University of South FloridaScholar Commons

Graduate Theses and Dissertations Graduate School

9-1-2005

Molecular Subtyping and Antibiotic ResistanceAnalysis of Salmonella SpeciesAparna TatavarthyUniversity of South Florida

Follow this and additional works at: https://scholarcommons.usf.edu/etd

Part of the American Studies Commons

This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion inGraduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contactscholarcommons@usf.edu.

Scholar Commons CitationTatavarthy, Aparna, "Molecular Subtyping and Antibiotic Resistance Analysis of Salmonella Species" (2005). Graduate Theses andDissertations.https://scholarcommons.usf.edu/etd/882

Molecular Subtyping and Antibiotic Resistance Analysis of Salmonella Species

Aparna Tatavarthy

A dissertation submitted in partial fulfillment of the requirements for the degree of

Doctor of Philosophy Department of Biology

College of Arts and Sciences University of South Florida

Co-Major Professor: Daniel Lim, Ph.D. Co-Major Professor: Andrew Cannons, Ph.D.

Valarie Harwood, Ph.D. Mylein Dao, Ph.D.

Date of Approval: September 1, 2005

Keywords: Salmonella, Ribotyping, PFGE, Antibiotic Resistance and Integrons

© Copyright 2005 , Aparna Tatavarthy

Dedication This work is dedicated to my husband Viswanadh Tatavarthy for moral support,

Encouragement and complete cooperation

Acknowledgements This work was supported by U.S. Army Research, Development and Engineering

Command, contract DAAD13-01-C-0043. Would like to thank Frank Reeves of Florida

Department of Health, Dr. Catherine Logue of North Dakota State University and Ravi

Pallipamu of Washington State Department of Health for kindly providing isolates for

this study. Also would like to thank Sonia Etheridge of Florida State Department of

Health, Jacksonville for serotyping the clinical isolate

Table of Contents

List of Tables ..................................................................................................................... iv

List of Figures..................................................................................................................... v

List of Abbreviations ........................................................................................................ vii

Chapter One - Introduction ................................................................................................. 1 The Genus Salmonella................................................................................................................. 1 Salmonella Infection.................................................................................................................... 3 Salmonella in Foodborne Outbreaks ........................................................................................... 4 Food as a Bioterrorism Agent...................................................................................................... 7 Detection of Salmonella .............................................................................................................. 8 Isolation of Salmonella from food............................................................................................. 14 Subtyping of Salmonella Species .............................................................................................. 18

Comparison of Phenotypic and Genotypic Chracterization.................................................................20 Molecular Typing ................................................................................................................................21 Molecular Typing for Epidemiological Investigations ........................................................................25

Pathogenicity Islands in Salmonella.......................................................................................... 27 Antibiotic Resistance in Salmonella.......................................................................................... 31

Plasmids as Antibiotic Resistance Determinants .................................................................................36 Integrons as Antibiotic Resistance Determinants ................................................................................37

Hypothesis ................................................................................................................................. 42 Aims of the Study...................................................................................................................... 45

Chapter Two - Material and Methods............................................................................... 46 Bacterial Isolates ....................................................................................................................... 46 DNA Extraction......................................................................................................................... 52

......................................................................................................52 DNA Extraction by MagNA Pure®

DNA Extraction by Epicenter Kit........................................................................................................53 Real time PCR- Primer and Probe Testing ................................................................................ 53 Detection and Isolation of Salmonella from Artificially Contaminated Food Samples ............ 55 Statistical Analysis .................................................................................................................... 59 Ribotyping ................................................................................................................................. 59

i

Pulsed Field Gel Electrophoresis (PFGE) ................................................................................. 60 PFGE for Non- Typeable Strains.........................................................................................................61

Antibiotic Resistance Testing.................................................................................................... 62 Dendrogram Construction ......................................................................................................... 64 Integron PCR............................................................................................................................. 67 DNA Sequencing....................................................................................................................... 68 Plasmid Extraction..................................................................................................................... 69 Membrane Transfer ................................................................................................................... 70 Hybridization of Southern Blots................................................................................................ 71

Southern Blotting with 1.0 Kb Integron Fragment ..............................................................................74 Dot Blots for Southern Hybridization..................................................................................................75

Chapter Three – Results.................................................................................................... 76 Primer and Probe Testing of Salmonella species by Real Time PCR ....................................... 76 Detection and Isolation of Salmonella species from Artificially Contaminated Food Samples 84

Detection of Salmonella species ..........................................................................................................84 Isolation of Salmonella species............................................................................................................89 Application of Colonies Isolated from Food for Typing and Antibiotic Susceptibility Testing ..........96

............................................................................. 99 ®rDNA Analysis by Automated RiboPrinter

DNA Fingerprinting by Macrorestriction Digestion (PFGE) .................................................. 101 Identification of Unknown Salmonella Serotypes by Molecular Typing ................................ 103 Discrimination of Salmonella Species by Molecular Typing and Antibiotic Susceptibility patterns .................................................................................................................................... 109 Antibiotic Susceptibility Testing ............................................................................................. 117 Resistance Determinants.......................................................................................................... 121

Location of Integrons.........................................................................................................................123 Sequencing of the Integrons ..............................................................................................................125

Association of Salmonella Pathogenicity Island (SPI) Genes and Integrons .......................... 132

Chapter Four - Discussion .............................................................................................. 138

Chapter Five - Significance of the Research .................................................................. 154

Chapter Six - Future Directions ...................................................................................... 156

ii

References....................................................................................................................... 158

Appendix A..................................................................................................................... 192

About the Author ................................................................................................... End Page

iii

List of Tables

Table 1. Salmonella Nomenclature..................................................................................... 2 Table 2. Salmonella Subtyping......................................................................................... 24 Table 3. Salmonella Pathogenicity Islands ....................................................................... 30 Table 4. Antibiotic Resistance Mechanisms..................................................................... 35 Table 5. Isolates Used in the Study................................................................................... 48 Table 6. Primers and Probes for Real Time PCR ............................................................. 54 Table 7. Food Samples for Analysis ................................................................................. 56 Table 8. Integron Primers ................................................................................................. 67 Table 9. Probes for Southern Hybridization ..................................................................... 73 Table 10. Real Time PCR Results .................................................................................... 79 Table 11. Real time PCR Results-Low Spiked................................................................. 85 Table 12. Real time PCR Results-Mixed Spiked.............................................................. 87 Table 13. Isolation of Salmonella from 25 gm of Spiked Food........................................ 94 Table 14. Antibiotic Susceptibility Testing of Salmonella Isolated from Spiked Food ... 98 Table 15. Identification of Unknown Salmonella serotypes by Molecular Typing........ 108 Table 16. Antibiotic Resistance of Clinical Salmonella Isolates.................................... 119 Table 17. Antibiotic Resistance of Environmental Salmonella Isolates......................... 120 Table 18. Sequencing of 1.0 Kb Integron Fragments ..................................................... 127 Table 19. Sequencing of 1.2 Kb, 1.6 Kb Integron Fragments ........................................ 128

iv

List of Figures

Figure 1. Integron Structure.............................................................................................. 38 Figure 2. Isolation and Detection of Salmonella .............................................................. 58 Figure 3. Molecular Weight Standard Analysis................................................................ 65 Figure 4. Dot Blots............................................................................................................ 75 Figure 5. Real Time PCR.................................................................................................. 76 Figure 6. Real time PCR Results-Low Spiked.................................................................. 86 Figure 7. Real time PCR Results-Mixed Spiked .............................................................. 88 Figure 8. Isolation of Salmonella on Selective Plates....................................................... 90 Figure 9. Isolation of Salmonella from 25 gm of Spiked Food ........................................ 95 Figure 10. Molecular Typing on Salmonella Isolated from Food .................................... 96 Figure 11. Ribotyping of Salmonella.............................................................................. 100 Figure 12. PFGE of Salmonella with XbaI ..................................................................... 102 Figure 13. Identification of Unknown Salmonella by Molecular Typing ...................... 105 Figure 14. Ribotyping of S. Newport.............................................................................. 112 Figure 15. PFGE of S. Newport...................................................................................... 114 Figure 16. Antibiotyping of S. Newport ......................................................................... 116 Figure 17. Integrons in Multidrug Resistant Isolates...................................................... 122 Figure 18. Plasmid Profiling of Integron Positive Isolates ............................................. 123 Figure 19. Detection of Integrons in Plasmids................................................................ 125 Figure 20. Alignment of 1.0 Kb of Integrons of S. Typhimurium ................................. 130 Figure 21. Alignment of 1.0 Integrons of S. Typhimurium and Other Serotypes .......... 131

v

Figure 22. PFGE Gel of Integron Positive Isolates......................................................... 133 Figure 23. Southern Hybridization with sitB Probe........................................................ 134 Figure 24. Southern Hybridization with magA Probe..................................................... 135 Figure 25. Southern Hybridization with 1 Kb Integron Probe........................................ 137

vi

List of Abbreviations

1. ANAA- Advanced Nucleic Acid Analyzer 2. ATCC- American Type Culture Collection 3. ACSuST- ampicillin, chloramphenicol, sulfomethoxizole, streptomycin and

tetracycline 4. Aug- Amoxicillin/Clavulanic Acid 5. A/S- Ampicillin/Sublactum 6. Ami-Amikacin 7. Amp- Ampicillin 8. Azt- Aztreonam 9. aad- aminoglycoside adenyl transferase 10. Axo- Ceftriaxone 11. BT- Bioterrorism 12. BPW- Buffered Peptone Water 13. BAM- Bacterial Analytical Manual 14. BLAST- Basic Local Alignment Search Tool 15. BHC- Black Hole Quencher 16. CBD- Center for Biological Defense 17. CDC- Centers for Disease Control and Prevention 18. CFU- Colony Forming Units 19. CT- Cholera Toxin 20. cAMP-Cyclic Adenosine Monophosphate 21. CS- Conserved Sequence 22. CT -Cycle Threshold 23. Cep- Cephalothin 24. Ch- Chloramphenicol 25. Cip- Ciprofloxacin 26. Cot- Trimethoprim/Sulfamethaxazole 27. DR- Direct Repeats 28. DT104- Direct Phage Type 104 29. DIG- Digoxygenin 30. ELISA- Enzyme Linked Immunosorbent Assay 31. ERIC-PCR- Enterobacterial Intergenic Repetitive Consensus PCR 32. FDA- US Food and Drug Administration 33. FRET- Florescent Resonance Energy Transfer 34. FAM- 6- carboxyfluorescein 35. FAFLP- Fluorescent Amplified Fragment Length Polymorphism 36. FLDOH- Florida Department of Health 37. Fox- Cefoxitin 38. Fep- Cefepime 39. Fop- Cefoperazone 40. Fot- Cefotaxime 41. Fis- Sulfizoxazole

vii

42. G- Gentamicin 43. HPC- Heterotrophic Plate Count 44. IMS- Immunomagnetic Separation 45. I-Intermediately Resistant 46. IS- Insertion Sequence 47. Imi- Imipenem 48. K- Kanamycin 49. Levo- Levofloxacin 50. Lome- Lomefloxacin 51. MLST- Multilocus Sequence Typing 52. MLVA- Multiple Locus Variable Number Tandem Repeat Analysis 53. MDR- MultiDrug Resistant 54. mar-Multiple Antibiotic Resistance 55. MIC- Minimum Inhibitory Concentration 56. NDSU- North Dakota State University 57. NCCLS- National Committee for Clinical Lab Standards 58. NCBI- National Center for Biotechnology Information 59. Nal- Nalidixic Acid 60. ompF- Outer Membrane Porin F 61. PCR- Polymerase Chain Reaction 62. PFGE- Pulsed Field Gel Electrophoresis 63. PS ribotyping-PstI and SphI ribotyping 64. PI-Pathogenicity Island 65. PBS- Phosphate Buffered Saline 66. Pip- Piperacillin 67. P/T- Piperacillin/Tazobactum 68. QAC- Quaternary Ammonium Compounds 69. RV- Rappaport Vassiliadis 70. RAPD- Randomly Amplified Polymorphic DNA 71. REP-PCR- Repetitive Extragenic Pallindromic PCR 72. RFLP- Restriction Fragment Length Polymorphism 73. R-Resistant 74. SI- Super Integrons 75. Str- Streptomycin 76. SAFLP- Single Amplified Fragment Length Polymorphism 77. SPI- Salmonella Pathogenicity Islands 78. sopB- Salmonella outer protein B 79. spv- Salmonella Virulence Plasmid 80. SGI- Salmonella Genomic Island 1 81. SJH- St. Joseph’s Hospital 82. S-Susceptible 83. Smx- Sulfamethoxazole 84. TTSS- Type Three Secretion System 85. TT- Tetrathionate broth

viii

86. TGH-Tampa General Hospital 87. TE-Tris EDTA 88. TSB- Trypticase Soy Broth 89. TSA- Trypticase Soy Agar 90. TIGR- The Institute for Genomic Research 91. Tic- Ticarcillin 92. Tim- Ticarcillin/ Clavulanic Acid 93. Tob- Tobramycin 94. Tio- Ceftiofur 95. Taz- Ceftazidime 96. Tet- Tetracycline 97. UCH- University Community Hospital 98. WADOH- Washington State Department of Health 99. XLD- Xylose-Lysine Desoxycholate

ix

Molecular Subtyping and Antibiotic Resistance Analysis of Salmonella Species

Aparna Tatavarthy

ABSTRACT

The genus Salmonella, comprised of 2400 serotypes, is one of the leading causes of

foodborne illnesses in the US and has been used for the deliberate contamination of food.

A rapid system for detection, isolation, typing and antibiotic susceptibility profiling is

essential for diagnosis and source tracking in natural outbreaks or a bioterrorism event.

Pure culture is essential for molecular typing and antibiotic resistance testing. The

virulence and the resistance mechanisms of Salmonella are rapidly evolving and many

are still unexplained. The first aim of the study was to rapidly detect and isolate

Salmonella from intentionally contaminated food. The second aim was to build a DNA

fingerprinting database for accurate identification of the subtype. The third objective was

to study the antibiotic susceptibility patterns and the underlying mechanisms of

resistance. A correlation between the DNA subtypes and antibiograms was

hypothesized. An association between the resistance determinants and pathogenicity

genes was expected. A total of 114 isolates including environmental and clinical sources

were tested. General and selective enrichments and immunomagnetic separation (IMS)

were tested for rapid detection and isolation of Salmonella from eight food groups.

Isolates were subtyped by pulsed field gel electrophoresis (PFGE) and automated

RiboPrinter®. Resistance to 31 drugs was tested by the Sensititre® system and integrons

were identified by PCR. The association between virulence and resistance was verified

by Southern hybridization. Of the three genes tested, ompF was found to be the most

x

reliable target for identifying Salmonella subspecies I, III and IV. Detection by real time

PCR after enrichment in buffered peptone water and isolation by IMS provided the

fastest results. Sixty two ribotypes and 74 pulsotypes were observed for the 100 isolates

subtyped. Sixty isolates were resistant to one or more antimicrobials and 12 had class-1

integrons. In conclusion, pure culture was achieved in 25 hours by IMS. Ribotyping, a

comparatively rapid technique was found to be ideal for initial identification. PFGE,

which was more discriminatory, was appropriate for source tracking. Contrary to the

original hypothesis, no correlation between subtyping and antibiograms was observed

and no association of integrons with the virulence genes tested was demonstrated

xi

Chapter One - Introduction

The Genus Salmonella

Various agents including bacteria, viruses and parasites cause foodborne diseases.

According to a FoodNet survey about 38.6 million illnesses are caused by known

pathogens every year of which 36% are due to foodborne organisms (141). Bacterial

infections account for approximately thirty percent of the total foodborne illnesses of

which, non- typhoidal Salmonella infections contribute to the highest percent of the

mortality (141).

Salmonella is a Gram negative, rod shaped, motile member of the Enterobacteriaceae.

The genus Salmonella is comprised of over 2400 different serotypes that infect a wide

range of hosts including poultry, cattle, rodents and humans (20). Salmonella is divided

into two species: Salmonella enterica also called Salmonella choleraesuis and Salmonella

bongeri. Salmonella enterica is further divided into five subspecies (I, II, IIIa, IIIb, IV,

VI) (23). The nomenclature of Salmonella is extremely complex and tends to be

confounding because of the lack of uniformity. Kauffmann and White proposed the initial

nomenclature based on the O (somatic) and H (flagellar) antigens (20). Every serotype

was considered as a species according to this system; however, with more than 2400

recognized serotypes this nomenclature system is not feasible. Based on DNA-DNA

hybridization it was observed that all subspecies (I, II, III, IV, VI) were closely related

except for subspecies V (Salmonella bongeri) (23). Salmonella choleraesuis is sometimes

used in the place of Salmonella enterica as the first species but its usage could be

1

confused with the serotype Choleraesuis. For subspecies I, the name of the serotype is

used, for example Salmonella enterica serotype Typhimurium, but for the other

subspecies (isolated after 1966) the antigenic formula is used. Table 1 shows the current

nomenclature of the genus Salmonella and their common habitat.

Table 1. Salmonella Nomenclature

Salmonella species Salmonella Subspecies Habitat enterica (I) Salmonella enterica Warm blooded animals salamae (II) Cold blooded animals,

environment arizonae (IIIa) Cold blooded animals,

environment diarizonae (IIIb) Cold blooded animals,

environment hountenae (IV) Cold blooded animals,

environment indica (VI) Cold blooded animals,

environment bongeri (V) Salmonella bongeri Cold blooded animals,

environment The current nomenclature of Salmonella followed by the Centers for Disease Control and

Prevention (CDC) (23)

Ninety-nine percent of clinically significant serotypes belong to subspecies I (Salmonella

enterica subspecies enterica). According to a Centers for Disease Control and Prevention

(CDC) survey the most frequently reported serotypes in the year 2002, all belonging to

subspecies I, were Salmonella enterica serotype Enteritidis (S. Enteritidis), S.

Typhimurium, Salmonella enterica serotype Javiana (S. Javiana) and Salmonella enterica

serotype Newport (S. Newport)

2

(http://www.cdc.gov/ncidod/dbmd/phlisdata/salmtab/2002/SalmonellaAnnualSummary2002.pdf). Two of

these serotypes, S. Typhimurium and S. Enteritidis are the most well studied serotypes of

the subspecies Salmonella enterica. Salmonella enterica serotype Typhi (S. Typhi) is

very host specific and infects only humans. S. Typhimurium infection in a mouse model

is assumed to be very similar to S. Typhi infection in humans (186). Although, other

studies have shown that the mechanism of infection of S. Typhi in humans and S.

Typhimurium in mice are slightly different (204).

Salmonella Infection

Salmonella species cause a variety of illnesses including nausea, vomiting, abdominal

cramps and diarrhea. The infective dose of Salmonella is usually about 1000 colony

forming units (CFU) (http://textbookofbacteriology.net/Salmonella.html) but it depends on

various factors including the serotype and the pH of the stomach. If the pH of the

stomach is high a low dose is sufficient to cause infection (74). A high stomach pH can

also accelerate Salmonella invasion and allow the organism to spread into the circulatory

system, liver and gall bladder causing further complications. After the initial invasion of

the epithelial cells, the bacteria are engulfed by the host phagocytes where they replicate

(188). Intracellular replication is important for the virulence of S. Typhimurium in a

mouse model according to Leung and Finley (111). It was observed in that study that

replication defective mutants did not kill the mice even after 21 days whereas the control

strains killed the mice in five days. The primary infection site of Salmonella is the distal

ileum (30). The invasion and replication strategies of Salmonella depend upon the

3

serotype and the nature of the host. For example the invasion of S. Typhimurium in swine

is rapid and is non-cell specific. The organism preferentially adheres to sites of epithelial

cell extrusion (144). Many serotypes of Salmonella produce two kinds of toxins

cytotoxin and enterotoxin apart from the endotoxin(196). The enterotoxin produced by

Salmonella has a similar action to the cholera toxin (CT). The Salmonella toxin (Stn)

elevates the levels of cyclic adenosine monophosphate (cAMP) like CT, however

structurally the two toxins are different (41). Stn is homologous to the toxins produced by

Pseudomonas aeruginosa and Corynebacterium diptheriae (41).

Salmonella in Foodborne Outbreaks

Salmonella is one of the ancient pathogens and it still continues to confound scientists. In

the early twentieth century Salmonella was the only known foodborne pathogen and was

thought to cause 90% of the gastroenteritis cases (88). In the past 20 years however,

scientists began to recognize other bacteria including E. coli O157:H7, Listeria

monocytogenes and Campylobacter species and viruses as potential foodborne agents

(190). S. Typhi infections were controlled in the beginning of the twentieth century by

disinfection of drinking water, sewage treatment and pasteurization of milk; however,

infections caused by non-typhoidal serotypes of Salmonella began to increase. Eggs were

implicated in several S. Enteritidis outbreaks in the 1980s. From 1985 –1999, 80% of S.

Enteritidis infections were due to eggs (162). Surveillance of Salmonella in eggs and

improved food handling practices led to the eventual decline in the foodborne disease

caused by S. Enteritidis. However, increased consumption of fresh produce in the 1990s

4

compared to the 1970s led to the increased incidence of foodborne illnesses (15). Fresh

produce could be contaminated at the stage of pre-harvesting due to various factors

including infected irrigation water, soil or manure. Post-harvest contamination could be

due to human handling, improper storage and packaging. Identifying the exact source of

the pathogen in a foodborne outbreak is an extremely complex task because various

ingredients of the food can be from several different sources and sometimes even

different countries (190).

Salmonella has been implicated in several foodborne outbreaks in the US. One of the

biggest outbreaks that caught the attention of the food regulatory agencies was the S.

Typhimurium outbreak in Chicago, IL in 1985. This involved the contamination of

pasteurized milk that led to 23,000 confirmed cases of S. Typhimurium. Several of the

patients who were infected in this outbreak have since developed long term arthritis (61).

