, alongwith a previously published sequence into the core Myrta-ceae such as species of the genera Eugenia, Myrtus,Eucalyptus, Myrcianthes and Metrosideros. In contrast,L. citratum was found to be basal to the core Myrtaceaepositioned distal to O. emarginata consistent with thereclassiWcation of the genus Leptospermum into a speciWcsubgenus Leptospermoideae.

Fig. 3 a View on the adaxial, upper and the abaxial, lower, leaf epi-dermis of ‘Lemon Myrtle’ as visible by brightWeld microscopy in tan-gential leaf sections. DiVerent focal planes are shown for the abaxialepidermis to clarify the structure of guard cells and trichomes. Theschematic drawings emphasise the relative size of epidermal pavement

cells over the subtending cells of the palisade parenchyma (shaded ingreen). Note that puzzle-shaped pavement cells occur only in B. citri-odora, whereas these cells are polygonal in L. citratum. b Trichomesat both leaf sides of the two ‘Lemon Myrtle’ accessions

Adaxial epidermis Abaxial epidermisB

ackh

ousi

a ci

trio

dora

Lept

ospe

rmum

citr

atum

A B

Lept

ospe

rmum

citr

atum

Bac

khou

sia

citr

iodo

ra

Adaxial epidermis Abaxial epidermis

100 µm 100 µm

100 µm100 µm

123

Eur Food Res Technol (2012) 234:853–861 859

Molecular identiWcation of ‘Lemon Myrtle’ based on restriction of the rbcL marker

Despite the high conservation of the rbcL marker betweenB. citriodora and L. citratum, a molecular diVerentiationshould become possible by restriction analysis. We chose

as target a speciWc Sac II restriction site diVering betweenthe two species of ‘Lemon Myrtle’. The digest should yieldtwo fragments of 458 and 141 bp in L. citratum, whereas inB. citriodora, the original 599 bp rbcL ampliWcate wouldremain complete (Fig. 5a). We tested this prediction usingdried leaves from both species, ampliWed the rbcL marker

Fig. 4 Characteristics of the rbcL marker isolated from B. citriodoraand L. citratum. a alignment with restriction sites. b NJ tree of 17 spe-cies of the Myrtaceae based on the rbcL marker. Bootstrap values are

based on 500 replicates. Boxes highlight the position of B. citriodoraand L. citratum

Primer rbcLa_F Psi1>>>>ATGTCACCACAAACAGAGACTAAAGC>>>> |

Back 1 ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAACTGACTTATNATACTNCTGACTATGAAACCAAAGATA 100Lept 1 ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAACTGACTTATTATACTCCTGAATATGAAACCAAAGATA 100

BseR1 Bsu36 BstAPEcoRV Bsm1 | EcoN1 SpAcc| AlwN1

| | | | || |Back 101 CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCAGGAGTTCCTCCTGAGGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGAC 200Lept 101 CTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCTCCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGAC 200

|Sac2

SpDon Psi1 Bcg1a SpAcc Bcg1b Bpm1| | | | | |

Back 201 AACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTATAAAGGAAGATGCTACCACATCGAGCCTGTTGCTGGAGAAGAAAATCAATATATATGTTAT 300Lept 201 AACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTATAAAGGAAGATGCTACCACATCGAGCCTGTTGCTGGAGAAGAAAATCAATATATATGTTAT 300

SpDon BssH2| |

Back 301 GTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTAC 400 Lept 301 GTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAATATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTAC 400

Bpm1 Xmn1| |

Back 401 GTCTGGAGGATCTGCGAATCCCTCCTTCCTATACGAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCG 500 Lept 401 GTCTGGAGGATCTGCGAATCCCTACTGCCTATACGAAAACTTTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGGCG 500

Bbs1 Xmn1| |

Back 501 TCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGTGGTGGACTTGATTTTAC 599Lept 501 TCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAACTACGGTAGAGCAGTTTATGAATGTCTTCGCGGTGGACTTGATTTTAC 599

<<<<CGTGGTGGACTTGATTTTAC<<<<Primer rbcLa_R

A

B

123

860 Eur Food Res Technol (2012) 234:853–861

and restricted the ampliWcates by Sac II. The unrestrictedrbcL ampliWcate was found to correspond to one band ofaround 600 bp in size for all species (data not shown).Upon Sac II restriction, there was no change for the B. citri-odora ampliWcate, consistent with the prediction that, here,no Sac II recognition site is present (Fig. 5b). In contrast,restriction of L. citratum yielded a larger fragment ofaround 450 bp and a smaller fragment of around 150 bp,consistent with the prediction (Fig. 5a). A control, wherethe DNA template in the PCR mix was omitted, wasincluded as negative control to check for potential contami-nations. In addition to the two species of ‘Lemon Myrtle’,we tested Dracocephalum moldavica, which shares a simi-lar citric Xavour and is sometimes used in combination with‘Lemon Myrtle’ (e.g. in commercial sample 3). Here, therestriction pattern resembled that observed for L. citratum.

