molecular evolution sylvia nagl. relationships between dna or amino acid sequence 3d structure...
TRANSCRIPT
•Relationships between
DNA or amino acid
sequence 3D structure protein functions
•Use of this knowledge for prediction of function, molecular modelling, and design (e.g., new therapies)
Sequence-structure-function paradigm
CGCCAGCTGGACGGGCACACCATGAGGCTGCTGACCCTCCTGGGCCTTCTG…
TDQAAFDTNIVTLTRFVMEQGRKARGTGEMTQLLNSLCTAVKAISTAVRKAGIAHLYGIAGSTNVTGDQVKKLDVLSNDLVINVLKSSFATCVLVTEEDKNAIIVEPEKRGKYVVCFDPLDGSSNIDCLVSIGTIFGIYRKNSTDEPSEKDALQPGRNLVAAGYALYGSATML
Evolution as an algorithmic process
Random mutation (genotype) “mutate”
Selection (phenotype) “select”
Differential reproduction “replicate”
The term algorithm denotes a certain kind of formal process consisting of simple steps that are executed repetitively in a defined sequential order and will reliably produce a definite kind
of result whenever the algorithm is run or ‘instantiated.’
‘cumulative’
•Cumulative selection will work on almost anything that can yield similar, but non-identical, copies of itself through some replication process.
•It depends on a medium that stores information and can be passed on to the next generation - DNA or RNA (virus) in terrestrial life forms.
•Most genetic mutations are deleterious - proofreading and error correction mechanisms - negative selection
•Whenever positive selection acts, it can be thought of as selecting DNA with particular phenotypic effects over others with different effects.
•Advantageous mutations may confer a survival and reproductive advantage on individuals who will then, on average, pass on more copies of their genetic material because they will tend to have a larger number of offspring.
•Over many generations, the accumulation of small changes can result in the evolution of DNA sequences with new associated phenotypic effects.
Genes and gene-related sequences
900Mb
Extragenic DNA
2100Mb
Single-copy genes
Multi-gene families
Regulatory sequences
Non-coding tandem repeats
DNA transposons
LTR elements
LINEs
SINEs
Satellite DNA
Minisatellites
Microsatellites
Dispersed
Tandemly repeated
Coding DNA 90Mb
Noncoding DNA
810Mb
Pseudogenes
Gene fragments
Introns, leaders, trailers
Unique and low-copy number
1680Mb
Repetitive DNA 420Mb
Genome-wide
interspersed repeats
Roadmap of the human genome
Multi-gene families: Evolution by gene duplication
•Gene duplication is the most important mechanism for generating new genes and new biochemical processes.
This mechanism has facilitated the evolution of complex organisms:
•In the genomes of eukaryotes, internal duplications of gene segments have occurred frequently. Many complex genes might have evolved from small primordial genes through internal duplication and subsequent modification.
•Vertebrate genomes contain many gene families absent in invertebrates.
•Many gene duplications have occurred in the early evolution of animals (“Biology’s Big Bang”, “Cambrian explosion”, ~570-505 million year ago).
A duplication may involve
•a single gene (complete gene duplication)
•part of a gene (internal or partial gene duplication)
•part of a chromosome (partial polysomy)
•an entire chromosome (aneuploidy or polysomy)
•the whole genome (polyploidy)
Types of duplication events
Unequal sister chromatid exchange at meiosis
Unequal crossing-over at meiosis
Gene duplication: Mechanisms
Transposition via an RNA intermediate
RNA cDNAtranscription reverse
transcription
reintegration
DNA transposons
transposon replication
Gene duplication: Mechanisms
Homology: Paralogy, orthology and xenology
a
a b
duplication
speciation
species 1 species 2
a b a b
paralogous
orthologous
‘Redundant copy’
Random mutation (genotype) “mutate”
Selection (phenotype) “select”
Differential reproduction “replicate”
Duplication – mutation in ‘redundant copy’ – paralogy - new function
Complete gene duplication
pseudogene (silent)
deleterious
mutations
invariant repeats
“tandem arrays”
increased gene product
Examples:
large quantities of specific rRNAs or tRNAs, histone proteins
amplified esterase gene in Culex mosquito
variant repeats
sequence divergence
HOX/HOM genes
function or regulation may differ
Dayhoff (1978):
at least 50% identity: gene family
>35% identity: homologous (super)family
Evolution of Hox and HOM gene clusters by gene duplication
mouse
Amphioxus
Drosophila
hypothetical
ancestor
gene duplication
Antennapedia Bithorax
•Duplicated gene segments often correspond to functional or structural domains.
A domain is a well-defined region within a protein that either performs a specific function or constitutes a stable structural unit.
•Domain duplication is a form of internal duplication.
This mechanism may
•increase number of active sites
•enable acquisition of a new function by modifying the redundant segment.
Domain duplication increases the functional complexity of genes in evolution.
Internal gene duplication: Domain duplication
Internal repeats in the apolipoprotein genes
The structural and functional module: a 22-mer repeat
In exon 4 of the genes belonging to this family, this 22-mer is repeated 1 to ~15 times.
The presence of many copies lead to the evolution of new functions:
apoE now plays a role in neural regeneration, immunoregulation, growth and differentiation, via interactions with low-density lipoprotein receptors and apoE receptors.
Gene evolution by domain shuffling
1. Internal duplication
Duplication of one or more domains
2. Domain insertion
Structural or functional domains are exchanged between proteins or inserted into a protein
“Mosaic or chimeric proteins”
Examples: Two common domains
Kringle domain from plasminogen protein
EGF-like domain from coagulation factor X
Domain insertion: “Mosaic proteins”
Structural modules:
plasminogen kringle domain
EGF domain
fibronectin finger domain
vit. K-dependent calcium-binding domain (osteocalcin)
tissue plasminogen activator
urokinase
prothrombin
plasminogen
Domain origins:
trypsin-like serine protease
Mosaic proteins
fibronectin
epidermal growth factor (EGF)