Since then, Salmonella species have caused a number of outbreaks involving a variety of

foods. In 1995, a S. Newport outbreak transmitted by contaminated alfalfa sprouts

affected over 100 persons in six different states in the US (197). Another outbreak of

Salmonella enterica serotype Mbandaka leading to 89 confirmed salmonellosis cases was

linked to alfalfa sprouts in Oregon in 1999 (80). The epidemiological investigations

traced the pathogen to two sprout growers that did not follow the U.S. Food and Drug

Administration’s (FDA) seed disinfection guidelines. Commercially packaged egg salad

was implicated in a S. Typhimurium outbreak that led to 18 illnesses in Oregon and

Washington states in 2003 (35). A multistate outbreak of S. Typhimurium in

5

unpasteurized milk affected four states and 62 people in 2002 (32). Roma tomatoes were

associated in a more recent outbreak affecting over 400 persons in two countries and 11

states in the US and Canada in 2004 (33). In this outbreak over five serotypes were

implicated including Salmonella enterica serotype Muenchen, S. Javiana, S.

Typhimurium, Salmonella enterica serotype Anatum and Salmonella enterica serotype

Thompson. Two of the five serotypes were traced to a supplier in Florida.

Foodborne outbreaks due to Salmonella are common in other parts of the world. An

international outbreak of Salmonella enterica serotype Oranienburg affecting Germany,

Sweden and Canada caused several hospitalizations due to bloody diarrhea in 2001 (205).

The organism in this outbreak was traced to chocolates but no source was identified. Egg

fried rice was implicated in the outbreak of S. Enteritidis infecting 31 persons in 2002

who dined at a Chinese restaurant in the U.K. (10). S. Enteritidis infection causing

gastroenteritis and hospitalizations in Taiwan in 2001 was traced to a bakery product

made with eggs (126).

Although there is a decline in the overall frequency of Salmonella infections since 1970s,

all the above mentioned outbreaks suggest that certain food groups including fresh fruits,

vegetables and ready to eat foods seem to be potential targets for Salmonella

contamination. The increasing dependency of consumers on commercially prepared food

could be one of the reasons for the rise in Salmonella infections in the recent past.

Availability and increased consumption of fresh fruits and vegetables could also be the

6

cause for the rise in the foodborne illnesses in fresh produce in the recent past. Lack of

education about hygiene and food imported from countries where the regulation is not

very stringent (e.g., Mexico, Guatemala) could also be the contributing factors.

Food as a Bioterrorism Agent

The deliberate use of microorganisms or toxins from living organisms to cause death or

disease of humans, animals and plants is known as bioterrorism (BT)

(www.sciencecoalition.org/glossary/glossary_main.htm). According to the CDC, a BT event can

be distinguished from natural outbreaks by the sudden or unusual increase in the illnesses

including two or more unrelated cases with unusual age distribution (34). The pathogen

has to meet certain criteria for it to be used as a BT agent. First of all, it needs to produce

temperature stable products that could be dispersed over a large area. Secondly, it should

allow aerosolization and production on a large scale. It should be difficult to diagnose

and be transmitted from person to person to rapidly spread the disease. It should allow the

terrorist to escape the scene by having a high incubation period. It should create panic

and overwhelm the public health system (176). A number of pathogens fit one or more of

the above descriptions and could be potentially used as BT agents. For example, the

lethal dose of Bacillus anthracis spores is one millionth of a gram. Bacillus anthracis

spores can be dispersed over a large area and affect thousands of people. The other

organisms that are likely candidates are Francisella tularensis, a Brucella species that is

common in contaminated dairy products, Variola major that causes smallpox and is

7

highly contagious and Clostridium botulinum that releases botulinum toxin that can kill a

person by contact or ingestion.

Though not conventional BT agents, foodborne pathogens that belong to category B

agents, could be used in a small scale BT event to overwhelm the public health system. In

fact, S. Typhimurium and Shigella dysenteriae have been used for the intentional

contamination of food in the past (103, 193). S. Typhimurium was used in the intentional

contamination of salad bars in Dalles, Oregon, by a religious cult group in 1985 to

influence elections (193). This incident led to 751 cases of gastroenteritis and the fact that

it was a BT event was not obvious at the time of the event. A similar case of intentional

contamination of pastries and donuts by Shigella dysenteriae affected 12 laboratory

workers who developed diarrheal disease (103). The use of enteric bacteria for the

purpose of bioterrorism may not be discovered immediately as it is difficult to distinguish

intentional contamination with the many natural outbreaks that occur each year around

the world. Therefore, a rapid detection and characterization system for identification and

source tracking of the organism is crucial to control both natural and deliberate outbreaks.

Detection of Salmonella

The conventional methods of identification of Salmonella including the one used by the

FDA are time consuming and labor intensive. According to the Bacterial Analytical

Manual (BAM) used routinely by FDA to test foods suspected to be contaminated with

Salmonella, the food sample is first enriched in general enrichment media for 24 hours

8

(http://www.cfsan.fda.gov/~ebam/bam-5.html). The enriched sample is then selectively enriched

for 24 hours and then inoculated in selective and differential agar media for

identification. Suspected Salmonella colonies are then further tested with biochemical

and serological methods for final identification. This identification process takes about 3-

5 days. Although the conventional identification and characterization process is still the

gold standard, most laboratories are adapting molecular techniques for rapid

identification and characterization. Several techniques including polymerase chain

reaction (PCR) and immunoassays are currently complementing the conventional

methods for rapid identification of Salmonella in food or in clinical samples.

The advantages of using DNA based assays for detection of a pathogen are many.

Nucleic acid assays can provide information about the virulence of the pathogen as well

its relatedness to other organisms. They offer information about the genome of the

organisms and are very useful for epidemiological investigations (13). Many studies have

shown that Salmonella species can be identified rapidly using conventional PCR. PCR

was used to detect S. Enteritidis and S. Typhimurium in chicken meat samples spiked

with 10 –7 CFU/ml after 24 hour enrichment in chicken meat using invA primers (62).

Multiplex PCR with invA gene and slt gene primers was used for detecting 10 to 102

CFU/ml of Salmonella in a mixture of Salmonella and E. coli after 9 hour pre-enrichment

(38). Another study involved a very sensitive assay for detection of S. Typhimurium in

artificially inoculated poultry samples, milk and fresh vegetables. In that study, using the

hin/H2 primers 3 CFU/gm of food were successfully detected (1). PCR was shown to be

9

more sensitive compared to conventional culture techniques in a study where Salmonella

was found in 19% of naturally contaminated poultry sample when tested by PCR, while

only 16% of the samples, were positive when tested by culture techniques (207). A

combination of the two techniques provided better results demonstrating 23% of the

samples to be positive.

Currently, conventional PCR is being replaced by real time PCR for identification of a

pathogen. The real time PCR technique takes advantage of the 5’ nuclease activity of the

taq polymerase to generate a positive signal (91). Typically, a probe that is

complementary to the target DNA and anneals to it is designed. During the PCR reaction

as the primers extend, the 5’ nuclease activity of the taq polymerase cleaves the probe,

which produces a fluorescent signal detected by the computer. This automated version of

the real time PCR has many advantages over traditional PCR technique. The new and

improved version eliminates the post PCR gel processing so that the data can be

monitored in real time (98). The rapid heating and cooling system ensures that there is

quick temperature alteration and the closed system eliminates the possible amplicon

contamination. Three kinds of probes have been developed for the real time PCR system:

TaqMan probes, florescent resonance energy transfer (FRET) probes and molecular

beacons (183). The TaqMan probe has a reporter dye at the 5’ end and a quencher dye at

the 3’ end. The quencher dye suppresses the reporter dye from fluorescing when in close

proximity. When the primer extends, the taq polymerase cleaves the probe separating the

reporter from the quencher to give a detectable signal. If the target DNA is absent the

10

probe cannot bind to the DNA and therefore the reporter and the quencher dyes are in

close proximity giving no signal.

There are numerous applications of real time PCR in patient diagnosis and environmental

sampling. It can be used for detection of virulence genes including E. coli and Vibrio

cholerae (55, 75) and antibiotic resistance genes (116). This technique can be used for

quantification of genes, for example the viral load of an immunocompromised individual

can be tested. It can be applied to trace bioterrorism and also check food and water safety

(98). It can be applied for the detection of spores (129). The efficiency, specificity and

speed of real time PCR has made it popular for clinical and environmental sample testing.

A number of studies have demonstrated the worth of real time PCR for rapid bacterial

detection. Belgrader et al. detected Erwinia herbicola (a surrogate for Yersinia pestis)

using the portable system advanced nucleic acid analyzer (ANAA) (13). In that study,

DNA from 500 cells were detected in seven minutes, fifty in 8 minutes and five cells

were detected in 9 minutes. The molecular beacon probe technology was used to detect

two CFU of S. Typhimurium from pure culture DNA using the himA gene as a target

(40).

Several groups have detected Salmonella species from naturally and artificially

contaminated food samples using various genes as targets. Knutsson et al. reported that

pre-enriching the sample before DNA extraction increases the sensitivity (102). Ten ml

of sterile buffered peptone water (BPW) was inoculated with 1 CFU of S. Enteritidis and

11

incubated for 36 hours in their study. Samples were taken for DNA extraction every 4

hours and tested using primers against the invA gene. An eight hour enrichment was

enough to detect one CFU of S. Enteritidis in clean broth in that study. The efficiency of

real time PCR was demonstrated in detecting several Salmonella serotypes in naturally

and artificially contaminated poultry samples enriched in tetrathionate (TT) broth for 18

hours at 37 °C (70). Artificially contaminated Salmonella-free chicken samples with S.

Enteritidis were enriched and tested after 18 hours with invA specific primers in that

study. Salmonella positive flocks were successfully identified in 30 minutes after 18 hour

enrichment compared to two days using conventional culture techniques. For the

artificially contaminated samples the detection limit was six CFU/ml. By using real time

PCR with invA gene as a target, the source of a gastroenteritis outbreak in Texas was

identified to be barbequed chicken (54). invA was used as target, in another study for the

detection of 50 strains of Salmonella belonging to Salmonella subspecies I, II, III, IV and

Salmonella bongeri (177). A study tested the utility of four DNA extraction kits for

detection of S. Enteritidis by real time PCR using sefA primers (58). The detection limit

was in the range of 108 to 103 CFU in that study for artificially contaminated poultry

samples after 24 hours of pre-enrichment at 37 °C. Heller et al. compared four

commercial kits for the detection of E. coli in artificially contaminated samples and

concluded that the ABI PrepMan Ultra was the easiest to use and very efficient compared

to others (90). The application of real time PCR was tested on fresh fruits and vegetables

that were intentionally contaminated with 4 CFU/gm using molecular beacon probes

(122). Positive results were obtained by using real time PCR in one day after 20-hour

12

enrichment compared to three to four days using the BAM methodology in that study. A

very sensitive assay targeting the sipB and sipC genes was developed for the detection of

one CFU/ml of Salmonella enterica serotype Abaetatuba in artificially spiked ready to eat

meats after six hours of enrichment (67). In another study, the tetrathionate respiratory

gene (ttRA) was targeted, and a detection limit of 103 CFU/ml with 70% probability and

105 CFU/ml with 100% confidence, was achieved in artificially inoculated chicken, fish

and meat samples (133). The technique was sensitive and could detect as low as three

CFU/ml after 20 hour enrichment. The application of real time PCR in clinical samples

was tested in artificially inoculated stool samples with food or waterborne pathogens

including S. Enteritidis, Campylobacter jejuni and Vibrio cholerae (77). They could

detect 105 CFU/gm of stool in two hours, the sensitivity was higher with an sample

overnight enrichment. All the studies suggest that real time PCR is a very powerful

technique that is easy to use compared to the conventional techniques and can be used for

testing food samples as well as clinical samples. However, there are several drawbacks of

PCR. PCR requires pure sample that is free of any inhibitors. It is a good tool that allows

molecular identification, however, needs technical expertise and can be expensive.

Unlike conventional methods, PCR cannot differentiate between live and dead organisms.

Most of the studies have demonstrated that it is possible to detect Salmonella from

artificially contaminated food samples with longer pre-enrichment or with high

inoculums. There are not many reports of a sensitive and rapid real time PCR assay that

can detect very low CFU (1-10) of Salmonella species from 25 gm of food samples

particularly with mixed backgrounds.

13

Isolation of Salmonella from food

Numerous techniques have been developed for the rapid detection of Salmonella species

in food including biosensors, real time PCR and microarrays (99, 159, 187). However,

studies on the rapid isolation of Salmonella species from mixed cultures are limited.

Isolation of pure cultures of Salmonella from mixed samples or from food is equally

important for further characterization including serotyping, biochemical analysis and

DNA based typing. Detection is important for identification of the pathogen and

diagnosis, whereas subtyping by serotyping or DNA fingerprinting is essential for

tracking down the source of the contamination in an outbreak. Source tracking is

especially relevant if the outbreak is food associated so that the corresponding food can

be recalled to prevent further illnesses. Though the FDA BAM protocol is extremely

sensitive and detects one CFU of Salmonella species per 25 gm of food, it is time

consuming and labor intensive. Therefore there is a need for studies involving

development of techniques to accelerate the isolation of Salmonella from food.

A number of studies have attempted to isolate Salmonella rapidly from food using

immunomagnetic separation (IMS) or shorter selective enrichment compared to

conventional techniques. Isolation of pure organism from food is a complicated process

because it not only contains components including fats, starches etc. but also could

contain a considerable amount of resident flora and preservatives (49). The IMS

technique has been relatively successful in limiting the time required for achieving pure

14

culture because it physically separates the specific bacteria targted by the assay from a

complex matrix (49). IMS is based on the use of species-specific antibody coated beads

to separate the organism of interest from a complex mixture of organisms. This technique

was first applied by Luk and Lindberg to detect Salmonella enterica serogroup C by

using a mouse monoclonal antibody (mAb) against Salmonella (128). The antibodies

used in that study were specific for the O antigen of serogoup C. Polysterene beads were

precoated with the Salmonella IgG (sheep antimouse immunoglobins) antibodies. These

beads were then coated with mAb. A detection limit of 4 CFU/ml of blood or TT broth

was achieved using this technique in the study. The beads were found to be specific to

Salmonella when tested against other bacteria including Pseudomonas species,

Staphylococcus species and Streptococcus species. In a study involving intentionally

contaminated meat and milk samples, a detection limit of 20 CFU/gm of E. coli O157:H7

was achieved after 24 hour incubation using IMS (210). The advantage of IMS over

conventional enrichment techniques in terms of recovery was demonstrated in a study

with naturally contaminated samples using the anti-Salmonella Dynabeads (49). In that

study, swab samples were enriched in BPW for 16-20 hours before employing IMS and

plated on selective agar plates. They demonstrated that IMS could identify more

Salmonella positive samples compared to the conventional selective enrichment with

selenite cystine broth or rappaport vassiliadis (RV) medium. Application of IMS for the

rapid detection of Salmonella in combination with enzyme linked immunosorbent assay

(ELISA) in food samples was demonstrated in a study where the sensitivity was 107

CFU/ml in artificially contaminated egg and chicken samples after 20 hour BPW

15

enrichment (47). Another study based on spiked food samples as well as naturally

contaminated samples compared six different methods, including IMS, conventional and

ELISA based techniques for isolation of Salmonella (84) . The specificity of beads was

studied by spiking Citrobacter species and Proteus species that resemble Salmonella on

selective agar plating. They were able to isolate 103 CFU in 30 hours using IMS and

found it to be most rapid compared to other techniques however, it was non-specific. To

improve the specificity of the protocol, the IMS method was modified in a later study by

adding a post-IMS enrichment step in RV soy peptone broth for isolation of bacteria in

artificially contaminated food samples (48). Although the process was lengthy (48 hours

to obtain pure culture) and the sensitivity (100-1000 CFU/25 gram) lower, compared to

the conventional methods, the non-specificity issue was eliminated. A very large study

involved the testing of environmental samples from animal feeds, cheese samples, egg

products and environmental swabs from food manufacturing plants (182). The samples

were incubated in pre-enrichment broth for 16 hours, were selectively enriched in TT

broth or RV medium and were purified by IMS. They found a good correlation between

the standard culture techniques and IMS; the latter was 24h faster. In another study,

artificially inoculated liquid eggs were tested for S. Enteritidis after 24 hour pre-

enrichment using various techniques including TT broth, RV broth, and IMS enrichment

(87). BPW followed by TT broth enrichment was the best technique in terms of

identifying the highest percentage of S. Enteritidis positive samples (97% to 100%) in

that study.

16

IMS has been used by a number of groups to concentrate samples in preparation for

detection of Salmonella species by PCR or bacteriophage assays (72, 93, 95, 175). IMS

also aids in the removal of food debris and concentrating the target bacteria to perform

molecular analysis by PCR (95). An automated version of the IMS process known as the

automated immunomagnetic separation (AIMS) exists. Lynch et al. tested AIMS for

detection of S. Typhimurium in artificially contaminated poultry samples (130). It was

shown to have a higher sensitivity for isolation and was more rapid in identifying

Salmonella species when compared to conventional culture techniques.

These studies suggest that IMS with anti-Salmonella antibody beads is rapid and specific

for isolation of certain Salmonella species from food samples. Furthermore, it is apparent

that a longer pre-enrichment before IMS improves the sensitivity of the assay. Some

studies suggested that a post-IMS enrichment yielded better results for isolation of

Salmonella compared to direct plating after IMS (48). However, the development of rapid

detection and isolation protocol for Salmonella diagnosis and source tracking is still

needed. The sensitivity of the assay needs to be improved so that less than 100 CFU/25

gm of foods can be detected and isolated using shorter enrichments compared to the

conventional techniques. The specificity of the assay needs to be tested on samples

containing mixed backgrounds.

17

Subtyping of Salmonella Species

Salmonella subtyping is required for source tracking for epidemiological investigations of

outbreaks and for general surveillance of the pathogen in the environment. Subtyping is

also essential to distinguish outbreak strains from existing endemic strains, therefore a

good subtyping technique should be very discriminatory. Salmonella can be typed based

on phenotypic or genotypic methods. The common phenotypic techniques used for typing

Salmonella are biochemical characterization (biotyping), serotyping, antibiotic

susceptibility profiling and phage typing. Biochemical profiling involves reaction of the

organism to a series of biochemical tests including hydrogen sulfide production, glucose

and lactose fermentation, and lysine decarboxylation. Serotyping of Salmonella is based

on somatic (O), flagellar (H) and capsular (Vi) antigens (20). Phage typing relies on the

ability of bacteriophages to lyse Salmonella and their host specificity to certain serotypes

(31). Although routinely used for typing Salmonella, phenotypic typing methods are time

consuming and extremely labor intensive. Therefore, genotyping methods that are more

rapid and specific offer an attractive alternative to phenotypic methods, including plasmid

profiling, ribotyping, pulsed field gel electrophoresis (PFGE), randomly amplified

polymorphic DNA (RAPD), multilocus sequence typing (MLST), repetitive extragenic

pallindromic PCR (REP-PCR) and multiple locus variable number tandem repeat analysis

(MLVA) (71, 104, 123, 147, 168, 174, 203). Plasmid profiling is based on the presence or

absence of plasmids in an organism and their restriction digestion pattern. The

disadvantage of plasmid profiling is that several Salmonella strains may lack plasmids

therefore this technique does not provide good discrimination (148). Therefore subtyping

18

based on chromosomal DNA is a better option. Ribotyping is based on the ribosomal

operons that are conserved among bacteria. It relies on the principle of Southern

hybridization where the probe recognizes some combination of 16S, 23S and 5S

ribosomal operons. The ribosomal genes show high homology in various bacteria, which

allows hybridization. However, the regions flanking the genes are heterogeneous, which

is the basis for fingerprinting (16).

PFGE is based on restriction digestion of the whole bacterial genome. Since the

fragments obtained by the macrorestriction digestion of DNA can be up to several

megabases (Mb), specialized electrophoresis equipment is needed that can resolve large

DNA fragments. In this technique an electric field is alternately applied in several

directions. Longer pulses of current are applied in the forward direction and short pulses

are used in the reverse and sideways direction to resolve the large DNA fragments and to

accommodate relatively smaller DNA (202).

Various new techniques have been recently developed to subtype Salmonella. MLST is a

relatively recent technique that is based on sequencing of genes of housekeeping,

ribosomal or virulence traits (104). MLVA compares the number of tandem repeats

between isolates (168). A number of PCR techniques including RAPD (123), REP-PCR

(203) and enterobacterial intergenic repetitive consensus (ERIC) PCR have been applied

to fingerprint Salmonella species (27). The issue of non-typeability that is associated with

phenotyping is usually eliminated when dealing with chromosomal DNA based typing.

19

Many groups have compared molecular typing methods with phenotypic typing

techniques for subtyping Salmonella species. Before the molecular era, phage typing was

the method of choice for further subtyping Salmonella serotypes. Phage typing was used

to identify Salmonella and other members of Enterobacteriaceae (89). Phage typing was

more discriminatory compared to serotyping and was determined to be a good tool for

epidemiological investigations in a study of isolates from contaminated food, human

clinical samples and naturally contaminated waters (31). However, molecular techniques

including ribotyping and PFGE have a better discriminatory power (71, 147).