We Wnally tested whether this assay can be administeredto commercial samples where typically dried leaf frag-ments of ‘Lemon Myrtle’ are blended with other herbalcompounds (Table 2). Sample D3 contained ‘Lemon Myr-tle’ as second compound followed by ‘Moldavian Dragon-head’ and produced a pattern with three bands (Fig. 5c) of600 bp (corresponding to the full-length rbcL ampliWcate)and 450 + 150 bp (corresponding to the fragmentsexpected for L. citratum). The morphological analysisgave clear evidence for B. citriodora, however (data notshown). To test, whether the two smaller bands are actu-ally originating from B. citriodora or from the surrogateD. moldavica, the leaf fragments recognised as ‘Lemon

Myrtle’ were sorted from the mixture and extracted andanalysed separately. The resulting sample D1 yielded onlyone band of 600 bp as to be expected for B. citriodora,suggesting that the smaller bands originated from thesurrogate D. moldavica. Sample D4 contained ‘LemonMyrtle’ as one of the minor compounds and produced a bandof 600 bp, which was consistent with the results of themorphological analysis clearly identifying B. citriodora.Again, these fragments were sorted and analysed sepa-rately yielding D2 that produced a single band of 600 bp asexpected. In sample D5, ‘Lemon Myrtle’ (identiWed mor-phologically as B. citriodora) was a major component.Again, a single band of 600 bp was observed. In the lastsample, D6, ‘Lemon Myrtle’ the morphological featuresidentiWed L. citratum as major component, consistentwith the presence of the 450 and 150 bp bands. The upper600-bp band, corresponding to the undigested ampliWcate,is most likely originating from the other components thatdo not harbour a corresponding Sac2 restriction site (datanot shown).

Conclusions and outlook

As exemplary case study for many other cases, whereplants used in traditional medical or culinary cultures aretransferred as trend food supplements to the Western mar-kets, we have analysed ‘Lemon Myrtle’, actually two dis-tantly related species of the Myrtaceae derived from the

Fig. 5 Molecular diagnostics of ‘Lemon Myrtle’ based on restrictiondigest of the rbcL genomic fragment a Predicted fragment sizes for di-gest with Sac II in B. citriodora versus L. citratum. b VeriWcation ofthe prediction using pure leaf samples of B. citriodora, L. citratum andthe ‘Lemon Myrtle’ surrogate D. moldavica. M size marker (100-bpDNA ladder), DNA control test for the speciWcity of the PCR withoutadded DNA template. Arrows indicate the two smaller fragments

resulting from the restriction digest with Sac2. c Validation of the as-say using commercial tea blends containing ‘Lemon Myrtle’. SamplesD1 and D2 have been sorted as b. Citriodora from the commercial prod-ucts D3 and D4, respectively, using the microscopic discrimination giv-en in Table 1. Commercial product D3 contained also Dracocephalummoldavicum, commercial product D4 did not. Commercial product D5contained B. citriodora, D6 L. citratum as veriWed by microscopy

100 bp

200 bp

300 bp400 bp500 bp600 bp

141 bp

599 bp

458 bp

B. c

itrio

dora

, rbc

L,

Sac

2 di

gest

L. c

itrat

um, r

bcL,

S

ac2

dige

st

A B C

100

500

1000

bp

123

Eur Food Res Technol (2012) 234:853–861 861

culture of the Australian Aborigenes. By a combination ofclassical microscopic analysis with molecular diagnosticsusing restriction length polymorphisms in the rbcL marker,we can discriminate between B. citriodora and L. citratumin dried mixtures as typically encountered in commercialsamples.

Principally, this approach should be transferrable tomore processed samples as well (such as ‘Lemon Myrtle’Xakes), where anatomical features are diYcult to beassessed. However, if not supported by anatomical features,the approach suVers from limitations: in the presence ofD. moldavica (which in some samples is added due to itssimilar lemon-type Xavour), the restriction pattern hampers thediscrimination between B. citriodora and L. citratum. Thus,in case that only the upper RAPD band is detected, thisreports that neither L. citratum nor the surrogate D. moldav-ica are present. However, the presence of the smallerRAPD does not with certainty report the presence of L. cit-ratum, because the same pattern could be caused by the sur-rogate D. moldavica. In order to extend the discriminativepower of the assay to samples, where the anatomical fea-tures have been lost due to strong processing, we presentlydevelop molecular and microscopic markers for a clearidentiWcation of D. moldavica. First data show that a strat-egy based on nested primers for the rbcL marker allows forsuperior discriminative power.