Comparison of Phenotypic and Genotypic Chracterization As mentioned before there are various ways to characterize Salmonella based on

phenotypic methods including serotyping, biotyping, phage typing and antibiotic

susceptibility testing. A number of studies have compared the phenotypic subtyping to

molecular methods (73, 120, 173). One hundred twenty environmental isolates belonging

to three serotypes were characterized by ribotyping (69). It was shown in that study that

ribotyping that produced 12 types was clearly more discriminatory than serotyping. In

another study, 56 S. Typhimurium isolates were subtyped by biotyping, antibiotic

susceptibility profiling, plasmid profiling and ribotyping (148). Ribotyping and plasmid

profiling that generated nine and eight types and were more discriminatory than biotyping

that produced only four types. In a Brazilian study of 105 S. Enteritidis isolates from

clinical and environmental sources, ribotyping was shown to be more discriminatory (14

20

profiles) compared to phage typing (2 types) (73). Ribotyping that generated 22 types

was demonstrated to be more discriminatory compared to phage typing that generated 10

types in characterizing 104 poultry S. Enteritidis isolates (118). The discriminatory

ability of molecular typing by insertion sequence 200 (IS 200) typing (11 types) was

evident in a study that also characterized 99 S. Typhimurium isolates also by phage

typing (4 types) (96). In a study of 199 S. Typhimurium isolates, four phage types were

divided into 34 ribotypes and 23 pulsotypes (120). Molecular typing methods including

PFGE, ribotyping, amplified fragment length polymorphism (AFLP) were more

discriminatory compared to antibiotyping in characterizing ten outbreak isolates of S.

Havana (173).

Molecular Typing As previously mentioned molecular typing methods including ribotyping and PFGE are

good tools for the discrimination of closely related Salmonella strains. Ribotyping

generated more profiles in comparison to phage typing in a study of S. Enteritidis isolates

from human clinical, food and water samples (107). Six different enzymes including

EcoRI, HindIII, SmaI, Sau3AI, HaeIII and XhoI were compared in a study to ribotype

three Salmonella serotypes: S. Typhimurium, S. Reading and Salmonella enterica

serotype Seftenburg from a variety of sources. EcoRI generated the most clear and

distinctive patterns (69). Ribotyping with SphI was found to be more discriminatory than

PFGE in typing S. Enteritidis strains isolated from clinical and poultry sources (191).

Ribotyping with two enzymes used together, for example PstI and SphI ribotyping (PS

ribotyping) was demonstrated to be more discriminatory compared to phage typing,

21

PFGE and plasmid profiling for characterization of S. Enteritidis and S. Typhimurium in

several other studies (118-120, 147). Since ribotyping using EcoRI is less discriminatory

compared to PS ribotyping, it is suggested that EcoRI be used for serovar level of

identification and PS ribotyping for further discrimination (56). Ribotyping using the

automated version was the preferred method compared to PFGE in terms of

discrimination, speed and increased standardization in a study that involved typing of a

number of organisms including E. coli, Hafnia, Proteus and Staphylococcus aureus (92),

whereas PFGE was demonstrated to be more discriminatory compared to ribotyping,

phage typing and biotyping in typing S. Typhimurium, S. Enteritidis and S. Thompson in

another study (153). The discriminatory ability of PFGE compared to plasmid profiling

and ribotyping was also shown in another study of S. Enteritidis isolates (174). The

discriminatory power of PFGE was demonstrated to be better compared to several other

techniques including ribotyping, phage typing, fluorescent amplified fragment length

polymorphism (FAFLP), insertion sequence typing and MLST in typing Salmonella

serotypes by a number of groups (71, 81, 120, 121, 160, 189).

Although PFGE is considered the gold standard for typing Salmonella, several studies

have shown that other techniques including plasmid profiling, RAPD, MLST, MLVA

further resolved PFGE groups (36, 104, 108, 123, 125, 178). Application of PFGE to

differentiate drug resistant Salmonella isolates from the sensitive ones was demonstrated

in several studies (76, 184, 213). The ability of PFGE technique to separate S.

22

Typhimurium direct phage type 104 (DT104) from the non DT104 isolates was also

demonstrated in another study (66).

Based on the above studies it is clear that molecular typing techniques that are based on

chromosomal DNA analysis have an advantage over phenotypic typing methods for

subtyping Salmonella species. Molecular techniques could successfully type almost all

serotypes of Salmonella studied so far. For certain serotypes including S. Enteritidis it

appears that ribotyping provides better discrimination than PFGE (118, 148, 191).

However, for most serotypes including S. Typhimurium, S. Derby and S. Dublin, PFGE

was more discriminatory compared to ribotyping (120, 121, 189). Based on the above

observations it is clear that the discriminatory ability of a technique relies upon the nature

of the genome of the Salmonella serotype. Therefore, an ideal typing system should

include more than one technique. A comparison of the common techniques used for

typing Salmonella is summarized in Table 2.

23

Table 2. Salmonella Subtyping

Typing Technique Principle Advantages Disadvantages Biotyping Biochemical

reactions Standard identification in laboratories

Time consuming, laborious, expensive

Serotyping Serological reactions against Somatic (O) and Flagellar antigens (H)

Well known typing system for Salmonella species

Not discriminatory for epidemiological analysis

Not all Salmonella species are typeable using this method

Phage typing Ability of bacteriophages to lyse specific Salmonella types

More discriminatory compared to serotyping

Plasmid Profiling Presence or absence of plasmids

Discriminatory when comparing two isolates with presence of plasmids

Chances of loosing the plasmid with the lack of selective pressure are very high. Not all Salmonella species are typeable using this method

Ribotyping Hybridization to rRNA operons

Conserved among species allowing species identification, very rapid with automated system

Not discriminatory for all Salmonella serotypes, expensive

PFGE Macro restriction profiling of the entire genome

Gold standard for typing Salmonella, Pulsenet database established for comparison between health laboratories in the US and other countries

Laborious, not discriminatory for S. Enteritidis, expensive

MLST Typing based on sequence analysis of housekeeping genes

Analyses conserved areas of the genome, shown to be more discriminatory than PFGE in some

Time consuming, no standardized protocol for Salmonella

24

Typing Technique Principle Advantages Disadvantages studies

MLVA Typing based on sequencing of tandem repeats in the genome

Shown to be more discriminatory than PFGE

Still in the preliminary stages, needs validation and standardization

Common techniques to subtype Salmonella and their advantages and disadvantages.

PFGE- pulsed field gel electrophoresis, MLST- multi locus sequence typing, MLVA-

multiple locus variable number tandem repeat analysis

Molecular Typing for Epidemiological Investigations

Subtyping with either phenotyping or genotyping could provide very valuable

information regarding the epidemiology of the pathogen. This information assists in

tracking down the source of the contamination and make needed changes and prevent

further spread of the epidemic clone. A number of studies have shown the efficacy of

molecular typing data for source tracking and general surveillance of Salmonella species.

In a lengthy study of over six years, S. Enteritidis isolates collected from patients,

chicken meat and chicken feces were characterized by phage typing and PFGE analysis

and the outbreak strain was traced to chicken meat (19). In a similar study, an identical

clone of Salmonella enterica serotype Indiana was identified in human patients, poultry

meat and pet food by PFGE typing (165). A common link of S. Typhimurium infections

was established between two children’s centers based on the ribotyping, PFGE and

RAPD data (145). Clones of S. Newport were observed in humans and food animals in a

study that characterized isolates by PFGE (213). Several other studies have determined

25

the circulation of identical clones between humans, foods, food animals and their

environment by molecular typing techniques including PFGE, ribotyping, RAPD or

phenotypic typing techniques including, phage typing and antibiotyping (14, 43, 82, 117,

147, 154). A number of studies have demonstrated that molecular typing was useful in

establishing an epidemiological link between outbreak strains and their sources. For

example cuttle-fish chips were determined to be the source of S. Oranienburg infections

by PFGE, ERIC-PCR and in a study that involved isolates from patients and recalled

food samples (105). An outbreak strain of S. Livingstone was traced to animal feed based

on molecular typing data of animal food and human clinical isolates (68). Likewise, at

times, phenotypic data was also successful in determining the source of outbreak. This

was shown in a study where biotyping based on the ability of the isolates to ferment

melibiose was helpful in tracking down the source of a S. Enteritidis outbreak to chicken

portion of the lunch (3).

Molecular typing methods also helped in demonstrating absence of an epidemiological

link between different sources in several studies (37, 79). Molecular typing methods are

not only useful in source tracking but also valuable in surveillance of Salmonella species

in a particular environment (21). All the above studies suggest that molecular typing

methods combined with phenotypic techniques are valuable in source tracking and

establishing an epidemiological link, which is vital in an event of an outbreak or

bioterrorism.

26

Pathogenicity Islands in Salmonella

Salmonella possesses five large pathogenicity islands known as Salmonella Pathogenicity

Islands (SPI) and a number of smaller pathogenicity islets (196). These large DNA

fragments contain genes required for virulence mechanisms including invasion,

macrophage survival, iron uptake and survival in low magnesium conditions (137). All

the SPI except for the SPI-1 are inserted near tRNA loci (86). The SPI are horizontally

acquired and have features of mobile elements including low G+C percentage compared

to the rest of the genome, presence of integrases, presence of insertion sequences and

direct repeats (DR) flanking on either of their sides (137, 149).

SPI-1 and SPI-2 are the two islands that have been extensively studied in Salmonella.

The SPI-1 is a 40 Kb element located at 63 minute centisome of Salmonella

Typhimurium (149) and is present in all subspecies of Salmonella (157). The major

function of the SPI-1 that harbors iron uptake genes is to encode the proteins required for

invasion into the host epithelial cells. The iron uptake locus of SPI-1 has a different G+C

content compared to the rest of the island proving that it was acquired independently of

the SPI-1 (161). SPI-2, which is absent in Salmonella subspecies V is also a 40 Kb

element located at 31 minute centisome near Val tRNA. Normal functioning of SPI-2 has

been shown to be important for expression of SPI-1 genes (59). Its functioning is

important for the survival of Salmonella in macrophages and for defense against host

reactive oxygen species (97, 158). The function of SPI-2 depends on various

environmental cues including ion limitation and osmomolarity and was considered to be

27

regulated by the two component regulatory system phoP/phoQ. Some studies in

Salmonella enterica Gallinarum have shown that SPI-2 but not SPI-1 is required for

virulence (97). In a recent study it was demonstrated that SPI-2 is required for virulence

in the colon and cecum in a mouse model (44). These two studies emphasize the role of

SPI-2 and survival in macrophages in causing infection in the host (44, 97). Hensen-

Wester et al. have shown that SPI-2 could be transferred into a non- SPI-2 containing

species, Salmonella bongeri (85). This functional transfer led to increased colonization

and secretion of effector proteins by S. bongeri. However, these changes were not

sufficient to cause any systemic infection, demonstrating that factors outside SPI-2

influence the virulence of the organism.

The less well-studied SPIs of Salmonella are SPI-3, 4 and 5. SPI-3 has been found only in

Salmonella suspecies, I, II, IIIb and V. It is 17 Kb long and has a mosaic structure and

encodes magnesium transporters. It is important for survival in macrophages, virulence in

mice and survival in low Mg++ conditions (18). It is inserted near the selC tRNA locus

and is regulated by the phoP/phoQ system. SPI-4 is also required for survival in

macrophages and is 27 Kb long. SPI-5 is located near the serT tRNA locus and is unique

to Salmonella species (209). It contains genes coding for Salmonella outer protein B

(sopB) and other putative membrane proteins required for cellular responses. The cause

of insertion of most of the SPIs near tRNA loci is not clear. However, it is possible that

mobile elements that are horizontally transferred get inserted near a conserved locus

similar to tTNA. It is also possible that the mobile elements that are inserted near the

28

conserved locus are retained in the course of evolution. Therefore, the SPIs that are

inserted near tRNA loci are conserved and have been vertically transmitted, although

SPI-1 that is not inserted near a tRNA is an exception.

Both SPI-1 and SPI-2 harbor genes required for the type three secretion system (TTSS)

(137, 146). The TTSS is responsible for producing the proteins essential for bacterial

internalization by the host, macrophage apoptosis and the production of effector proteins

that interfere with the host cellular system and cause systemic disease. TTSS genes

include spiC that encodes proteins required for intramacrophage survival and sseF and

sseG that encode proteins for replication in the macrophage. sifA and sseJ which are

located on SPI-2 have been implicated in virulence and replication in macrophages (201).

Knodler et al. observed an interesting phenomenon of cross talk between various SPIs

(101). They established that the SPI- 5 genes are regulated by the two large pathogenicity

islands (PI), SPI-1 and SPI-2. The genes of SPI-1 are the most conserved in all the

Salmonella subspecies whereas the genes of SPI-2, SPI-3, SPI-4 and SPI-5 are not highly

conserved, according to a microarray analysis (164). A study based on pathogenic

isolates of Salmonella subspecies I by Southern blotting and restriction fragment length

polymorphism (RFLP), revealed that the SPI-1, SPI-2, SPI-4 and SPI-5 have a very

conserved structure but SPI-3 has a high degree of variation between serotypes (5). The

structure and functions of the SPIs are summarized in Table 3.

29

Table 3. Salmonella Pathogenicity Islands

Size/Co-location with tRNA gene

Pathogenicity Island Major role/genes

SPI-1 40 kb, unknown Invasion, Iron uptake genes, sit, invA

40 Kb, val tRNA SPI-2 Survival in macrophages, replication, omp

17 Kb, selC tRNA SPI-3 Magnesium uptake system, virulence genes, mgtC

27 Kb, putative tRNA genes SPI-4 Macrophage survival SPI-5 serT tRNA Salmonella outer protein

gene (sopB), virulence

Structure and major function of Salmonella pathogenicity islands (SPI)

Besides the five PI, Salmonella has other virulence factors including virulence plasmids,

fimbriae and flagella (196). The virulence plasmids in Salmonella are present in only six

serotypes of Salmonella enterica including: S. Typhimurium, S. Enteritidis, S. Dublin, S.

Pullorum, S. Choleraesuis and S. Gallinarum. These plasmids contain the spvRABCD

locus. spvB is important for virulence and actin depolymerization. The spv (Salmonella

virulence plasmid) locus is chromosomal in location in other subspecies of Salmonella,

including subspecies II, IIIa and IV (115). Fimbriae and flagella have been shown to be

required for colonization and motility respectively (196).

30

Antibiotic Resistance in Salmonella

The prevalence of Salmonella in animal products including uncooked meat, eggs and

milk is not surprising because it is endemic in food animals. To control the spread of

infection in animals, antibiotics have been used in the past and are still being used.

Although not proven, the increase of antibiotic resistance in Salmonella in developed

countries could be mainly due to the administration of antibiotics in food animals for

growth and treatment (192). The increase of antibiotic resistance in developing countries

is due to the widespread usage of antibiotics for human treatment (45). Salmonella

evolved into a pathogen by acquiring pathogenicity determinants through horizontal gene

transfer; similarly, it developed antibiotic resistance by virtue of mobile DNA elements.

Salmonella is resistant to a variety of antimicrobials including ampicillin, broad-spectrum

cephalosporins, aminoglycosides, quinolones, tetracycline, trimethoprim and

chloramphenicol. Cabrera et al. characterized 62 Salmonella isolates causing travelers

diarrhea that were collected from the Indian subcontinent and Western Africa during

1995-2002 (28). Overall, 45% of the isolates were resistant to at least one drug including

tetracycline, ampicillin and nalidixic acid. A very high increase (60%) in resistance to

nalidixic acid was observed in 2003 compared to 1991.

Resistance to two or more classes of drugs (MDR phenotype) is becoming increasingly

widespread in Salmonella species. Several studies have demonstrated the increasing

prevalence of multidrug resistance in Salmonella (110). An increase in multidrug

31

resistant Salmonella was observed in a 1989-1990 study based on human clinical isolates

in the US (110). Similar observation was made in Greece in a survey during 1990-1997

where increased resistance to tetracycline, ampicillin and piperacilin in non-typhoidal

Salmonella isolates of humans, food animals and environment was observed (198). S.

Typhimurium was found to be the most resistant in that study. Out of 113 isolates

collected from poultry slaughterhouses, 65% were found to be multiply resistant to

antibiotics including tetracycline, neomycin and streptomycin in a study in Spain (29). In

a similar study, 90% of the S. Enteritidis isolates collected from humans, food and

poultry samples were resistant to at least one antimicrobial and 61% were multidrug

resistant (60). Kariuki et al. observed a trend showing an increase in multiple resistance

to chloramphenicol, streptomycin and tetracycline in human clinical Salmonella isolates

collected from 1994 to 2003 (100).

The prophylactic use of antibiotics in food animals is a major contributing factor for the

increase in resistance in the US and Europe. In 1997, the World Health Organization

(WHO) reported that the selection of antibiotic resistance in non-typhoid Salmonella is

due to the use of antimicrobials in food animals (6). The increase of antibiotic resistance

in the US is mainly due to the spread of resistant organisms in food animals. It is not due

to increased antimicrobial use in humans in US or in any other country (45). Numerous

studies have also verified the spread of resistance from food animals to humans. Chen at

al. have observed that 82% of the isolates obtained from retail meat samples including

chicken, turkey and pork were resistant to one or more drugs (39). An identical clone of

32

S. Typhimurium was observed in nine isolates collected from pork products and an

outbreak of gastroenteritis in Portugal (7). This clone was pentadrug resistant to

ampicillin, chloramphenicol, sulfomethoxizole, streptomycin and tetracycline (ACSuST)

and the resistance was plasmid encoded. A high prevalence of tetA encoding resistance to

tetracycline, strA and strB encoding resistance to streptomycin was observed in a study in

Italy (163). Out of 58 multidrug resistant isolates from swine, turkey, chicken and duck

samples 84% of the isolates carried str genes and 68% harbored tetA genes. An increased

resistance to quinolones and fluoroquinolones was observed in food animals in a thirteen

year study in Germany (134). A number of other recent studies have shown an alarming

increase in the resistance to fluoroquinolones in food animals. In a lengthy study of 22

years, Salmonella isolates from patients and food sources collected from 1981-2003 were

tested for the presence of nalidixic acid resistance (138). During the period of 1981-1991

0.3% of the isolates showed resistance to nalidixic acid whereas, from 1992-2003, 24.8%

of the isolates were resistant to nalidixic acid. Mutations in the quinolone resistance

determining region of gyrA genes were seen in organisms from both food and human

sources and increase in the resistance to nalidixic acid was attributed to the use of the

antibiotics in food animals. The increase in the antibiotic resistance in Salmonella can

also be attributed to the spread of MDR S. Typhimurium DT104 showing the

characteristic pentadrug resistant phenotype ACSuST. In a study of Salmonella isolated

from raw foods of animal origin, animal feed and animal feces, 52% of all S.

Typhimurium were found to be multiply resistant to chloramphenicol, tetracycline,

sulfonamides and β-lactamases (135). This study confirms that food animals are

33

responsible for the increased resistance to various antibiotics in Italy. The above studies

indicate that there has been an increase in multi-antimicrobial resistance over the past

decade in Salmonella species especially in S. Typhimurium and S. Enteritidis.

A number of factors have led to antibiotic resistance in bacteria. One of the major causes

is the acquisition of resistance determinants and their retention even in the absence of

antibiotics. Improper use of antimicrobials as in animal feed particularly at the

subtherapeutic levels favors selection and eventual propagation of the resistant strains.

Some bacteria are intrinsically resistant to antibiotics based on their genetic and structural

organization while others acquire resistance by mutations or by horizontal gene transfer.

A number of mechanisms are responsible for decreased susceptibility in bacteria (Table

4) (166, 211). Some of them are due to chromosomal mutations leading to the low intake

of the drug and increased efflux or alteration of the target. Others could be due to genes

encoding for enzymes that inactivate the drug. A number of pumps or porins are involved

in the uptake of antibiotics by bacteria. Mutations in the genes encoding these porins

often lead to decreased permeability of the antimicrobial and hence increased resistance.

For example mutations altering the expression of the genes encoding the outer membrane

porins ompF and ompC result in decreased uptake of β-lactams in E. coli (166) . A

similar situation was observed in clinical isolates of Salmonella enterica serotype Wein

where absence of ompF led to imipenum resistance (9). acrAB efflux pumps have been

demonstrated to be responsible for the increased resistance of S. Typhimurium to

34

penicillin, tetracycline and chloramphenicol (156). High expression of arcB gene was

observed in post therapy resistant organism compared to pre-therapy susceptible ones.

Mutations in the gyrA gene often lead to decreased susceptibility to quinolones in

Salmonella (200). A number of studies have shown that the presence of β - lactamase

genes confer resistance to various β lactams (172). Most of the resistance determinants

are mobile and are usually harbored by plasmids, phages and integrons.

Table 4. Antibiotic Resistance Mechanisms

Antimicrobial Mode of Action Resistance

Mechanisms Genes responsible bla, ampC Inhibition of

enzymes required for peptidoglycan synthesis, alterations in penicillin binding proteins

β-lactams (penicillins, cephalosporins, carbapenums)

Production of β-lactamases, changes causing reduced uptake of the drug and active efflux

Quinolones (nalidixic acid, ciprofloxacin, levofloxacin)

Inhibit DNA synthesis by acting on DNA gyrase and topoisomerase IV

Mutations in genes encoding gyrase or topoisomerase, decreased permeability and active efflux

tet (A-E), tet (M,O,P,Q,S)

Tetracycline Prevents protein synthesis by binding reversibly to 30 S ribosomal subunit

Altered permeability, active efflux or ribosome protection

sul I & II Sulfonamides and Trimethoprim

Inhibit conversion of p-amino benzoic acid (PABA) into dihydrofolate or

Decreased permeability and overproduction

35

Antimicrobial Mode of Action Resistance Mechanisms

Genes responsible

inhibit dihydrofolate reductase (DHFR) respectively

of PABA

cat genes Chloramphenicol Prevents peptide elongation by binding to 50 S ribosomal subunit

Inactivation of the drug by chloramphenicol acetyl transferases

aac, aad Aminoglycosides (gentamicin, amikacin, tobramycin,kanamycin,strepto-mycin, spectinomycin

Inhibit protein synthesis by binding irreversibly to 30 S ribosomal subunit

Decreased uptake of drug or enzymes modification

Some of the common antimicrobials to which Salmonella is resistant and their mode of

action (166, 211)

Plasmids as Antibiotic Resistance Determinants Plasmids are one of the most common vectors of antibiotic resistance genes in Gram

negative organisms. Numerous studies based on conjugation experiments have shown

that this resistance is transferable from one species to another facilitating the spread of

antibiotic determinants (42, 208). Plasmids harboring resistant genes to a number of

antibiotics have been reported. A transferable but non-conjugative plasmid carrying a

blaCMY gene and conferring resistance to cephalosporins was observed in Salmonella

species isolated from animals (208). Evidence of antibiotic resistance genes on a serotype

specific virulence plasmid was first seen in clinical isolates of S. Choleraesuis where a

smaller plasmid with drug resistance genes integrated into the virulence plasmid giving

rise to a bigger plasmid (42). A very recent study also demonstrated the propagation of

36

virulence genes and antibiotic resistance genes in a plasmid (199). An integron carrying

resistance genes to ampicillin, streptomycin and kanamycin was demonstrated in a

virulence plasmid on S. Typhimurium in that study. This situation is particularly

alarming since it allows the dissemination of resistance and virulence determinants

together and may favor selection. Circulation of plasmids with antibiotic resistance genes

is a common feature in Enterobacteriaceae. For example a gene conferring resistance to

florphenicol sequenced from MDR S. Newport showed 100% identity to the floR gene of

R55 plasmid of Klebsiella pneumoniae (142). 96% of all S. Mbandaka clinical isolates

were found to be resistant to broad-spectrum cephalosporins encoded by plasmids in a

Tunisian study (132). A plasmid conferring resistance to all β-lactams and β -lactam

combinations, streptomycin, trimethoprim and sulfamethoxazole was observed in a

clinical isolate of Salmonella Cubana (150). All the above studies show that plasmid

mediated multiple drug resistance is widespread in Salmonella and is very prevalent in

both human and animal isolates.

Integrons as Antibiotic Resistance Determinants Integrons are mobile genetic elements containing antibiotic resistance genes. These

integrons belong to a family of transposable elements, Tn21, and were first described by

Schmidt and Kaul in 1984 (181). The name integron was first proposed by Stokes and

Hall in 1989 (185). Integrons are found in chromosomal and extrachromosomal DNA in

mostly in Gram negative bacteria (180). They consist of a 5’ conserved sequence (CS), a

middle variable region and a 3’CS. The antibiotic resistance genes are generally

37

incorporated into the variable region by site-specific recombinations. The integrase gene

(intI) of the 5’CS encodes enzymes essential for these recombinations. It mediates

recombinations between a primary recombination sequence (attI) and a secondary site

(attC or 59 base element) (46). The secondary site is associated with the gene cassettes of

the variable region. A typical integron structure is shown in Figure 1.

Figure 1. Integron Structure

Variable Region

General structure of class-1 integron with 5’ conserved sequence, 3’ CS and a middle

variable region with gene cassettes (112). intI-integrase gene that mediates

recombination in class-1 integron, Pant – anterior promoter required for expression of

gene cassettes, sulI- sulfonamide resistance encoding gene typically present in the 3’ CS

of an integron

Integrons are divided into four classes and can be distinguished by their intI genes. The

int1 gene was first described in an E. coli K12 strain in 1988 (139). The 3’CS is usually

associated with genes encoding resistance to quaternary ammonium compounds (QAC)

and sulfonamides. Integrons found in Salmonella species have the standard integron

structure. Brown et al. characterized integrons in S. Enteritidis by using primers targeting

38

the conserved integron sequences (26). They observed four different integron profiles in

11 isolates proving a great degree of diversity.

Class-1 integrons are the most common ones that are associated with the multidrug

resistant phenotype. Guerra et al. observed that 20% of all the MDR Salmonella

serotypes isolated from patients and foodborne outbreaks in Spain were positive for class-

1 integrons (83). In an Irish study on clinical and food isolates of Salmonella

Typhimurium, 90% were seen resistant to sulfonamides and 85% of those harbored class-

1 integrons (52). This supports the previously known concept that sulfonamide resistance

is a good marker for class-1 integrons. The fact that sul genes are good markers for the

presence of class-1 integrons was recently demonstrated (8).

The presence of integrons was noted in clinical as well as environmental Salmonella

isolates (124). Integrons are frequently associated with multidrug resistance phenotype

(65, 116, 169). Class-1 integrons were detected in 38% of MDR S. Gallinarum isolated

from chicken in South Korea (106). 34% of animal isolates and 71% Salmonella

Typhimurium contained class-1 integrons in a study based in England and Wales (116).

Class-1 and class-2 integrons were observed in a variety of serotypes that were resistant

to three or more drugs including S. Emek, S. Newport, S. Stanley and S. Ohio (169).

Multiplex PCR revealed the presence of class-1 integrons in 30% of 104 veterinary

isolates that were MDR (65). It was also observed in the study that isolates showing

resistance to tetracycline, chloramphenicol and kanamycin had a higher probability of

39

harboring integrons compared to others. In a recent study integrons were detected on

conjugative plasmids in S. Agona isolates from pigs that were resistant to multiple

antibiotics including tetracycline and chloramphenicol (24). In another study integrons

were noted in Salmonella isolates from non-symptomatic carriers (212) . Overall, these

studies prove that class-1 integrons conferring multidrug resistance are ubiquitous in

animal and human isolates of Salmonella. A very high prevalence is observed in S.

Typhimurium isolates. This could be because of the wide host range and hence increased

exposure to antibiotics and it could also be because of successful clonal spread.

It is unknown as to where the integrons harboring multiple gene cassettes originated and

what their original function was. A number of scientists have speculated that they have

originated from the super integrons (SI) of Vibrio cholerae. The SI are large elements

integrated into the chromosome of V. cholerae and harbor up to seventy gene cassettes

(155). Magnus et al. have shown that the integrase activity of SI and class-1 integrons is

similar and also sequence similarity exists between attC and Vibrio cholerae repeats.

They have also shown that SI is required for metabolic activities and is not limited to just

the virulence or antibiotic resistance functions. The fact that integrons were isolated from

environmental samples further supports the theory that integrons do not have to be

associated with pathogenicity or antibiotic resistance (179).

Many recent studies have described the presence of novel integrons or integrons carrying

novel resistance genes. A novel integron with β lactam and aminoglycoside resistance

40

genes was reported in S. Agona isolates from human clinical sources (152). A new class-

2 integron was identified in S. Enteritidis isolates in another recent study (2). A new gene

aacA5 encoding resistance to aminoglycoside in a S. Kentucky strain isolated from spices

was recently described (114).

Integrons can be located on plasmids or chromosomes in Salmonella (25, 194). Class-1

integrons coupled with plasmids in clinical were noted strains of Salmonella

Typhimurium (194). Many scientists have observed the chromosomal integration of

integrons in the pentadrug resistant strain S. Typhimurium DT104 isolates. This strain,

which is avian in origin, has caused an immense increase in the multidrug resistant of

Salmonella species (208). The 10 KB resistance gene cluster was characterized by Briggs

et al. and contains two class-1 integrons separated by a resistance plasmid (R plasmid)

(25). The characteristic two integron (1.0 Kb and 1.2 Kb) pattern of S. Typhimurium

DT104 and S. Typhimurium non-DT104 isolates showing pentadrug resistance was noted

in a number of studies (11, 131). Boyd et al. further characterized the antibiotic

resistance gene cluster and found it to be a part of a bigger island (22). They named this

Salmonella genomic island 1 (SGI 1). SGI 1 is a 43 KB element with a different G+C

ratio than the rest of the genome and it is usually flanked by DR establishing its

horizontal acquisition (63). SGI 1 was later found in S. Albany, S. Paratyphi, and S.

Agona with minor sequence variations (63, 64, 143). In a recent study, SGI 1 was

identified in 46% of S. Paratyphi isolates tested (151). Levings et al. in a very recent

study identified SGI in a variety of other Salmonella serotypes including S. Emek, S.

41

Derby, S. Infantis and S. Kiambu (113). This widespread presence of SGI in non S.

Typhimurium isolates as well as non DT104 strains suggests that SGI confers some

advantage to the organism and is spreading rapidly either by horizontal transfer or by

plasmids. A third integron of 1.6 Kb carrying additional genes dfrA1 and aadA1

conferring resistance to trimethoprim and aminoglycosides respectively was recently

found in two S. Typhimurium DT104 bovine (51).

Hypothesis

Both the antibiotic resistance and virulence factors are required by the organism for

survival against the host defenses. However, the correlation between antibiotic resistance

and virulence in Salmonella or any other organism has never been extensively studied.

There have been few reports of such association in Salmonella, for example the

integration of both the serotype specific virulence plasmid and antibiotic resistant

plasmid or integron in S. Choleraesuis, S. Typhimurium (42, 199). Similarly, Rahman et

al. observed that the multidrug resistant S. Typhi caused more severe illness and

prolonged fever than the susceptible ones due to possible association of the resistance

plasmid with the virulence genes (167). This kind of association is very plausible as the

bacteria that are pathogenic are more likely to encounter antibiotics than the less virulent

organisms. For non-typhoidal Salmonella and other foodborne pathogens this might not

be entirely true because of the administration of antibiotics for growth and prophylaxis in

food animals. The pathogen does not have to be particularly virulent to have encountered

antibiotics. However, the fact that it survives illustrates its ability to invade and propagate

42

amidst host defenses and antibiotics. Some scientists might not agree with the above

coselection concept on the basis that the presence of antibiotic genes cause target

alterations and hence reduces the overall virulence of the bacteria (140). This could be

true for maybe the first few growth cycles but the eventual survival and multiplication

proves that the bacteria have compensatory mechanisms. In fact, it has been shown that

compensatory mutations arise to support the growth of antibiotic resistant organisms (17).

This further supports the opinion that the organisms that have both antibiotic resistance

and virulence thrive better in hostile conditions. A number of subtle associations between

antibiotic resistance and virulence have already been recognized in some studies. The

occurrence of multiple antibiotic resistant operon marRAB in Salmonella subspecies I

was observed by Randall and Woodward (170). The marA locus upregulates efflux

pumps (example acrAB) that pump out antibiotics and marB downregulates outer

membrane porin including ompF and therefore resulting in the decreased permeability of

the outer membrane to antimicrobials. In addition, they found that the mar system was

absent in Klebsiella, Streptococcus and Staphylococcus (mar). In a later study, Randall

and Woodward have shown that the mar mutant of S. Typhimurium DT104 has reduced

adherence and lower survival in macrophages in chickens (171). Similarly the

upregulation of genes encoding iron uptake systems (fecA) and antioxidant defense

enzymes (sodA, soxRS) was observed when marA was constitutively expressed in E. coli

(12). The importance of iron as a virulence factor in Salmonella species and its presence

on SPI-1 has already been established (94, 214).

43

The fact that antibiotic resistance persists even in the absence of selective pressure

implies that the resistance factors are incorporated in the genome. This is more probable

if the antibiotic gene clusters are carried by an integron since they have the integrase gene

that mediates site-specific recombinations. The hypothesis of this study is that the

antibiotic resistance determinants present on an integron are likely to be integrated into

the chromosome as seen in the case of the S. Typhimurium DT104. This trend may be

more common in the Salmonella serotypes that are more widespread and therefore likely

exposed to antibiotics, for example S. Typhimurium, S. Enteritidis, S. Newport, and S.

Agona and other common serotypes associated with food animals. The expected

integration site for the integron on the Salmonella chromosome is a conserved location as

seen in most horizontal gene transfers. A resistance gene cluster in PI encoding iron

uptake systems has been recently found in Shigella flexneri but not in Salmonella species.

Therefore the potential incorporation sites for the resistance genes in Salmonella species

are SPI-1 (encodes for iron uptake proteins and is highly conserved), SPI-5 (encodes for

Mg++ uptake systems and putative membrane proteins) or SPI-3 (has a mosaic structure

with varying G+C content and recombination hot spots in addition to encoding Mg++

uptake systems and putative membrane proteins). Both PI and antibiotic gene clusters

have the features of mobile elements (IS, DR and integrases) and are required for the

survival of the bacterium against host defenses. Based on this and the above studies it is

reasonable to hypothesize that selective pressure would bring SPI and antibiotic

resistance elements together. It is possible that they are physically interrelated to each

other and are co-expressed collectively.

44

Aims of the Study

The overall aims of the project are to develop a protocol for rapid isolation of Salmonella

from food, to build a molecular typing database and study the antibiotic resistance

mechanisms of Salmonella species. The specific aims of the project are as follows:

• To rapidly detect and isolate Salmonella species from food, as pure culture is

required for molecular typing as well as antibiotic resistance analysis

• To build a fingerprinting database with known serotypes and to identify unknown

Salmonella species by comparing them to the database

• Apply the DNA fingerprinting database to see differences in the typing patterns of

the clinical and environmental Salmonella isolates

• To compare the discriminatory ability of PFGE and ribotyping

• To determine whether the DNA typing patterns correlate with the antibiotic

resistance profiles as observed in other studies (76, 184, 213)

• To understand the molecular basis of antibiotic resistance in Salmonella based on

DNA profiles, plasmids and integrons

• To determine if antibiotic resistance determinants and pathogenicity genes are co-

located in Salmonella species as seen in Shigella flexneri (127)

45

Chapter Two - Material and Methods

Bacterial Isolates

A total of one hundred fourteen Salmonella isolates consisting of 33 serotypes and three

subspecies were used in this study. One hundred wild type isolates were used of which

sixty are clinical and forty are from environmental sources. Thirty out of forty

environmental isolates obtained from two midwestern turkey farms were kindly donated

by Dr. Catherine Logue of North Dakota State University (NDSU); 10 were obtained

from Washington State Department of Health (WADOH). Forty eight of the sixty clinical

isolates were collected from various hospitals in Tampa, FL including Tampa General

Hospital (TGH), Saint Joseph’s Hospital (SJH) and University Community Hospital

(UCH). These Tampa clinical isolates were obtained through the Florida Department of

Health (FLDOH) and will be referred to as FLDOH isolates. Twelve clinical isolates

were donated by the WADOH. Twelve Salmonella strains were used as controls for real

time PCR, ribotyping, PFGE and the antibiotic susceptibility testing. Seven of the control

strains were obtained from American Type Culture Collection (ATCC, Manassa, VA);

six were from CDC and one was from DuPont Qualicon (Wilmington, DE). All the

isolates were characterized biochemically by API 20E® panel, analyzed with the APILAB

Plus® Identification Program v.3.3.3/4.0 (bioMerieux, Inc., Hazelwood, MO) by Mrs.

Kealy Peak. Serotyping of clinical isolates was performed by the Salmonella reference

laboratory of the FLDOH, Bureau of Laboratories, Jacksonville, FL. Strains obtained

from WADOH and Dr. Logue were serotyped by the contributors prior to inclusion in

this study. E. coli, Proteus mirabilis and Citrobacter freundii obtained from ATCC were

46

47

used for specificity testing for the food detection and isolation. Shigella sonnei, Listeria

monocytogenes and Bacillus cereus were used for the specificity testing of the primers

and probes for the detection by real time PCR. The isolate number, serotype and source

are shown in Table 5.

Table 5. Isolates Used in the Study

Strain number Serotype Clinical/ Environmental Source Source Isolation DateCBD 032 S.Nima Clinical Unknown TGH 7/1/2001 CBD 033 S.Aberdeen Clinical Rectal swab, Human TGH 9/30/2001 CBD 067 S.Newport Clinical Unknown UCH 12/20/2001 CBD 069 S.Javiana Clinical Unknown UCH 12/20/2001 CBD 213 S.Newport Clinical Stool, Human FLDOH 11/18/2002 CBD 222 S.Javiana Clinical Stool, Human FLDOH 11/26/2002 CBD 425 S.Newport Clinical Stool, Human WADOH 8/10/2001 CBD 426 S.Newport Clinical Stool, Human WADOH 2/5/2002 CBD 427 S.Newport Clinical Stool, Human WADOH 3/31/2002 CBD 428 S.Newport Clinical Stool, Human WADOH Unknown CBD 429 S.Oranienburg Environmental Bearded Dragon WADOH 7/22/2002 CBD 430 S.Apapa Environmental Lizard WADOH 2/5/2003 CBD 431 S. Saintpaul Environmental Alfalfa sprouts WADOH 3/14/2003 CBD 432 S. arizonae Environmental Snake WADOH 2/5/2003 CBD 433 S. arizonae Clinical Stool, Human WADOH 5/29/2003 CBD 434 S.Brandenburg Clinical Stool, Human WADOH Unknown CBD 435 S.Westhampton Clinical Stool, Human WADOH 6/4/2003 CBD 436 S.Paratyphi A Clinical Blood, Human WADOH 6/5/2003 CBD 437 S.Saintpaul Clinical Stool, Human WADOH 6/6/2003 CBD 438 S.Typhimurium Clinical Stool, Human WADOH 6/4/2003 CBD 439 S.Enteritidis Clinical Stool, Human WADOH 6/6/2003 CBD 440 S.Muenchen Environmental Unpasteurized OJ outbreak WADOH 6/1/1999 CBD 441 S.Muenchen Environmental Unpasteurized OJ outbreak WADOH 6/1/1999 CBD 442 S.Muenchen Environmental Unpasteurized OJ outbreak WADOH 6/1/1999 CBD 443 S.Hildgo Environmental Unpasteurized OJ outbreak WADOH 6/1/1999 CBD 444 S. Alamo Environmental Unpasteurized OJ outbreak WADOH 6/1/1999 CBD 445 S. Javiana Environmental Unpasteurized OJ outbreak WADOH 6/1/1999 CBD 446 S. Typhimurium Environmental Stool, Human WADOH Unknown CBD 569 S.Alachua Environmental Turkey Plant-2, Day-1 NDSU 2000 CBD 570 S. Anatum Environmental Turkey Plant-1, Farm-A NDSU 2000 CBD 571 S.Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 572 S.Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 573 S.Istanbul Environmental Turkey Plant-1, Farm-B NDSU 2000 CBD 574 S.Istanbul Environmental Turkey Plant-1, Farm-B NDSU 2000

48

Strain number Serotype Clinical/ Environmental Source Source Isolation DateCBD 575 S.Istanbul Environmental Turkey Plant-1, Farm-B NDSU 2000 CBD 576 S.Kentucky Environmental Turkey Plant-1, Farm-B NDSU 2000 CBD 577 S.Kentucky Environmental Turkey Plant-1, Farm-A NDSU 2000 CBD 578 S. Mbandaka Environmental Turkey Plant-1, Farm-A NDSU 2000 CBD 579 S. Montvideo Environmental Turkey Plant-2, Day-2 NDSU 2000 CBD 580 S. Muenster Environmental Turkey Plant-1, Farm-C NDSU 2000 CBD 581 S.Muenchen Environmental Turkey Plant-1, Farm-C NDSU 2000 CBD 582 S. Reading Environmental Turkey Plant-1, Farm-B NDSU 2000 CBD 583 S. Reading Environmental Turkey Plant-1, Farm-B NDSU 2000 CBD 584 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 585 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 586 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 587 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 588 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 589 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 590 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 591 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 592 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 593 S. Newport Environmental Turkey Plant-2, Day-3 NDSU 2000 CBD 594 S. Newport Environmental Turkey Plant-2, Day-4 NDSU 2000 CBD 595 S. Newport Environmental Turkey Palnt-2, Day-5 NDSU 2000 CBD 596 S. Newport Environmental Turkey Plant-2, Day-5 NDSU 2000 CBD 597 S. Newport Environmental Turkey Plant-2, Day-6 NDSU 2000 CBD 598 S. Newport Environmental Turkey Plant-2, Day-6 NDSU 2000 CBD 603 S. Javiana Clinical Stool, Human FLDOH 8/2003 CBD 604 S. Newport Clinical Stool, Human FLDOH 8/2003 CBD 746 S. Typhimurium Clinical Stool, Human UCH 3/2004 CBD 747 Clinical Stool, Human UCH 3/2004 S. IV 50:z4,z23:-- CBD 757 S. Typhimurium Clinical Stool, Human UCH 4/2004 CBD 759 S. Newport Clinical Stool, Human SJH 4/2004 CBD 775 S.Typhimurium Clinical Stool, Human SJH 3/2004 CBD 776 S. Sandiego Clinical Body Fluid from thyroid SJH 4/2004 CBD 777 S.Typhimurium Clinical Stool, Human SJH 4/2004 CBD 778 S. Typhimurium Clinical Stool, Human SJH 4/2004 CBD 779 S. Enteritidis Clinical Stool, Human SJH 4/2004 CBD 780 Clinical Stool, Human UCH 4/2004 S. IV 50:z4,z23:-- CBD 781 S. Enteritidis Clinical Stool, Human UCH 4/2004

49

Strain number Serotype Clinical/ Environmental Source Source Isolation DateCBD 782 S. Stanley Clinical Stool, Human UCH 4/2004 CBD 805 S. Berta Clinical Stool, Human UCH 6/2004 CBD 806 S.species Clinical Stool, Human UCH 6/2004 CBD 807 S.Javiana Clinical Rectal swab, Human SJH 6/2004 CBD 808 S.Muenchen Clinical Rectal swab, Human SJH 6/2004 CBD 809 S.Muenchen Clinical Stool, Human SJH 6/2004 CBD 810 S. Heildelberg Clinical Stool, Human SJH 6/2004 CBD 811 Clinical Rectal swab, Human SJH 6/2004 S. I 4,12:i:-- CBD 813 S. Javiana Clinical Stool, Human SJH 7/2004 CBD 814 S. Anatum Clinical Stool, Human SJH 7/2004 CBD 815 S. Newport Clinical Stool, Human SJH 7/2004 CBD 816 S.Typhimurium Clinical Body fluid, Human SJH 7/2004 CBD 817 S.Typhimurium Clinical Unknown UCH 7/2004 CBD 818 S.Enteritidis Clinical Stool, Human UCH 7/2004 CBD 819 S.Javiana Clinical Stool, Human SJH 8/2004 CBD 820 S.Typhimurium Clinical Stool, Human SJH 8/2004 CBD 821 S.Sandiego Clinical Stool, Human SJH 8/2004 CBD 822 S.species Clinical Stool, Human SJH 8/2004 CBD 823 S.Typhimurium Clinical Stool, Human SJH 8/2004 CBD 824 S.Tallahassee Clinical Stool, Human SJH 8/2004 CBD 825 S.Paratyphi A Clinical Blood, Human UCH 8/2004 CBD 826 S.Javiana Clinical Unknown UCH 8/2004 CBD 827 S.Newport Clinical Stool, Human UCH 9/2004 CBD 828 S.Typhimurium Clinical Stool, Human UCH 9/2004 CBD 829 S.Newport Clinical Stool, Human SJH 9/2004 CBD 830 S.Javiana Clinical Stool, Human SJH 9/2004 CBD 831 S.Muenchen Clinical Stool, Human SJH 9/2004 CBD 832 S.Enteritidis Clinical Stool, Human UCH 10/2004 CBD 833 S. IV 50:z4,z23 :- Clinical Stool, Human UCH 10/2004 CBD 020 S. Infantis Dupont Dupont 103 CBD 024 S.Enteritidis ATCC ATCC 13076 CBD 025 S.Choleraesuis ATCC ATCC 13312 CBD 026 ATCC ATCC 13314 S. arizonae CBD 027 S. Pullorum ATCC ATCC 19945 CBD 028 S. Typhimurium ATCC ATCC 23564 CBD 030 S. Newport ATCC ATCC 6962 CBD 031 S. Derby ATCC ATCC 6960

50

51

Strain number Serotype Clinical/ Environmental Source Source Isolation DateCBD 236 S. Typhimurium CDC DOH-D-13 CBD 321 S. Braenderup CDC CDC H 9812 CBD 387 S. arizonae CDC CAP D-05 CBD 599 S. Typhimurium CDC CDC 61-99 CBD 600 S. Typhimurium CDC CDC 78-99 CBD 1058 S. Newport ATCC ATCC 27869 CBD 52 E. Coli ATCC ATCC 25922 CBD 553 Citrobacter freundii ATCC ATCC 8090 CBD 554 Proteus mirabilis ATCC ATCC 35659 CBD 006 Bacillus cereus ATCC ATCC 11778 CBD 009 Listeria monocytogenes ATCC ATCC 9525 CBD 002 Shigella sonnei ATCC ATCC 9290

Isolate number, serotype, source and date of isolation of bacteria used in the study. UCH-University Community Hospital,

Tampa, FL, SJH- St. Joseph’s Hospital, Tampa, FL, TGH- Tampa General Hospital, WADOH- Washington Department of

Health, FLDOH- Florida Department of Health, NDSU- North Dakota State University, O.J- orange juice. The turkey carcass

strains were isolated from two Plants, 1 and 2. Plant-1 isolates were from three different farms, A, B and C. Plant-2 isolates

were collected in a course of six days. The specific days, farms and plants are indicated in the table.