Acknowledgments We acknowledge Angelika Piernitzki andJoachim Daumann, Botanical Garden of the University, for excellenthorticultural support during the project and Olivia Huber for skillfultechnical support during DNA extraction and analysis.

ConXict of interest The authors declare that they do not have anyconXict of interest.

References

1. Ernst E (1998) Harmless herbs? A review of the recent literature.Am J Med 104:170–178

2. European Parliament and European Council (1997) Regulation onnovel foods and novel food ingredients no. 258/97 of 27 January1997. J Eur Comm L 43:1–5

3. Green JM, Draper AK, Dowler EA (2003) Short cuts to safety: riskand `rules of thumb’ in accounts of food choice. Health Risk Soc5:33–52

4. Hahn H, Michaelson I (1996) Mikroskopische Diagnostik pXanzli-cher Nahrungs-, Genuss- und Futtermittel, einschliesslich Gew-ürze. Springer, Berlin

5. von Mueller FJH (1859) Fragmenta Phytographiae Australiae 1:786. Thompson J (1989) A revision of the genus Leptospermum (Myrt-

aceae). Telopea 3:301–4487. Atkinson W, Brice H (1955) Antibacterial substances produced byXowering plants. Aust J Exp Biol 33:547–554

8. Greive KA, Staton JA, Miller PF, Peters BA, Oppenheim VMJ(2010) Development of Melaleuca oils as eVective natural-basedpersonal insect repellents. Aust J Entomol 49:40–48

9. Burke BE, Baillie JE, Olson RD (2004) Essential oil of Australianlemon myrtle (Backhousia citriodora) in the treatment of mollus-cum contagiosum in children. Biomed Pharmacother 58:245–247

10. Hood JR, Burton DM, Wilkinson JM, Cavanagh HMA (2010) TheeVect of Leptospermum petersonii essential oil on Candida albi-cans and Aspergillus fumigatus. Med Mycol 48:922–931

11. Lazar-Baker E, Hetherington S, Ku V, Newman S (2011) Evalua-tion of commercial essential oil samples on the growth of posthar-vest pathogen Monilinia fructicola (G. Winter) Honey. Lett ApplMicrobiol 52:227–232

12. Doran JC, Brophy JJ, Lassak EV, House APN (2001) Backhousiacitriodora F. Muell. Rediscovery and chemical characterization ofthe L-citronellal form and aspects of its breeding system. FlavourFragr J 16:325–328

13. Hayes AJ, Markovic B (2002) Toxicity of Australian essential oilBackhousia citriodora (Lemon myrtle). Part 1. Antimicrobialactivity and in vitro cytotoxicity. Food Chem Toxicol 40:535–543

14. Hayes AJ, Markovic B (2003) Toxicity of Australian essential oilBackhousia citriodora (Lemon myrtle). Part 2. Absorption andhistopathology following application to human skin. Food ChemToxicol 41:1409–1416

15. Consortium for the Barcode of Life (2009) A DNA barcode forland plants. Proc Natl Acad Sci USA 106:12794–12797

16. Walsh NG, Entwisle TJ (1996) Flora of Victoria, vol 3. InkataPress, Melbourne

17. Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure fromsmall quantities of fresh leaf tissues. Phytochem Bull 19:11–15

18. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecularevolutionary genetics analysis (MEGA) software version 4.0. MolBiol Evol 24:1596–1599

19. Saitou N, Nei M (1987) The neighbor-joining method: a newmethod for reconstructing phylogenetic trees. Mol Biol Evol4:406–425

20. Felsenstein J (1985) ConWdence limits on phylogenies: an approachusing the bootstrap. Evolution 39:783–791

21. O’Brien TP, Feder N, McCully ME (1964) Polychromatic stainingof plant cell walls by Toluidine Blue O. Protoplasma 59:367–373

Table 2 Declared composition of commercial samples used in this study and rbcL fragments obtained after digest with Sac2

Sample Declared composition rbcL-Sac2 fragments (bp)

D3 ‘Lemon Grass’, ‘Lemon Myrtle’, ‘Moldavian Dragonhead’, ‘Elderberry Flowers’ »600, »450, »150

D4 ‘Ginger’, ‘Lemon Grass’, ‘Lemon Peel’, ‘Lemon Myrtle’, ‘Liquorhize’ »600

D5 ‘Rooibos’, ‘Lemon Myrtle’, ‘Lemon Grass’, ‘Lemon Verbena’, ‘Cranberry’, ‘Orange Peel’, ‘Peppermint’, ‘Lemon Peel’

»600

D6 ‘Orange Leaves’, ‘Ginger’, ‘Sweet Bramble Leaves’, ‘Lemon Myrtle’, ‘Natural Orange Oil’ »600, »450, »150

123