DNA Extraction

DNA was extracted from pure cultures by using the MagNA Pure® LC instrument and kit

(Roche Applied Sciences, Indianapolis, IN) or the Epicenter Masterpure DNA isolation

kit (Epicenter Biotechnologies, Madison, WI). All the buffers except for Tris EDTA (TE)

buffer (10mM Tris; 100mM Ethylenediamine tetraacetic acid) were provided in the kits.

A 1: 20 ratio of, DNA to molecular biology grade water (Sigma Aldrich, St. Louis, MO)

was used for all PCR reactions.

®DNA Extraction by MagNA Pure

®MagNA Pure is designed to purify DNA from bacteria and fungi. Bacterial isolates from

freshly sub-cultured plates were grown in 4 ml of trypticase soy broth (TSB, REMEL,

Inc., Lenexa, KS) for 18 hours at 37 °C. One ml of the TSB culture was centrifuged at

8000 X g for 10 minutes and 900 μl of the supernatant was discarded. One hundred thirty

μl of bacterial lysis buffer was added to the remaining 100 μl containing the pellet and

mixed well. Twenty μl of proteinase K (50mg/ml) was added and incubated at 65 °C for

10 minutes and at 95 °C for 10 minutes. The above 250 μl of the lysed sample was loaded

into the machine along with buffers and disposables. The buffers are subsequently added

automatically into the sample by the MagNa Pure® instrument. The first buffer to be

added is 300 μl of lysis binding buffer, which lyses the cells and releases the DNA. Then,

150 μl of magnetic glass particle is added to which DNA is bound. Four hundred fifty μl

52

of wash buffers I and II are then added to remove any unbound particles. One hundred μl

of elution buffer is finally added to elute the DNA.

DNA Extraction by Epicenter Kit

Bacterial colonies from freshly sub-cultured plates were grown for 18 hours in TSB. 1 ml

of the above culture was centrifuged for 5 minutes at 12,000 X g. The pellet was

resuspended in 1 μl of proteinase K (50 μg/μl) and 150 μl of 2X tissue and cell lysis

solution (2 X T+C). The sample was mixed well by vortexing and then was incubated at

65 °C for 30 minutes. The sample tubes were transferred to a 95 °C heat block, incubated

for 10 minutes, and then placed on ice for 5 minutes. One hundred fifty μl of protein

precipitation reagent provided in the kit was added and the mixture was vortexed. The

samples were centrifuged at 10,000 X g for 10 minutes and the supernatant was

transferred to a fresh microfuge tube. Five hundred μl of 75% isopropanol was added to

the pellet, tubes were inverted 30 to 40 times and centrifuged at 12,000 X g for 10

minutes at 4 °C. The pellet containing DNA was rinsed twice with 75% ethanol. Finally,

the pellet was resuspended in 200 μl of TE.

Real time PCR- Primer and Probe Testing

Three primers and probe sets representing the genes Salmonella outer protein B (sopB),

outer membrane porin F (ompF) and Salmonella virulence plasmid A (spvA) were

designed. sopB is required for virulence and fluid secretion but not invasion (78). The

53

main function of spvA is virulence since spvA mutants show lower virulence in mice

(115). ompF is a porin, present on SPI-2 and is required for Salmonella virulence (109).

The TaqMan probes were labeled with the reporter dye, 6 – carboxyfluorescein (FAM)

on the 5’ end and the quencher dye, Black Hole Quencher (BHC) on the 3’ end. The

primer and probe sequences are listed in Table 6.

Table 6. Primers and Probes for Real Time PCR

Gene Primer or probe Sequence (5’ to 3’) sopB Forward TGGCGGCGAACCCTATAAA sopB Reverse CGCGTCAATTTCATGGGC sopB TaqMan probe TCGCACAACGCCTTGCCATGTT spvA Forward CGGTATTTGCTGGTTAATGGC spvA Reverse GAGCGTCGGCCGGAC spvA TaqMan probe TCATTAACCACCATCAGGGTGGCCA ompF Forward CCTGGCAGCGGTGATCC ompF Reverse AAATTTCTGCTGCGTTTGCG ompF TaqMan probe TGCCCTGCTGGCTGCTGCA

The primer and probes sequences used for real time PCR in the study. All the above

primers were designed using Primer Express® Oligo design software, version 1.5

(Applied Biosystems, Foster City, CA) for this study.

For the real time PCR, 50 μl reaction was set up consisting of 25 μl of TaqMan universal

master mix (Applied Biosystems, Foster City, CA), 0.45 μl forward primer, 0.45 μl

reverse primer (100 pmol/μl stock each), 0.125 μl of probe (100 pmol/μl stock), 18.975

μl of molecular biology grade water (Sigma Aldrich, St. Louis, MO) and 5 μl of the

template DNA (40-50 μg/ml). All the primers used in this study were purchased from

54

Integrated DNA Technologies (IDT DNA, Coralville, Iowa). PCR amplification and

detection was carried out using ABI Prism 7700 sequence detection system using the

default parameters (Applied Biosystems, Foster City, CA). Each sample was run in

duplicate and the mean Cycle Threshold (CT) value was calculated. CT value represents

the cycle number at which the florescence of the reaction crosses the threshold (102). CT

value shows the stage of the PCR reaction at which there is enough amplified product to

give a positive result. Therefore, the lower the CT value the higher is the likelihood of the

reaction to be positive. CT value of 40 or above was considered to be a negative reaction

based on the criteria set by Heller et al. (90).

Detection and Isolation of Salmonella from Artificially Contaminated Food Samples

Ready to eat food samples were used in this study, as they are potential candidates for

natural or intentional contamination. The food was from local grocery stores and was

divided into 25 gm aliquots and frozen at –30 °C until needed. These foods are listed in

Table 7. The background flora that is represented in CFU per gram of each food is also

shown in the table. The media used in this study were purchased from REMEL

(REMEL, Inc., Lenexa, KS). The background flora for each food was calculated by

using the heterotrophic plate count (HPC) method as follows. Twenty five gm of food

was homogenized with 225 ml of sterile phosphate buffered saline (PBS) in a stomacher

(Seward Medical, London, UK) for 2 minutes at 230 RPM. The homogenized sample

was serially diluted to 10-2 -3 and 10 dilutions. Ten ml of the sample as well as the

dilutions were poured onto a petri dish. Then, 12-15 ml of plate count agar (cooled to 45

55

± 1°C) was poured into the petri dish and allowed to solidify at room temperature. The

plates were then incubated at 37 °C for 48 hours and the colony counts were recorded.

Table 7. Food Samples for Analysis

Food Sample Background (CFU/gm) Chicken cuts 15

Egg salad 500 Hamburger 5050

Sushi 100 Blueberries 420

Cheese 2550 Mayonnaise <10 Orange juice 0

Ready to eat food samples used in the study and their background flora calculated

according to HPC protocol. The background is represented in colony forming units

(CFU) per gram of food.

For isolation and detection, 25 grams of each food sample was artificially inoculated with

low spike (1- 10 CFU of S. Enteritidis, ATCC 13076 or S. Typhimurium, ATCC 23564)

or mixed spiked (1-10 CFU of Salmonella species along with 5-200 CFU E.coli, Proteus

mirabilis and Citrobacter freundii). The spiking amounts for each experiment and the

organisms is shown in the Appendix, Table A1. The negative control was unspiked. The

standard spiking amount was maintained through frozen glycerol dilution stocks kept at –

80 °C. One hundred μl of frozen dilution stock of each organism, which was the amount

used for the intentional contamination of the food samples, was plated on three TSA

plates for viability count and quality control for each experiment performed. For

56

Salmonella, 100 μl of the frozen dilution was also inoculated on three xylose lysine

desoxycholate (XLD) plates. The mean viable count from the three XLD plates was

considered as the spiking amount of Salmonella for each experiment. The mean viable

count from the three TSA plates was considered the spiking amount for E. coli and

Citrobacter. For the Proteus species individual colonies were not counted, but a lawn of

growth on TSA plate was considered as the ideal spiking amount.

The artificially contaminated food samples were homogenized within a sterile filter bag

(Interscience laboratories, Weymouth, MA) using the stomacher (Seward medical,

London, UK) for 90 seconds at 230 RPM with 225 ml of buffered peptone water (BPW,

pH 7.2) containing bacto peptone. The homogenate was incubated at 37 °C for 6 hours

and 100 μl of the same was plated on TSA and XLD agar respectively and then incubated

at 37 °C for 18 hours. For orange juice the inoculated BPW was shaken in a jar and was

not homogenized. Salmonella species can be differentiated from other enterics based on

three reactions, xylose fermentation, lysine decarboxylation and hydrogen sulfide (H2S)

production on XLD agar. Xylose is fermented by most enterics but not Shigella, this

differentiates Shigella from Salmonella. Salmonella, which has lysine decarboxylase

enzyme, reverts the pH back to alkaline conditions after the xylose fermentation.

Coliforms are lysine positive but the presence of excess sucrose and lactose prevent these

from reverting to alkaline conditions. Sodium thiosulphate and ferric ammonium citrate

lend Salmonella to produce H2S that turns the colony black whereas E. coli, Citrobacter

and Proteus produce yellow colonies. Deoxycholate is the selective agent and inhibits the

growth of Gram positive organisms.

57

One ml of the BPW enriched samples was selectively enriched by IMS and tetrathionate

(TT) broth. Organisms that can reduce TT survive and flourish in this medium while

others are inhibited. Therefore, growth of fecal organisms will be inhibited. Bile salts and

sodium thiosulfate inhibit Gram positive organisms and some Enterobacteriaceae. For

IMS, 1 ml of the sample was mixed with 20 μl of anti Salmonella antibody beads (Dynal

Biotech, Brown Deer, WI). The beads and the sample were mixed for an hour using the

sample mixer (Dynal Biotech) and washed three times for 10 minutes in 400 μl of sterile

PBS (with 10% Tween). Finally the beads were suspended in 100 μl of sterile PBS and

50 μl was plated onto each of TSA and XLD agar plates. For TT broth enrichment, 1ml

of the BPW enriched sample was mixed with 10 ml of TT broth and incubated for 4

hours, then 100 μl of the sample was plated onto TSA and XLD plates. The XLD and

TSA plates from IMS and TT broth enrichment were incubated for 18 hours at 37 °C.

The schematic of the isolation is represented in Figure 2.

Figure 2. Isolation and Detection of Salmonella

25 gm Food (spiked, mixed spiked and unspiked) +

225 ml BPW

Enriched BPW

TT, 4 hrs, 370C

PP

Detection by RT PCR

6 h 37 oC

Plate IMS

Plate

58

Schematic of detection and isolation protocol; BPW=buffered peptone water,

TT=tetrathionate broth, IMS=immunomagnetic separation, RT PCR=real time PCR

Plate counts were recorded and the morphology of the colonies was determined. All

colonies that were black on XLD and resembled the control plates were considered to be

Salmonella species. Each experiment was repeated for two or three times and the average

was calculated. DNA was extracted by using the ABI PrepMan® kit (Applied

Biosystems, Foster City, CA) from one ml of each the BPW and the TT broth enriched

samples. Real time PCR (ABI 7700, Applied Biosystems, Foster City, CA) with

Salmonella specific ompF gene was used to test the DNA extracted from the food

samples.

Statistical Analysis

Students T test was calculated by comparing the averages of two sets of isolation.

Isolation results from each enrichment technique: BPW, BPW+IMS and BPW+TT were

compared against the others to get the P value. The data for low and mixed spiking was

analyzed separately.

Ribotyping

Automated ribotyping was performed on the RiboPrinter® (Dupont Qualicon,

Wilmington, DE) with the restriction enzyme EcoRI according to manufacturers’

instructions. All the reagents were supplied by the manufacturer. Briefly, 2-3 isolated

59

colonies from freshly inoculated TSA plates were suspended in 200 μl of sample buffer

and heated to 80 oC for 15 minutes. 5 μl each of lysis agent A and B were added to 30 μl

of the above sample and were placed in sample carrier tray. The sample carrier tray was

loaded into the RiboPrinter® along with the gel cassette, membrane, purified water,

restriction enzyme and other disposables including probe, substrate and conjugate. All the

steps are automatically performed by the RiboPrinter® including the restriction digestion,

separation of the DNA fragments on the gel and transfer of the fragments onto a

membrane and its subsequent hybridization with the rDNA probe. The results were

exported into the BioNumerics® (Applied Math, Sint-Martens Latem, Belgium) program

in QNX (text file) format.

Pulsed Field Gel Electrophoresis (PFGE)

Macrorestriction digestion of genomic DNA was performed using the CDC standardized

laboratory protocol for molecular subtyping of E.coli O157:H7. All reagents were

obtained from Sigma (Sigma Aldrich, St. Louis, MO) unless otherwise specified. Briefly,

Salmonella colonies from freshly inoculated TSA plates (incubated for 18-20 hours) were

suspended in 1 ml of cell suspension buffer (100 mM Tris: 100 mM EDTA, pH 8.0) to

obtain an optical density of 1- 1.4 absorbance units at 610 nm. Two hundred μl of the

above cell suspension, 0.2 mg of proteinase K and 200 μl of 1% molten agarose (Seakem

Gold, Cambrex Bio Science, Rockland, ME) were dispensed into disposable plug molds

(BioRad, Hercules, CA) and allowed to solidify for 10 minutes at 4 °C. The plugs were

lysed in cell lysis buffer (50 mM Tris: 50 mM EDTA, pH 8.0 and 1 % Sarcosyl) with 0.5

60

mg of proteinase K for 2.5 hours at 54 °C in a shaking waterbath and were then washed

twice in preheated water (50 °C) and four times in Tris EDTA buffer (50 °C) at 10

minute intervals. Plug slices of 2 mm width were digested with 50 units each of SpeI and

XbaI (Promega, Madison, WI) separately for two hours. XbaI digested S. Braenderup

H9812 plug slices were used as molecular weight standards. The electrophoresis was

carried out on the CHEF Mapper (BioRad, Hercules, CA) with an initial switch time of

2.16 seconds and final switch time of 63.8 seconds for 18 hours. The running buffer as

well as the buffer used for the gel was 0.5X Tris Boric acid EDTA (TBE)

(Tris 0.04M, Boric acid 0.04M, EDTA, disodium 0.001M). The gel was stained in

ethidium bromide (0.4 mg/ 400 ml of deionized water) for 20 minutes, destined twice for

10 minutes in deionized water for and visualized by using the GelDoc (BioRad, Hercules,

CA). TIFF images were exported into the BioNumerics® program for analysis.

PFGE for Non- Typeable Strains

S. Saintpaul is one of the serotypes that is known to be untypeable by PFGE under

normal conditions. This serotype requires addition of thiourea in the TBE running buffer.

Thiourea neutralizes a nucleolytic peracid derivative of Tris that is formed at the anode

during electrophoresis. S. Saintpaul isolates were typed by the addition of 1600 μl of

10mg/ml thiourea to 2100 ml of the TBE running buffer.

61

Antibiotic Resistance Testing

Antibiotic resistance profiles were determined by using the Sensititre® system (Trek

Diagnostics, Cleveland, OH). All the reagents were provided by the manufacturer. The

Sensititre® system consists of a panel of precision dosed antibiotics at different dilutions

in a 96 well plate and is equivalent to the classic macrobroth dilution method. It provides

an autoread system that utilizes fluorescence technology to detect the bacterial growth

after 18 hours. The technology monitors the activity of specific surface enzymes and

hence the fluorescence substrate generated is directly related to the growth of the test

organism. Resistance to a total of 31 different antibiotics or antimicrobial combinations

was tested using manufacturers’ instructions with two panels comprised of 23 and 16

antibiotics each. Briefly, 1-2 pure colonies of the bacteria were resuspended in a saline

tube to obtain a 0.5 McFarland density. Ten μl of this solution was placed into a Mueller

Hinton broth tube. This mixture was then automatically dispensed in 50 μl aliquots into

the 96 well plate by the machine.

Intraplate reliability testing was done to see if the results vary based on time or day. A

fresh TSA plate was inoculated with a sterile loop touching a colony of the mother plate

of Salmonella enterica serotype Infantis (DuPont # 103) and incubated for 18 hours at 37

°C. Five different reactions were set up using the same plate but touching different

colonies for each. This was done five times using the same incubated plate but with five

different saline and broth tubes. Then the broth tubes were used to automatically

inoculate the 96 well plates consisting of the antibiotics. The same test was repeated

62

twice on two different days using the same colony from the mother plate to inoculate a

fresh plate.

The isolates were tested for various antibiotics including β lactams: ampicillin (Amp),

piperacillin (Pip), ticarcillin (Tic); β-lactam/β-lactamase inhibitor combinations:

amoxicillin/clavulanic acid (Aug), ampicillin/sublactum (A/S), piperacillin/tazobactum

(P/T), ticarcillin/ clavulanic acid (Tim); Aminoglycosides: amikacin (Ami), gentamicin

(G), kanamycin (K), streptomycin (Str), tobramycin (Tob); Cephams: ceftriaxone (Axo),

cephalothin (Cep), cefoxitin (Fox), ceftiofur (Tio), aztreonam (Azt), cefepime (Fep),

cefoperazone (Fop), cefotaxime (Fot), ceftazidime (Taz); Quinolones: nalidixic acid

(Nal); fluoroquinolones: ciprofloxacin (Cip), levofloxacin (Levo), lomefloxacin (Lome);

Others: chloramphenicol (Ch), tetracycline (Tet), trimethoprim/sulfamethaxazole (Cot),

sulfamethoxazole (Smx), sulfizoxazole (Fis), imipenem (Imi). Results were interpreted

according to the National Committee for Clinical Laboratory Standards (NCCLS, 2002)

guidelines. The minimum inhibitory concentration (MIC) values in μg/ml of the isolates

were compared to the NACCLS breakpoints. An isolate was considered to be resistant

(R), intermediately resistant (I) or susceptible (S) based on the NCCLS breakpoints. An

isolate was considered to be multidrug resistant if it was R or I to two or more classes of

antibiotics. E. coli (ATCC 25922) was used for quality control.

63

Dendrogram Construction

Tagged image file format (TIFF) images of PFGE and ribotyping and the MIC values of

antibiotic resistance were analyzed by BioNumerics® software, version 3.0 using the Dice

coefficient. For PFGE, four molecular weight standards were run on each gel for

normalization and bands below 54 kilobases (Kb) were not considered for analysis. For

ribotyping, the data was analyzed in two different ways. In the first method, data

normalized by the RiboPrinter® was exported into the BioNumerics® database. In the

second method TIFF images obtained from the RiboPrinter® were manually analyzed

using the BioNumerics® software. The phylogenetic relationship between isolates was

studied by dendrograms constructed with unweighted pair group method using arithmetic

averages (UPGMA) with 1% position tolerance. Strains that showed 93% or more

similarity were considered identical for PFGE based on cluster analysis of molecular

weight standards from various gels (Figure 3a). For the RiboPrinter®, comparison of

molecular weight standards’ between gels showed 99.99% similarity, therefore strains

showing less than 99.99% similarity were considered different for both automated

normalization as well as the TIFF based manual analysis (Figure 3b).

64

Figure 3. Molecular Weight Standard Analysis Figure 3a.

Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]PFGE Xba-1

100

99989796959493

PFGE Xba-1

Marker1

Marker2

Marker3Marker4

Marker10

Marker11

Marker8Marker7

Marker6

Marker9

Marker5

Analysis of molecular weight standards of PFGE gels digested with XbaI. Eleven

standards analyzed showed 93% similarity.

65

Figure 3b.

Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]Ribotyping-EcoR1

100

Ribotyping-EcoR1

Marker-1 034

Marker-3 034

Marker-1 044Marker-3 044

Marker-1 060

Marker-3 060

Marker-1 071Marker-1 179

Marker-2 179

Marker-3 179

Marker-1 182

Marker-3 182Marker-1 186

Marker-3 186

Marker-1 211

Marker-3 211Marker-1 216

Marker-3 216

Marker-1 225

Marker-3 225Marker-1 229

Marker-3 229

Marker-1 238

Marker-3 238

Marker-1 239Marker-3 239

Marker-1 306

Marker-3 306

Marker-1 311Marker-3 311

Marker-1 321

Marker-3 321

Marker-1 322

Marker-3 322Marker-1 327

Marker-3 327

Marker-3 335Marker-1 367

Marker-3 367

Analysis of molecular weight standards of ribotyping with EcoRI. The standards

analyzed showed 99.99% similarity.

66

Integron PCR

Integrons were amplified using the primers (Table 8) and conditions described by

Levesque et al. (112). The primers are directed to amplify the entire length of the

integron; therefore, the expected product size can be variable. For amplification of

integrase gene (intigene) primers were designed based on previous studies are shown in

Table 8 (212). All the reagents were purchased from TaKaRa Bio Inc. (Otsu, Shiga,

Japan) PCR was performed in 50 μl reaction with 4 μl of 10X PCR buffer, 0.8 μl of

deoxynucleotide triphosphate mix (2.5 mM/μl), 0.6 μl each of forward (18.8 pM/μl) and

reverse primer (18.5 pM/μl), 6 μl of magnesium chloride (25 mM/μl), 35.6 μl of

molecular biology grade water, 0.4 μl of Taq DNA Polymerase and 2 μl of DNA

template. PCR was set up using the hot start method using the Whatman Biometra

thermocycler (Horsham, PA). The initial denaturing was done at 94 °C for 5 minutes

followed by 34 cycles of denaturation (94 o oC, 30 seconds), annealing (55 C for 30

seconds), extension (72 oC for 2 minutes 30 seconds) and a final extension. Twenty μl of

the amplified product was electrophoresed on 1% agarose gel using the Benchtop ladder

(Promega, Madison, WI) as a size standard and stained in ethidium bromide. The stained

gel was visualized using the GelDoc (BioRad, Hercules, CA)

Table 8. Integron Primers

Gene Primer Sequence (5’ to 3’) Reference int Forward GGC ATC CAA GCA GCA AG Levesque et al.int Reverse AAG CAG ACT TGA CCT GA Levesque et al.

intigene Forward GTT CGG TCA AGG TTC TG Zhang et al. intigene Reverse GCC AAC TTT CAG CAC ATG Zhang et al.

67

Sequences of forward and reverse primers for integron (int) and integrase gene (intigene)

PCR.

DNA Sequencing

The amplified product was purified using the QIAquick gel extraction kit (Qiagen,

Valencia, CA) for sequencing using manufacturers’ protocol. Briefly, QG buffer was

added to the fragments of interest that were cut from the agarose gel after PCR. The

sample was incubated for 10 minutes at 50 oC and vortexed. The sample was then placed

in QIAquick spin column and centrifuged at 12,000 X g for 1 minute. The flow- through

was discarded and 500 μl of buffer QG was added and centrifuged for 1 minute. The

filtrate was discarded and 750 μl of PE buffer was added and centrifuged for 1 minute.

The filtrate was discarded and the sample was spun dry for 1 minute. Finally, the DNA

was eluted in 50 μl of molecular biology grade water (preheated to 65 oC). Five

microliters of the eluted DNA was electrophoresed on 0.7% agarose gel for calculating

the concentration of DNA for sequencing. Lambda DNA HindIII marker (Promega,

Madison WI) was used as the molecular weight and concentration standard.

Sequencing was done using the CEQ 8000 (Beckman Coulter, Fullerton, CA) following

the manufacturer’s protocol and reagents. A total of 20 μl sequencing reaction was set up

with 5 μl of the DNA template, 1.5 μl of primer (18.5 pM), 8 μl of DTCS and 5.5 μl of

68

molecular biology grade water. The thermal cycling was carried out for 30 cycles at 96

°C for 20 seconds, 50 °C for 20 seconds and 60 °C for 4 minutes. The DNA was

concentrated by precipitation in 1.5 ml microfuge tubes. Four μl of stop solution (equal

volumes of 1.5 M NaOAc pH 5.2 and 50 mM EDTA pH 8.0) and 1 μl of glycogen (20

mg/ml) was added to the cycle sequencing product. Sixty μl of cold 95% ethanol was

added and mixed well. The sample was then centrifuged at 12,000 X g at 4 °C for 15

minutes. The supernatant was then carefully removed without disturbing the pellet. The

pellet was then washed twice in 200 μl of cold 70% ethanol by centrifuging at 12,000 X g

for 10 minutes. The sample was then dried using the DNA 110 SpeedVac (Thermo

Savant, Holbrook, NY) for 10 minutes. The sample was resuspended in 40 μl of sample

loading solution and transferred to the 96 well sequencing plate. One drop of mineral oil

was added to each well and then the plate was loaded onto the sequencer. The results

were analyzed using the Lasergene software, version 5.6 (DNAstar Inc., Madison, WI)

and compared with the National Center for Biotechnology Information database

(http://www.ncbi.nlm.nih.gov/BLAST/).

Plasmid Extraction

Plasmids were extracted using the Qiagen plasmid midi kit (Qiagen, Valencia, CA). The

isolates were first grown on TSA plates and then an isolated colony was inoculated in 25

ml TSB broth. The 25 ml culture was pelleted down and the pellet was resuspended in 4

ml of buffer P1 and vortexed. Then, 4 ml of buffer P2 was added and mixed gently and

69

incubated for 5 minutes at room temperature. Buffer P3 was then added and mixed gently

and incubated on ice for 20 minutes. The sample was then centrifuged at 10,000 X g for

30 minutes. The supernatant was filtered through a pre wet paper towel to eliminate extra

debris. Four milliliters of buffer QBT was allowed to flow through the spin column to

equilibrate the column. The supernatant was then placed in the spin column and allowed

to flow through. The DNA in the column was washed twice with buffer QC. The DNA

was then eluted in a fresh tube with 5 ml of preheated (50 0C) buffer QF. The DNA was

then precipitated by adding 3.5 ml of isopropanol and centrifuged for 30 minutes at

10,000 X g. The supernatant was discarded and the pellet was washed twice with 70%

ethanol. The pellet was air dried and resuspended in 50 μl of TE buffer. Five microliters

of the plasmid prep was electrophoresed on a 0.7% agarose gel.

Membrane Transfer

DNA was fractionated according to the PFGE protocol. The gel was soaked in several

volumes of depurination solution (0.2 N hydrochloric acid) for 15 minutes. The gel was

then soaked in denaturation solution (1.5 M sodium chloride. 0.5 N sodium hydroxide)

for 20 minutes. The gel was rinsed in deionized water and then soaked in neutralization

solution (1 M Tris pH 7.4, 1.5 M sodium chloride) for 30 minutes. The gel was again

soaked in neutralization solution for an additional 15 minutes and the DNA was

transferred from the gel to the membrane by capillary action. Briefly, a plexiglass

container was wrapped in Whatmann 3 MM paper and placed in a large baking dish. The

dish was filled with transfer buffer (10X SSC; 175.3 gm sodium chloride, 88.2 gm

70

sodium acetate per L of deionized water, pH 7.0). The gel was inverted and placed on the

plexiglass support; a pre wet membrane (Roche Applied Sciences, Indianapolis, IN) was

cut similar to the dimensions of the gel was placed on the gel. Two Whatmann filter

papers were cut to match the gel size and placed on the membrane. The baking dish was

filled with more transfer buffer and paper towels were stacked on the arrangement.

Finally, a weight of about 500 gm was placed on this and the DNA was allowed to

transfer for 48 hours. The arrangement was then disassembled and the DNA was

crosslinked on the membrane using the UV Strata Linker® (Spectronics Corporation).

Hybridization of Southern Blots

The primers used to make the probe for Southern blotting are listed in Table 5. Probe

bound to DNA fragments was detected by chemiluminescence. The probes were designed

for variety of virulence and antibiotic resistance genes based on the Salmonella

Typhimurium LT2 genome. sitA and sitB are iron transporter genes and are important

virulence factors . phoP and phoQ are part of two component regulatory system. invA is

the gene encoding the invasion protein and magA is the putative magnesium transporter.

fecA encodes an iron carrier protein in Shigella flexneri that is present on a pathogenicity

island and is associated with multiple antibiotic resistance genes. ampC and ampH

encode penicillin binding proteins conferring resistance to β- lactams. blaSHV and tem1

encode resistance toβ- lactams. aadA2 is aminoglycoside resistance gene; tetR is the gene

conferring resistance to tetracycline. sul1, dfr1 and cat genes confer resistance to

sulfonamides, trimethoprim and chloramphenicol respectively. All the reagents were

71

purchased from Roche (Roche Applied Sciences, Indianapolis, IN) except for the primers

and SSC solution. Primers were labeled using the digoxygenin (DIG) 3’ oligonucleotide

tailing 2nd generation kit using the manufacturer’s protocol to make the hybridization

probe. Briefly, 1 μl (100 pmol/ μl) of the forward or reverse primer shown in Table 9 was

added to 8 μl of molecular biology grade water. This solution was then mixed with 4 μl

of reaction buffer, 4 μl of cobalt chloride solution, 1 μl of DUG-dUTP solution, 1 μl of

dATP solution and 1 μl of U terminal transferase. The sample was then mixed well and

centrifuged briefly. The solution was then incubated for 15 minutes at 37 °C and placed

on ice for 5 minutes. Finally 2 μl of 0.2 M EDTA was added to stop the reaction. The

labeled probe was then added to 25 ml of hybridization solution. This probe was stored at

–20 °C prior to use. Hybridization was carried out using the CDP Star kit. The

membrane was prehybridized in the pre heated DIG Easy Hyb solution for 1 hour at 35

°C in a hybridization oven (VWR international, West Chester, PA). This was replaced

with preheated hybridization solution containing the probe. The membrane was allowed

to hybridize for 18 hours at 35 °C. The blot was then washed twice for 5 minutes each in

2X SSC and 0.5X SSC at appropriate temperature (5 °C less than melting temperature of

the primer). The blot was then washed on a rocker in 100 ml of washing buffer for 15

minutes followed by blocking for 1 hour in 10% blocking buffer. The blot was then

incubated in 20 ml of antibody solution (1 μl of anti-digoxigenin-AP Fab fragments in 20

ml of blocking buffer) for 30 minutes. The blot was then washed in washing buffer twice

for 15 minutes each. The membrane was then equilibrated in 20 ml of detection buffer for

5 minutes. Finally, 2 ml of CDP star working solution was spread onto the membrane and

72

covered with transparency. The blot was then visualized in the ChemiDoc (BioRad,

Hercules, CA) with appropriate exposure time. The membrane was then stripped by

rinsing twice in 1X stripping solution (10X stock; 2M sodium hydroxide, 1% sodium

didocyl sulfate). The stripped membrane was viewed in the ChemiDoc to make sure there

was no signal. The stripped membrane was reused 2-3 times. Table 9. Probes for Southern Hybridization

Gene Primer Sequence (5’ to 3’) Reference/Gene id

fecA Forward GTT GTC GTC ATA AGA GCG G Luck et al. fecA Reverse GCT CCC ATT TCG CTC GGC Luck et al. sitA Forward GTC AGC TCG ATT ACC AAA CC STM2861* sitA Reverse CGC CGA TCA GCG CTG GTT STM2861* sitB Forward GGT TCA ATC GCC GCG CTG STM2862 * sitB Reverse GAG CTG TCC GGC GGG CA STM2862*

phoP Forward GGT CTG CCG GAT GAA GAC G STM1231* phoP Reverse GTT CTC ATG GGG CGT CTG C STM1231* phoQ Forward GAC GCA GCG CAA CAT TCC STM1230 * phoQ Reverse CGC GAG CTT GAA GAT CAT C STM1230* magA Forward GCT GGC GTC GCG CGA TC STM3763 * magA Reverse CGG CGC GAT GGA TGT GCT STM3763* invA Forward GCG GAT GCC GCG CGC G STM2896* invA Reverse GGC GTG CGC CTG CCG G STM2896*

ampC Forward TGG GGC TAT GCG GAC A 948669 ampC Reverse ACG CCT GGG GAT ATC G 948669 ampH Forward GCG CGC ATG TCC CGA 1246887 ampH Reverse GCG GCG GAG TCT ATT C 1246887

blaSHV Forward CA CGCTGACCGCCTG 1446571 blaSHV Reverse GGTG GACGATCGGG TC 1446571

tem1 Forward TCC CGT GTT GAC GCC G 2716540 tem1 Reverse AGC CCT CCC GTA TCG TA 2716540

aadA2 Forward CGA GCA TTG CTC AAT GAC 1450505 aadA2 Reverse GGC CTC ACG CGC AGA 1450505 tetR Forward GGT GTA GAG CAG CCT AC 1446691 TetR Reverse GCA CTC AGC GCT GTG G 1446691 Sul1 Forward GCC GGC CGA TGA GAT 1263138 Sul1 Reverse TCT CGG TGT CGC GGA 1263138 Dfr1 Forward CTG CCT TGG CAT TTG CC 933011 Dfr1 Reverse CCT ATT TCC CTG AAG AGC 933011 cat Forward GGC ATT TCA GTC AGT TGC 1251342 cat Reverse AAG GCG ACA AGG TGC TG 1251342

73

Probes designed for various virulence and antibiotic resistance genes based on The

Institute for Genomic Research (TIGR) or National Center for Biotechnology

Information (NCBI) database. The gene id number is depicted; * indicates that the

primers were designed using TIGR website. fecA probe was designed based on Luck et

al. (127)

Southern Blotting with 1.0 Kb Integron Fragment

For the detection of integrons in the PFGE gels in order to see the location of the

antibiotic resistance determinants in relation to pathogenicity island genes Southern

hybridization using the High Prime DNA Labeling and Detection Starter Kit II (Roche

Applied Sciences, Indianapolis, IN) was used. The protocol is essentially similar to the

above described DIG oligonucleotide tailing kit except that pure DNA extracted by using

the QIA Quick kit after cutting the integron band was used as a probe. Approximately 1

μg of template DNA was denatured by boiling for 10 minutes and chilled briefly on ice.

Four microliters of DIG high prime solution was added to the above sample was

incubated for 1 hour at 37 °C. The reaction was stopped by adding 2 μl of 0.2 M EDTA

and heated at 65 °C. The sample was added to 25 ml of pre hybridization solution (Roche

Applied Sciences, Indianapolis, IN) and stored at –30 °C before use. The hybridization

was carried exactly as described above with minor variations. After the hybridization, the

membranes were washed twice with 2 X SSC solution at 28 °C and twice with 0.5 X SSC

solution at 68 °C.

74

Dot Blots for Southern Hybridization Dot blots were prepared to be as controls for the Southern hybridization. Approximately,

2 μg of DNA was placed on a small piece of membrane (Roche Applied Sciences,

Indianapolis, IN) and allowed to dry for 10 minutes at room temperature. After 10

minutes, 2 μg of template was added again on the membrane and allowed to dry for one

hour. Both the positive control (CBD 746, S. Typhimurium) and negative control (CBD

554, Proteus mirabilis) were placed on the two corners of the membrane as shown in

Figure 4.

Figure 4. Dot Blots

+ Control - Control

Preparation of dot blots for positive and negative control. S. Typhimurium (CBD 746)

was used as a positive control and Proteus mirabilis (CBD 554) was used as a negative

control for integron and Salmonella virulence gene testing

Whatman filter papers were cut to fit the size of the dot blots and placed in three trays.

The filter paper was soaked with NaOH (0. 5M) in tray #1, Tris (1 M) in tray #2 and Tris

(1 M) with NaCl (1.5 M) in tray #3. The dot blot membranes were then placed on each

tray #1 for 10 minutes, tray #2 for three minutes and tray #3 for 10 minutes and allowed

to dry and were crosslinked in the Stratalinker and visualized using the Chemidoc.

75

Chapter Three – Results

Primer and Probe Testing of Salmonella species by Real Time PCR

Three primers and probes targeting the genes sopB, spvA and ompF were tested on the

DNA extracted from pure culture obtained from the 114 isolates listed in Table 5. A

mean CT value of 40 or more was considered negative; the results were also analyzed

based on the amplification plot generated for each well. An example of the amplification

plot produced by the system is given in Figure 5. A well defined peak showing a plateau

stage represents a positive reaction whereas a scattered and disorganized plot depicts the

absence of amplification. In the Figure 5, wells A3, A4; A5, A6 and A7 with Salmonella

species were positive whereas the negative controls including a no template control, E.

coli, Bacillus cereus, Shigella sonnei and Listeria monocytogenes did not produce a

curve.

Figure 5. Real Time PCR

Amplification plot showing the CT value or the cycle number at which the fluorescence

of the reaction crosses the threshold. A well-defined peak indicates that that the reaction

76

is positive, whereas smaller peaks indicate no reaction. The sample lanes and the graph

are color-coded. A1, A2-no template control, A3, A4-Salmonella Pullorum, A5, A6-

Salmonella spp., A7, A8-Salmonella spp. A9, A10-Shigella sonnei, A11, A12-E.coli, B1,

B2-E.coli, B3, B4-E.coli, B5, B6-E.coli, B7, B8-Bacillus cereus, B9, B10-Listeria

monocytogenes

Table 10 represents the CT values of the isolates for the three primers sets. All the isolates

belonging to Salmonella enterica subspecies I were positive for the sopB gene, whereas

only three out of seven isolates belonging to subspecies III and IV possessed the sopB

gene. The spvA reaction was positive for only four serotypes of subspecies I including

Pullorum, Choleraesuis, Typhimurium and Enteritidis. The spvA locus was also seen in

some of the isolates belonging to subspecies III and IV. Overall, four out of six S.

Enteritidis isolates, 13/16 S. Typhimurium isolates and four out of eight isolates

belonging to subspecies III and IV were positive for the spvA gene. The ompF gene was

detected in all of the 114 Salmonella isolates belonging to all of the three subspecies I, III

and IV tested. The negative controls including E. coli, Shigella sonnei, Listeria

monocytogenes, Proteus mirabilis, Citrobacter fruendii and Bacillus cereus were

negative for all the three primer sets.

77

78

Table 10. Real Time PCR Results

sopB gene spvA gene ompF gene CBD # Genus Name Serotype/Subspecies Source CBD 0020 Salmonella Infantis ATCC +,16.06 -,40 +,19.2 CBD 0024 Salmonella Enteritidis ATCC +,17.01 +,18.79 +,18.7 CBD 0025 Salmonella Choleraesuis ATCC +,15.31 +,14.59 +,17.8

-,40 +,17.88 +,18.0 CBD 0026 arizonae, subspeciesIIIATCC Salmonella CBD 0027 Salmonella Pullorum ATCC +,16.47 +,19.57 +,20.4 CBD 0028 Salmonella Typhimurium ATCC +,15.35 +,17.30 +,18.6 CBD 0030 Salmonella Newport ATCC +,18.82 -,40 +,18.5 CBD 0031 Salmonella Derby ATCC +,16.47 -,40 +,17.1 CBD 0032 Salmonella Nima FLDOH +,17.4 -,40 +,18.4 CBD 0033 Salmonella Aberdeen FLDOH +,15.34 -,40 +,17.9 CBD 0067 Salmonella Newport FLDOH +,16.11 -,40 +,17.4 CBD 0069 Salmonella Javiana FLDOH +,15.89 -,40 +,21.9 CBD 0213 Salmonella Newport FLDOH +,15.2 -,40 +,17.10 CBD 0222 Salmonella Javiana FLDOH +,14.5 -,40 +,22.8 CBD 0236 Salmonella Typhimurium CDC +,17.34 +,17.54 +,16.45 CBD 0321 Salmonella Braenderup CDC +,16.92 -,40 +,16.9

-,40 +,17.32 +,17.34 CBD 0387 arizonae, subspeciesIIICDC Salmonella +,18.53 -,40 +,16.73 CBD 0425 Newport WADOHSalmonella +,16.74 -,40 +,16.04 CBD 0426 Newport WADOHSalmonella +,16.82 -,40 +,16.63 CBD 0427 Newport WADOHSalmonella +,18.34 -,40 +,15.96 CBD 0428 Newport WADOHSalmonella +,19.6 -,40 +,16.05 CBD 0429 Oranienburg WADOHSalmonella +,18.0 -,40 +,16.14 CBD 0430 Apapa WADOHSalmonella +,16.6 -,40 +,16.34 CBD 0431 Saintpaul WADOHSalmonella +,27.99 -,40 +,16.03 CBD 0432 arizonae, subspeciesIII WADOHSalmonella -,40 +,17.7 +,20.56 CBD 0433 arizonae. subspeciesIIIWADOHSalmonella

79

sopB gene spvA gene ompF gene CBD # Genus Name Serotype/Subspecies Source +,22.2 -,40 +,17.84 CBD 0434 Brandenburg WADOHSalmonella +,18.18 -,40 +,16.38 CBD 0435 Westhampton WADOHSalmonella +,24.1 -,40 +,25.22 CBD 0436 Paratyphi A WADOHSalmonella +,17.47 -,40 +,17.9 CBD 0437 Saintpaul WADOHSalmonella +,15.60 +,17.72 +,16.7 CBD 0438 Typhimurium WADOHSalmonella +,17.71 +,18.95 +,17.12 CBD 0439 Enteritidis WADOHSalmonella +,16.47 -,40 +,17.09 CBD 0440 Muenchen WADOHSalmonella +,14.98 -,40 +,18.51 CBD 0441 Muenchen WADOHSalmonella +,17.03 -,40 +,15.69 CBD 0442 Muenchen WADOHSalmonella +,18.34 -,40 +,18.19 CBD 0443 Hildgo WADOHSalmonella +,16.87 -,40 +,18.02 CBD 0444 Alamo WADOHSalmonella +,16.39 -,40 +,19.46 CBD 0445 Javiana WADOHSalmonella +,15.4 +,16.94 +,17.09 CBD 0446 Typhimurium WADOHSalmonella

CBD 0569 Salmonella Alachua Turkey +,15.82 -,40 +,17.54 CBD 0570 Salmonella Anatum Turkey +,16.30 -,40 +,18.01 CBD 0571 Salmonella Newport Turkey +,15.29 -,40 +,17.48 CBD 0572 Salmonella Newport Turkey +,15.73 -,40 +,16.38 CBD 0573 Salmonella Istanbul Turkey +,17.31 -,40 +,16.68 CBD 0574 Salmonella Istanbul Turkey +,15.30 -,40 +,17.38 CBD 0575 Salmonella Istanbul Turkey +,17.11 -,40 +,16.40 CBD 0576 Salmonella Kentucky Turkey +,17.29 -,40 +,17.03 CBD 0577 Salmonella Kentucky Turkey +,17.63 -,40 +,17.10 CBD 0578 Salmonella Mbandaka Turkey +,17.06 -,40 +,16.61 CBD 0579 Salmonella Montevideo Turkey +,17.84 -,40 +,16.34 CBD 0580 Salmonella Muenster Turkey +,16.41 -,40 +,15.58 CBD 0581 Salmonella Muenster Turkey +,16.87 -,40 +,15.99 CBD 0582 Salmonella Reading Turkey +,16.95 -,40 +,27.96 CBD 0583 Salmonella Reading Turkey +,17.12 -,40 +,17.27

80

sopB gene spvA gene ompF gene CBD # Genus Name Serotype/Subspecies Source CBD 0584 Salmonella Newport Turkey +,17.05 -,40 +,16.13 CBD 0585 Salmonella Newport Turkey +,17.19 -,40 +,16.68 CBD 0586 Salmonella Newport Turkey +,16.85 -,40 +,16.60 CBD 0587 Salmonella Newport Turkey +,16.67 -,40 +,16.70 CBD 0588 Salmonella Newport Turkey +,17.21 -,40 +,16.33 CBD 0589 Salmonella Newport Turkey +,16.90 -,40 +,16.77 CBD 0590 Salmonella Newport Turkey +,16.52 -,40 +,16.87 CBD 0591 Salmonella Newport Turkey +,16.88 -,40 +,16.79 CBD 0592 Salmonella Newport Turkey +,15.92 -,40 +,17.3 CBD 0593 Salmonella Newport Turkey +,16.17 -,40 +,16.96 CBD 0594 Salmonella Newport Turkey +,17.28 -,40 +,17.98 CBD 0595 Salmonella Newport Turkey +,15.96 -,40 +,18.23 CBD 0596 Salmonella Newport Turkey +,14.64 -,40 +,18.97 CBD 0597 Salmonella Newport Turkey +,16.00 -,40 +,18.19 CBD 0598 Salmonella Newport Turkey +,14.61 -,40 +,19.76 CBD 0599 Salmonella Typhimurium CDC +,16.15 +,16.90 +,18.39 CBD 0600 Salmonella Typhimurium CDC +,15.98 -,40 +,16.2 CBD 0603 Salmonella Javiana FLDOH +,15.33 -,40 +,22.15 CBD 0604 Salmonella Newport FLDOH +,15.32 -,37.95 +,17.34 CBD 0746 Salmonella Typhimurium FLDOH +,15.62 +,16.07 +,17.98

-,40 -,40 +,16.92 CBD 0747 FLDOH Salmonella IV 50:z4,z23:-- CBD 0757 Salmonella Typhimurium FLDOH +,15.48 +,17.20 +,16.85 CBD 0759 Salmonella Newport FLDOH +,14.89 -,40 +,15.90 CBD 0775 Salmonella Typhimurium FLDOH +,15.79 +,17.26 +,16.78 CBD 0776 Salmonella Sandiego FLDOH +,16.15 -,40 +,16.13 CBD 0777 Salmonella Typhimurium FLDOH +,15.72 +,16.92 +,16.88 CBD 0778 Salmonella Typhimurium FLDOH +,16.31 +,17.57 +,17.13 CBD 0779 Salmonella Enteritidis FLDOH +,15.41 +,17.01 +,16.24

81

sopB gene spvA gene ompF gene CBD # Genus Name Serotype/Subspecies Source +,35.5 -,40 +,16.45 CBD 0780 FLDOH Salmonella IV 50:z4,z23:--

CBD 0781 Salmonella Enteritidis FLDOH +,15.73 -,40 +,16.57 CBD 0782 Salmonella Stanley FLDOH +,15.89 -,37.81 +,16.99 CBD 0805 Salmonella Berta FLDOH +,16.28 -,40 +,16.47 CBD 0806 Salmonella Species FLDOH +,16.17 -,40 +,16.87 CBD 0807 Salmonella Javiana FLDOH +,15.70 -,40 +,20.12 CBD 0808 Salmonella Muenchen FLDOH +,16.53 -,40 +,17.33 CBD 0809 Salmonella Muenchen FLDOH +,16.14 -,40 +,18.36 CBD 0810 Salmonella Heildelberg FLDOH +,16.25 -,40 +,17.13

+,15.73 +,14.95 +,15.99 CBD 0811 FLDOH Salmonella I 4,12:i:-- CBD 0813 Salmonella Javiana FLDOH +,16.32 -,40 +,21.95 CBD 0814 Salmonella Anatum FLDOH +,16.04 -,40 +,16.52 CBD 0815 Salmonella Newport FLDOH +,16.67 -,40 +,17.15 CBD 0816 Salmonella Typhimurium FLDOH +,16.16 +,16.63 +,17.05 CBD 0817 Salmonella Typhimurium FLDOH +,16.51 +,16.34 +,16.83 CBD 0818 Salmonella Enteritidis FLDOH +,15.63 +,14.85 +,15.88 CBD 0819 Salmonella Javiana FLDOH +,18.58 -,40 +,20.33 CBD 0820 Salmonella Typhimurium FLDOH +,16.93 -,40 +,17.24 CBD 0821 Salmonella Sandiego FLDOH +,19.72 -,40 +,16.31 CBD 0822 Salmonella Species FLDOH +,17.5 -,40 +,17.08 CBD 0823 Salmonella Typhimurium FLDOH +,19.41 +,20.54 +,16.89 CBD 0824 Salmonella Tallahasse FLDOH +,19.34 -,40 +,16.56

+,20.05 -,40 +,16.99 CBD 0825 Paratyphi A FLDOH Salmonella CBD 0826 Salmonella Javiana FLDOH +,19.2 -,40 +,20.61 CBD 0827 Salmonella Newport FLDOH +,17.46 -,40 +,16.49 CBD 0828 Salmonella Typhimurium FLDOH +,16.68 -,40 +,16.66 CBD 0829 Salmonella Newport FLDOH +,17.36 -,40 +,18.18 CBD 0830 Salmonella Javiana FLDOH +,17.44 -,40 +,22.90

82

83

CBD # Genus Name Serotype/Subspecies Source sopB gene spvA gene ompF gene CBD 0831 Salmonella Muenchen FLDOH +,17.46 -,40 +,17.24 CBD 0832 Salmonella Enteritidis FLDOH +,17.13 +,22.62 +,18.13 CBD 0833 Salmonella IV 50:z4,z23 :- FLDOH +,35.15 -,40 +,17.56 CBD 0052 Escherichia Coli ATCC -,40 -,40 -,40 CBD 0553 Citrobacter Freundii ATCC -,40 -,40 -,40 CBD 0554 Proteus Mirabilis ATCC -,40 -,40 -,40 CBD 0006 Bacillus Cereus ATCC -,40 -,40 -,40 CBD 0009 Listeria Monocytogenes ATCC -,40 -,40 -,40 CBD 0002 Shigella Sonnei ATCC -,40 -,40 -,40 Mean CT values from two reactions of the isolates tested for the three primers targeting the genes, Salmonella outer protein

(sopB), Salmonella virulence plasmid (spvA) and outer membrane porin (ompF). The serotype names and sources are

indicated. – Indicates a negative reaction and + indicates a positive PCR reaction. Dark gray cells for sopB and ompF genes

specify a negative reaction; light gray cells for spvA gene indicate a positive reaction.

Detection and Isolation of Salmonella species from Artificially Contaminated Food Samples

Detection of Salmonella species

Eight ready to eat food groups shown in Table 7 were artificially seeded with low spike

(1-10 CFU of S. Typhimurium or S. Enteritidis) or mixed spiked (1-10 CFU of

Salmonella species along with 5-200 CFU E. coli, Proteus mirabilis and Citrobacter

freundii) as shown in Figure 2. The DNA was extracted after enrichment in BPW and

BPW + TT broths and tested using real time PCR with primers targeting the ompF gene.

The consolidated results of the PCR for the low spiked foods are shown in Table 11 and

Figure 6 and the raw data is given in the Appendix (Table A1). For sushi, mayonnaise

and orange juice enrichment in BPW resulted in 100% positive results, whereas for

hamburger and chicken cuts further enrichment in TT broth provided 100% positive

results. None of the enrichments were 100% successful for egg salad or cheese. None of

the unspiked food samples gave a positive signal. Overall, 19/25 reactions were positive

after BPW enrichment and 18/25 were positive after BPW and TT broth enrichment

showing that further enrichment in TT broth did not provide any significantly additional

benefit for the detection of Salmonella species by real time PCR (P=0.5).

84

Table 11. Real time PCR Results-Low Spiked

No. Of positive

Reactions Food (Low Spike) No. Of ReactionsBroth BPW 2 Chicken Cuts 3 BPW+TT 3 BPW 3 Egg Salad 4 BPW+TT 3 BPW 2 Hamburger Meat 3 BPW+TT 3 BPW 3 Sushi 3 BPW+TT 2 BPW 2 Cheese 5 BPW+TT 3 BPW 3 Mayo 3 BPW+TT 1 BPW 3 Orange Juice 3 BPW+TT 2 BPW 1 Blueberries 1 BPW+TT 1

Real time PCR results of food samples artificially inoculated with 1-10 CFU of S.

Enteritidis or S. Typhimurium. The total number of experiments carried out and the

number of positive reactions are shown. BPW= 6 h enrichment in buffered peptone

water, BPW+TT= 6 h enrichment in BPW and 4 h enrichment in tetrathionate broth

85

Figure 6. Real time PCR Results-Low Spiked P e r c e nt a ge of P osi t i v e Re a c t i ons f or Low S pi k e

67%

100%

75% 75%67%

100% 100%

67%

40%

60%

100%

33%

100%

67%

100% 100%

3 4 3 3 5 3 3 1

Chi c k e n Cut s Egg S a l a d Ha mbur ge rM e a t

S ushi Che e se M a y o Or a nge J ui c e B l ue be r r i e s

BP W

BP W+T

Real time PCR results of food samples artificially inoculated with 1-10 CFU of S.

Enteritidis or S. Typhimurium. The total number of experiments performed is shown on

the X-axis and the percentage of positive reactions is indicated on the top of the bars for

each food group. BPW= 6 h enrichment in buffered peptone water, BPW+TT= 6 h

enrichment in BPW and 4 h enrichment in tetrathionate broth

The results for the mixed spiked food samples are represented in Table 12 and Figure 7.

Enrichment with BPW as well BPW and TT broths gave 100% positive results for foods

including chicken cuts, blueberries and hamburger. BPW and TT enrichment was better

than BPW for egg salad and BPW was slightly better than BPW and TT enrichment for

the foods including cheese and mayonnaise. Only one test was carried out on the mixed

spiked sample of sushi, and it did not provide a positive result. On the whole, 15/20

86

(75%) reactions were positive with BPW enrichment and 13/30 (65%) reactions were

positive when the samples were further enriched in TT broth. These results again

demonstrate that further enrichment in TT broth did not significantly increase the

sensitivity (P=0.4)

Table 12. Real time PCR Results-Mixed Spiked

Food (Mixed Spike) No. Of Reactions Broth No. Of +Ve Reactions BPW 2 Chicken Cuts 2 BPW+TT 2 BPW 1 Egg Salad 2 BPW+TT 2 BPW 3 Hamburger Meat 3 BPW+TT 3 BPW 0 Sushi 1 BPW+TT 0 BPW 4 Cheese 5 BPW+TT 2 BPW 2 Mayo 3 BPW+TT 1 BPW 2 Orange Juice 3 BPW+TT 2 BPW 1 Blueberries 1 BPW+TT 1

Real time PCR results of food samples artificially inoculated with 1-10 CFU of S.

Enteritidis or S. Typhimurium along with E. coli, Proteus mirabilis and Citrobacter

freundii. The total number of experiments carried out and the number of positive

reactions are shown. BPW= 6 h enrichment in buffered peptone water, BPW+TT= 6 h

enrichment in BPW and 4 h enrichment in tetrathionate broth.

87

Figure 7. Real time PCR Results-Mixed Spiked P e r c e nt a ge of P osi t i v e Re a c t i ons f or M i x e d S pi k e

100% 100%

50%

100% 100% 100%

0% 0%

80%

40%

67%

33%

67% 67%

100% 100%

2 2 3 1 5 3 3 1

Chi c k e n Cut s Egg S a l a d Ha mbur ge rM e a t

S ushi Che e se M a y o Or a nge J ui c e B l ue be r r i e s

BP W

BP W+T

Detection results of food samples mixed spiked with 1-10 CFU of S. Enteritidis or S.

Typhimurium along with E. coli, Proteus mirabilis and Citrobacter freundii. The total

number of experiments performed is shown on the X-axis and the percentage of positive

reactions is indicated on the top of the bars for each food group. BPW= 6 h enrichment in

buffered peptone water, BPW+TT= 6 h enrichment in BPW and 4 h enrichment in

tetrathionate broth

88

Isolation of Salmonella species

Ready to eat foods that were artificially seeded with Salmonella species were subjected to

general enrichment in BPW and selective enrichment as shown in Figure 2. The

purification or selective enrichment was carried out by IMS and TT broth respectively to

compare the two techniques. The foods were low spiked, mixed spiked or unspiked and

enriched in BPW, BPW+IMS and BPW+TT. One hundred μl of BPW and BPW+TT

enriched samples were inoculated in both XLD and TSA plates. For the BPW+IMS

technique, 50 μl of the final product was plated onto TSA and XLD agar plates. The

mean results of repeat isolation experiments are represented in Table 13 and the raw data,

including each spiking amount and isolation results is shown in the appendix (Table A1).

The colony count on the XLD agar was used for analysis. To compensate for the

difference in the final amounts of BPW+IMS (50 μl) and the two broths (100 μl) plated

on the XLD agar, half the number of colonies isolated after enriching in BPW and

BPW+TT broth were considered for analysis.

Figure 8a shows an example of isolation of Salmonella from unspiked, low spiked and

mixed spiked foods after BPW+IMS enrichment. The negative control, which was

unspiked, had very little background flora on TSA agar and almost none on the XLD

agar. The low spiked XLD plate predominantly showed the presence of Salmonella

species, whereas the mixed spiked had few colonies, possibly E. coli or Citrobacter

freundii. The black colonies of Salmonella species were easily distinguishable from the

89

yellowish ones on the XLD plate. A comparison of the three isolation techniques, after

general enrichment in BPW and selective enrichments in TT broth and IMS is depicted in

Figure 8b. No colonies were seen in the unspiked chicken cuts using any of the three

enrichments on the XLD plates. The low spiked food samples had colonies using the

three enrichment techniques. The highest number of Salmonella was seen in the mixed

spiked sample using the IMS technique with no E. coli or Citrobacter contamination.

However, possible E. coli and Citrobacter species were seen in the mixed spiked samples

after the BPW enrichment as well as the BPW+TT enrichment. This data suggests that

IMS technique might offer a cleaner sample of Salmonella species in mixed cultures

compared to TT broth.

Figure 8. Isolation of Salmonella on Selective Plates Figure 8a

Unspiked Low Spiked Mixed Spiked

90

Isolation results of unspiked, low spiked (1-10, Salmonella species) and mixed spiked

(Salmonella species with E. coli, Citrobacter and Proteus) from chicken cuts, after

selective enrichment in buffered peptone water and immunomagnetic separation on

trypticase soy agar and xylose lysine desoxycholate (XLD) agar. Black colonies on XLD

agar represent Salmonella species; yellow colonies are possible E. coli or Citrobacter

species.

Figure 8b

Unspiked

Low spiked

Mixed spiked

BPW BPW+IMS BPW+TT

Isolation of Salmonella species from low spiked and mixed spiked chicken cuts with

Buffered Peptone Water (BPW), immunomagnetic separation (BPW+IMS) and

91

tetrathionate broth (BPW+TT) enrichments on xylose lysine desoxycholate (XLD) agar.

Black colonies represent Salmonella species.

Table 13 and Figure 9 show the mean data of repeat tests for the isolation of Salmonella

species from low and mixed foods after six hour general enrichment and selective

enrichments. The raw data with results from each experiment is in the Appendix (Table

A1). The unspiked samples were consistantly negative for Salmonella and therefore are

not shown in the table or the graph. The number of colonies isolated after selective

enrichment in IMS was greater than the general enrichment in BPW for all the low spiked

food samples except cheese. However, further enrichment in TT broth for four hours did

not improve isolation over the general enrichment for most of the low spiked foods. For

cheese, all the rapid enrichment techniques provided poor recovery. An overnight

incubation in BPW was required for cheese to obtain any growth on the plates. Overall,

isolation by BPW+IMS was significantly better than BPW (P=0.02) and BPW+TT

(P=0.01) for the food samples that were spiked with low levels of Salmonella.

Enrichment in BPW provided better recovery compared to BPW+TT (P=0.03) for the

low spiked samples. The isolation data for low spiked food clearly shows that BPW+IMS

is the best technique compared to the general enrichment in BPW or the selective TT

broth enrichment.

92

For mixed spiked food samples, again for most food types, BPW+IMS was better than

the other two methods. For foods including chicken cuts, egg salad and mayonnaise BPW

provided better recovery than BPW+TT and the converse is true for the other foods.

Although BPW+IMS technique facilitated the isolation of more Salmonella colonies

compared to BPW+TT, the difference between the two techniques for mixed spiked food

samples is not significantly different (P=0.95). However, isolation results of BPW+IMS

are significantly different compared to BPW enrichment (P=0.01). On the whole, it is not

surprising that both BPW+IMS and BPW+TT improved the isolation of Salmonella

species from mixed cultures compared to the general enrichment. In general BPW+IMS

is the best technique for both the low and the mixed spiked food groups.

93

Table 13. Isolation of Salmonella from 25 gm of Spiked Food

Food(25gm) SampleBackground

(CFU/gm)Mean CFU

BPWMean CFU BPW+IMS

Mean CFU BPW+TT

# of Expts.

Low Spiked 15 30 170 8 3Mixed Spiked 66 230 28 2Low Spiked 500 28 80 9.5 3Mixed Spiked 45 99 20.5 2Low Spiked 5050 46.5 227 21 3Mixed Spiked 68 165 102 3Low Spiked 100 22.5 28 14 3Mixed Spiked 9 5 22.5 1Low Spiked 420 15.5 98 21.5 5Mixed Spiked 6.5 79 86 2Low Spiked 2550 0.1 0 0 4Mixed Spiked 0 2 0Low Spiked 2550 TNTC TNTC TNTC 1Mixed Spiked 0 31 TNTCLow Spiked <10 58 115 25.5 3Mixed Spiked 92 255 83.5 3Low Spiked 0 6.5 39 4.5 3Mixed Spiked 9.5 21 10.5 3

Orange Juice

Blueberries

Cheese

Cheese O/N

Mayonnaise

Chicken Cuts

Egg Salad

Hamburger

Sushi

4

1

Isolation of Salmonella from 25 gm of food samples low spiked or mixed spiked and

enriched in buffered peptone water (BPW), BPW+IMS (immunomagnetic separation) or

BPW+TT (tetrathionate broth). The background flora of each food group is indicated.

The mean colony count on xylose lysine desoxycholate (XLD) agar from repeat tests is

shown. TNTC=too numerous to count.

94

Figure 9. Isolation of Salmonella from 25 gm of spiked food

Food Isolation

0

50

100

150

200

250

300

350

400

450

500

Low

Spi

ked

Mix

ed S

pike

d

Low

Spi

ked

Mix

ed S

pike

d

Low

Spi

ked

Mix

ed S

pike

d

Low

Spi

ked

Mix

ed S

pike

d

Low

Spi

ked

Mix

ed S

pike

d

Low

Spi

ked

Mix

ed S

pike

d

Low

Spi

ked

Mix

ed S

pike

d

Low

Spi

ked

Mix

ed S

pike

d

Low

Spi

ked

Mix

ed S

pike

d

ChickenCuts

Egg Salad Hamburger Sushi Blueberries Cheese CheeseO/N

Mayonnaise OrangeJuice

Food Samples

No.

of C

FU

Mean CFU BPWMean CFU BPW+IMSMean CFU BPW+TT

Isolation of Salmonella from food samples enriched in buffered peptone water (BPW),

BPW+IMS (immunomagnetic separation) or BPW+TT (tetrathionate broth). The mean

colony count on xylose lysine desoxycholate (XLD) agar from repeat tests is shown. For

the graph, too numerous to count colonies were represented as 500

95

Application of Colonies Isolated from Food for Typing and Antibiotic Susceptibility Testing

Salmonella colonies isolated on XLD agar after general enrichment in BPW and selective

enrichment in IMS and TT broth were subtyped by PFGE, ribotyping and antibiotic

susceptibility profiles. S. Typhimurium with which the food samples were originally

spiked was used as a positive control and was grown on a TSA plate. The organism

isolated after the enrichments had identical ribotype, PFGE and antibiotic susceptibility

patterns as the control (Figure 10, Table 14). This shows that pure culture was achieved

after the enrichments and there was no possible contamination. These results demonstrate

that Salmonella colonies isolated from the selective XLD agar can be used to subtyping

pure culture from a TSA plate is not required.

Figure 10. Molecular Typing on Salmonella Isolated from Food

10a. 10b.

M + B M BI BT MM + B M BI BT M M + B BI M + B BI

96

97

Application of S. Typhimurium isolated from intentionally contaminated food after

general and selective enrichment for molecular typing. The colonies isolated on xylose

lysine desoxycholate (XLD) agar were used for typing. 10a. Ribotyping, 10b. Pulsed field

gel electrophoresis; M=molecular weight standard, + = positive control, B=buffered

peptone water, BI=B + immunomagnetic separation, BT=B + tetrathionate broth

enrichment

98

Table 14. Antibiotic Susceptibility Testing of Salmonella Isolated from Spiked Food

AMI A/S AZT FEP FOP FOT TAZ AXO CH CIP G IMI LEVO LOM PIP P/T FIS TET TIC TIM TOB SXT

+ 4 S 2 S 2 S 2 S 4 S 4 S 1 S 4 S 4 S .25S 1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 16 S 1 S .5 S

B 4 S 2 S 2 S 2 S 4 S 4 S 1 S 4 S 4 S .25S 1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 16 S 1 S .5 S

BI 4 S 2 S 2 S 2 S 4 S 4 S 1 S 4 S 4 S .25S 1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 16 S 1 S .5 S

BT 4 S 2 S 2 S 2 S 4 S 4 S 1 S 4 S 4 S .25S 1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 16 S 1 S .5 S

Antibiotic susceptibility testing of S. Typhimurium isolated from artificially contaminated food samples. AMI- amikacin, A/S-

ampicillin/sublactum, AZT- aztreonam, FEP- cefepime, FOP- cefoperazone, FOT- cefotaxime, TAZ-ceftazidime, AXO-

ceftriaxone, CH- chloramphenicol, CIP- ciprofloxacin, G- gentamicin, IMI- imipenem, LEVO- levofloxacin, LOME-

lomefloxacin, PIP- piperacillin, P/T- piperacillin/tazobactum, FIS- sulfizoxazole, TET- tetracycline, TIC- ticarcillin, TIM-

ticarcillin/ clavulanic acid, TOB- tobramycin, SXT- trimethoprim/sulphamethoxazole. + = Positive control, B=buffered

peptone water, BI=B + immunomagnetic separation, BT=B + tetrathionate broth enrichment, S= susceptible

rDNA Analysis by Automated RiboPrinter®

The 100 wild type Salmonella isolates and the controls strains were subjected to rDNA

analysis by automated ribotyping with the enzyme EcoRI. The results were analyzed by

using BioNumerics® software. Figure 11a shows an example of the TIFF image obtained

after the automated ribotyping. The results are obtained in eight hours and the

RiboPrinter® identifies strains based on the ribotype patterns of the organisms in its

database (Figure 11b). The first strain (S. Choleraesuis) in Figure 11b was placed in a

group of five with 86% similarity, which included S. Choleraesuis. The third strain (S.

Typhimurium) was placed in a group of 55 with 96% similarity, which also consisted of

S. Typhimurium. The fourth strain (unknown) was put in a group of 12 with 90%

similarity. The sixth strain (S. Derby) was placed in a group of 3 with 90% similarity that

included S. Derby. The fifth strain was identified correctly as S. Newport. The

RiboPrinter® database did not identify the second and eighth strains (unknown). The

seventh strain CBD 32 was identified as Salmonella enterica serotype Give; however this

identification was incorrect based on biochemical and serological results. Out of the eight

strains analyzed, the RiboPrinter® correctly identified six as Salmonella species of which,

S. Newport was correctly recognized at the serotype level. Two of the eight isolates were

not grouped as Salmonella species, possibly due to the absence of these types in its

database. One of the serotypes (CBD 32, S. Nima) was mistakenly identified as S. Give.

These results show that the results analyzed by the RiboPrinter® may be correct at the

species level for Salmonella but not always at the serotype level which is expected

because the criteria used by the ribotyping and the serotyping are different. Serotyping

99

analyses the serological properties of the organism and ribotyping analyzes the rRNA

operons, hence a correlation although possible is not always expected. Therefore, analysis

and comparison of the fingerprints by creating a separate database is suggested.

Figure 11. Ribotyping of Salmonella 11a.

M 1 2 M 3 4 M 5 6 M 7 8 M

Ribotyping of Salmonella species by automated RiboPrinter®. 1= CBD 25, S.

Choleraesuis; 2=CBD 26, S. arizonae; 3= CBD 28, S. Typhimurium; 4= CBD 29, S.

species; 5= CBD 30, S. Newport; 6= CBD 31, S. Derby; 7= CBD 32, S. species; 8=CBD

33, S. species, M= Molecular weight standard

100

Figure 11b

Identification of unknown Salmonella serotypes by the RiboPrinter® after auto

normalization. Samples 1, 3, 4, 6 were placed in groups AE, AA, AB and AF respectively

by the RiboPrinter®. Samples 5 and 6 were identified as S. Newport and S. Give;

samples 2 and 8 were not identified.

DNA Fingerprinting by Macrorestriction Digestion (PFGE)

The 100 wild type isolates were subtyped by PFGE with two enzymes, XbaI and SpeI,

and were analyzed using BioNumerics® software. An example of a PFGE gel containing

samples digested with XbaI is shown in Figure 12. Four standards were run with each gel

for normalization. The four environmental S. Newport isolates in lanes 1-4 are identical

whereas the clinical S. Newport in lane 10 is slightly different (Figure 12). It is also clear

that the unknown Salmonella serotype (CDC isolate sent for PulseNet certification) in

lane eight has an identical pattern to the molecular weight standard S. Braenderup. The

two isolates in lanes six and seven have completely different PFGE profiles although they

are both of the same serotype (Typhimurium). These results indicate that typing by

101

PFGE can be used for identification of an isolate if the strain is already present in the

database. It is also clear that two isolates belonging to one serotype can have an identical

pattern or very different profiles. It is important to know the percent relatedness of the

isolates belonging to the same serotype to assess its clonality in the event of an outbreak;

therefore visual observation of the fragments in the gel is not sufficient.

Figure 12. PFGE of Salmonella with XbaI

M 1 2 3 M 4 5 6 7 M 8 9 10 11 M

1135 Kb

668.9 Kb

452.7 Kb

336.5 Kb

173.4 Kb

54.7 Kb

M 1 2 3 M 4 5 6 7 M 8 9 10 11 M

1135 Kb

668.9 Kb

452.7 Kb

336.5 Kb

173.4 Kb

54.7 Kb

Analysis of Salmonella species by macrorestriction profiling by XbaI. Lane 1= CBD 595

(S. Newport), lane 2= CBD 596 (S. Newport), lane 3= CBD 597 (S. Newport), lane 4=

CBD 598 (S. Newport), lane 5= CBD 599 (S. Typhimurium), lane 6= CBD 600 (S.

Typhimurium), lane 7= CBD 601 (S. species), lane 8= CBD 602 (S. species), lane 9=

CBD 603 (S. Javiana), lane 10= CBD 604 (S. Newport), lane 11= CBD 31 (S. Derby),

102

M= molecular weight standard (CDC H 9812, S. Braenderup). The molecular weights of

the bands are shown in Kb

Identification of Unknown Salmonella Serotypes by Molecular Typing

The rDNA and PFGE fingerprint database of known Salmonella serotypes created by

using the BioNumerics® software was used to identify the unknown Salmonella samples

obtained from FLDOH. The unknown isolates were eventually serotyped by Bureau of

Laboratories, Jacksonville, FL. but the molecular typing database was validated for initial

identification. The results of ribotyping database for identification of selected unknown

isolates are shown in Figure 13a and Table 15. By using the ribotyping and the PFGE

database, isolates 213, 604, 759, 827 and 67 were identified as S. Newport (Figure 13b).

Ribotyping gave a very close relatedness of 90 to 100%. Whereas; by PFGE, the isolates

were related by 65% to S. Newport. Isolates 832, 781, 779 and 818 showed a very close

similarity of more than 80% to S. Enteritidis using both the ribotyping and PFGE

database. All the S. Typhimurium isolates formed a close cluster of 90 to 100% similarity

with the ribotyping. However, the PFGE analysis separated the S. Typhimurium isolates

into three clusters at 55 to 80% relatedness. The S. Javiana isolates formed a cluster with

the known S. Javiana in the database with PFGE. However, they did not show any close

similarity with the ribotyping database. These results suggest that ribotyping patterns

show a closer relatedness among serotypes, which could be used for initial identification.

PFGE patterns among serotypes show more diversity and may not be appropriate for

initial identification of the serotype. The results of both the typing techniques depend on

103

the serotype as well. For example, S. Enteritidis isolates showed very high similarity to

the known S. Enteritidis strain using both the PFGE as well ribotyping. For S. Javiana,

PFGE was better in identifying the serotype compared to the ribotyping database. These

results also suggest that it is important to rely on two or more techniques for strain

typing.

104

Figure 13. Identification of Unknown Salmonella by Molecular Typing Figure 13a

60 65 70 75 80 85 90 95 100

105

Application of ribotyping database for identification of unknown Salmonella serotypes

received from Florida department of health (FLDOH). The unknown isolates are

compared to known serotypes obtained from Washington department of health

(WADOH) or American Type Culture Collection (ATCC), Centers for Disease Control

and Prevention (CDC) or environmental isolates from turkey carcasses. The numbers

above the dendrogram represent the percent relatedness, the red blocks indicate that the

serotype is known.

106

Figure 13b

40 50 60 70 80 90 100

107

Application of PFGE database for identification of unknown Salmonella serotypes

received from Florida department of health (FLDOH). The unknown isolates are

compared to known serotypes obtained from Washington Department of Health

(WADOH) or American Type Culture Collection (ATCC), Centers for Disease Control

and Prevention (CDC) or environmental isolates from turkey carcasses. The numbers

above the dendrogram represent the percent relatedness, the red blocks indicate that the

serotype is known.

Table 15. Identification of Unknown Salmonella serotypes by Molecular Typing

Isolate Numbers

% Similarity by Ribotyping

% Similarity by PFGE

Final Id by Serotyping

213, 604, 759, 827, 829, 67

90-100% to S. Newport 65% to S. Newport S. Newport

832, 781, 779, 818

90-100% to S. Enteritidis

80-95% to S. Enteritidis

S. Enteritidis

746, 823, 777 90% to S. Typhimurium

72% to S. Typhimurium

S. Typhimurium

817, 828, 820, 757, 775, 778

90-100% to S. Typhimurium

55-80% to S. Typhimurium

S. Typhimurium

830, 807, 819, 603, 826, 69, 222

Closest match, 60% to S. Typhimurium

60-60% to S. Javiana

S. Javiana

Comparison of ribotyping and PFGE patterns of known serotypes with unknown

Salmonella serotypes for initial identification. The percent similarity as shown in the

dendrograms of Figure 12 is indicated and the final identification by serotyping is shown

108

Discrimination of Salmonella Species by Molecular Typing and Antibiotic Susceptibility patterns

The discriminatory ability of the two molecular typing techniques; PFGE and ribotyping,

and the phenotypic method, antibiotic susceptibility profiling, was tested on the 100 wild

type isolates. The ribotyping results were analyzed by both manual analysis of the TIFF

images as well as by importing images already normalized by the RiboPrinter®. For

PFGE, patterns above 93% similarity were considered identical and for ribotyping,

patterns that showed below 99.99% similarity were considered different based on

molecular weight standard analysis of repeated gels. The results of the molecular weight

standard analysis are shown in Figures 3a and 3b. For the 100 isolates, the ribotyping

based on auto normalization generated 58 profiles; whereas the manual analysis of the

TIFF images obtained from the ribotyping produce 62 ribotypes (data shown in

Appendix, Figure A1). The major difference was seen in the serotype Newport; 12 types

were produced by the manual analysis, whereas only eight types were seen by the

automated normalization for the 28 wild type isolates analyzed. Overall, PFGE typing

produced 74 profiles using the XbaI enzyme (data shown in Appendix, Figure A2) and 70

pulsotypes with the SpeI enzyme. The 100 isolates were divided into 42 profiles based on

the antibiograms (data shown in Appendix, Figure A3). These results clearly demonstrate

that both of the molecular fingerprinting methods were more discriminatory than the

phenotypic typing method, for the set of isolates studied.

109

To study the discriminatory ability and correlation between the three techniques,

ribotyping, PFGE and antibiotic susceptibility profiles, a set of 30 isolates belonging to

one serotype (S. Newport) was selected for analysis. Twenty eight wild type isolates and

two ATCC S. Newport strains were analyzed. When the ribotyping results were analyzed

manually, three major clusters at 74% or more similarity were seen (Figure 14a). The

three clusters were further divided into 14 unique ribotypes. Based upon 99.9%

similarity, with the exception of CBD 584, the environmental isolates grouped into the

largest cluster comprising 9 of the 14 ribotypes, whereas the clinical isolates were

dispersed among the three major clusters. Four clinical isolates, CBD 604, CBD 213,

CBD 829 and CBD 759, showed 100% identity with the environmental isolates. When

the fragment patterns were normalized by the RiboPrinter® software, ten ribotypes at

98% or less similarity were observed using the BioNumerics® software (Figure 14b).

These ten ribotypes are essentially similar to the manually analyzed data with some

exceptions. The major difference between the automated and the manual analysis was

seen among the environmental isolates. Thirteen isolates that showed 100% similarity

using the automated analysis were divided into 8 ribotypes using the manual analysis.

Using 93% similarity as the threshold, 14 PFGE pulsotypes were observed at 93%

similarity with the enzyme XbaI (Figure 15a) for the 30 S. Newport isolates. Similarly,

14 subtypes were seen with the enzyme SpeI (15b). The environmental isolates formed

one large cluster at 84% that could be further divided into 3 sub-groups and 4 pulsotypes

with the enzyme XbaI. The 11 clinical isolates showed greater diversity, forming 8

pulsotypes with all of the isolates from WADOH forming one cluster. The two ATCC

110

control strains were of two distinct pulsotypes. The PFGE results between the two

enzymes correlated well and similar grouping was observed with XbaI and SpeI (Figure

15a and 15b). Both PFGE and ribotyping further resolved groups not differentiated by the

corresponding method. For example, ribotype cluster 2 (Figure 14a) was further

discriminated by PFGE into two groups, B and C (Figure 15a). Likewise, PFGE cluster A

(Figure 15a) was further divided into clusters 1 and 3 by ribotyping (Figure 14a). The

clinical isolates from WADOH were identical by both ribotyping as well as PFGE.

Cluster analysis of the antimicrobial susceptibility results showed 23 distinct profiles.

Isolates resistant or intermediately resistant to six or more antibiotics formed a separate

cluster clearly distinguishable from the susceptible or less resistant isolates (Figure 16).

The clinical isolates from WADOH formed a cluster at 94% or more similarity. The

environmental isolates were distributed among various clusters. This data shows that for

the set of S. Newport isolates studied antibiograms were more discriminatory compared

to the molecular typing techniques. No correlation among the molecular typing patterns

and the antibiotic susceptibility profiles was apparent for the 30 S. Newport isolates

studied. Both susceptible and resistant isolates were spread among the various clusters

and were not clearly distinguished by the ribotyping or the PFGE.

111

Figure 14. Ribotyping of S. Newport Figure 14a

Dendrogram representing the ribotypes of the S. Newport isolates with the enzyme EcoRI

using the manual analysis of RiboPrinter® images. The isolate number, corresponding

source and resistance pattern are shown. The relatedness among the isolates is depicted

by percentage similarity. Cluster 2 depicts the group that was further divided by PFGE

with XbaI; Cluster 1 and 3 refer to the PFGE group A that was subdivided by the

ribotyping. S=susceptible, 1 class=R or I to only one class of antibiotic, MDR=Multidrug

resistant to 2 or more classes of drugs

112

Figure 14b

Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]VCA

100

9590858075706560VCA

CBD 588, S.Newport

CBD 598, S.Newport

CBD 571, S.Newport

CBD 585, S.Newport

CBD 586, S.NewportCBD 587, S.Newport

CBD 589, S.Newport

CBD 590, S.Newport

CBD 591, S.NewportCBD 594, S.Newport

CBD 595, S.Newport

CBD 596, S.Newport

CBD 597, S.Newport

CBD 592, S.NewportCBD 213, S.Newport

CBD 572, S.Newport

CBD 584, S.Newport

CBD 815,S.Newport

CBD 593, S.NewportCBD 604, S.Newport

CBD 759, S.Newport

CBD 827, S.Newport

CBD 829, S.Newport

CBD 67, S.NewportCBD1058, S.Newport

CBD 30, S.Newport

CBD 425, S.Newport

CBD 426, S.Newport CBD 427, S.Newport

CBD 428, S.Newport

Turkey Carcasses

Turkey Carcasses

Turkey Carcasses

Turkey Carcasses

Turkey CarcassesTurkey Carcasses

Turkey Carcasses

Turkey Carcasses

Turkey CarcassesTurkey Carcasses

Turkey Carcasses

Turkey Carcasses

Turkey Carcasses

Turkey CarcassesHuman FLDOH

Turkey Carcasses

Turkey Carcasses

Human,FLDOH

Turkey CarcassesHuman,FLDOH

Human,FLDOH

Human,FLDOH

Human,FLDOH

Human FLDOHATCC

ATCC

Human, WADOH

Human, WADOHHuman, WADOH

Human, WADOH

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

MDR

MDR

MDR

MDR

MDRMDR

1 Class

MDR

MDR1 Class

1 Class

1 Class

MDR

MDR1 Class

MDR

MDR

1 Class

MDRMDR

S

S

S

SS

S

MDR

MDRMDR

MDR

Dendrogram of the ribotypes of the S. Newport isolates with the enzyme EcoR1 using the

automated normalization. The isolate number, corresponding source and resistance

pattern are shown. The relatedness among the isolates is depicted by percentage

similarity. S=susceptible, 1 class=R or I to only one class of antibiotic, MDR=Multidrug

resistant to 2 or more classes of drugs

113

Figure 15. PFGE of S. Newport Figure 15a

Macrorestriction profiling of S. Newport isolates with the enzyme XbaI. The percentage

similarity between various pulsotypes is shown. The isolate number and source is

specified. Cluster A was further divided by ribotyping; Cluster B and C refer to the

ribotyping group 2 that was subdivided by PFGE. S=susceptible, 1 class=R or I to only

one class of antibiotic, MDR=Multidrug resistant to 2 or more classes of drugs.

114

Figure 15b

endrogram of the macrorestriction profiling with the enzyme SpeI. The percentage

Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]PFGE Spe-1

100

959085807570656055504540

PFGE Spe-1

CBD 604, S.Newport

CBD 759, S.Newport

CBD 588, S.Newport

CBD 597, S.Newport

CBD 584, S.Newport CBD 585, S.Newport

CBD 586, S.Newport

CBD 587, S.Newport

CBD 589, S.NewportCBD 590, S.Newport

CBD 591, S.Newport

CBD 572, S.Newport

CBD 571, S.Newport

CBD 595, S.NewportCBD 596, S.Newport

CBD 598, S.Newport

CBD 592, S.Newport

CBD 593, S.Newport

CBD 594, S.NewportCBD 829, S.Newport

CBD 815,S.Newport

CBD 67, S.Newport

CBD 213, S.Newport

CBD1058, S.NewportCBD 30, S.Newport

CBD 425, S.Newport

CBD 426, S.Newport

CBD 427, S.Newport CBD 428, S.Newport

CBD 827, S.Newport

Human,FLDOH

Human,FLDOH

Turkey Carcasses

Turkey Carcasses

Turkey CarcassesTurkey Carcasses

Turkey Carcasses

Turkey Carcasses

Turkey CarcassesTurkey Carcasses

Turkey Carcasses

Turkey Carcasses

Turkey Carcasses

Turkey CarcassesTurkey Carcasses

Turkey Carcasses

Turkey Carcasses

Turkey Carcasses

Turkey CarcassesHuman,FLDOH

Human,FLDOH

Human FLDOH

Human FLDOH

ATCCATCC

Human, WADOH

Human, WADOH

Human, WADOHHuman, WADOH

Human,FLDOH

MDR

S

MDR

MDR

MDRMDR

MDR

MDR

1 ClassMDR

MDR

MDR

MDR

1 Class1 Class

MDR

MDR

MDR

1 ClassS

1 Class

S

1 Class

SS

MDR

MDR

MDRMDR

S

D

similarity between various pulsotypes is shown. The isolate number and source is

specified. S=susceptible, 1 class=R or I to only one class of antibiotic, MDR=Multidrug

resistant to 2 or more classes of drugs.

115

Figure 16. Antibiotyping of S. Newport

endrogram showing the percentage similarity between isolates based on their

Dice (> 50%MEAN)Antib iotic resistance

100

9590858075706560

Antibiotic resistance

AM

IA

UG

AM

PFO

XTI

OAX

OC

EP

CH

CIP

G K NAL

STR

SM

XTE

TC

OT

A/S

AZT

FEP

FOP

FOT

TAZ

IMI

LEVO

LOM

PIP

P/T

FIS

TIC

TIM

TOB

CBD 213, S.Newport

CBD 595, S.Newport

CBD 815,S.Newport

CBD 589, S.Newport

CBD 594, S.NewportCBD 827, S.Newport

CBD 829, S.Newport

CBD1058, S.Newport

CBD 30, S.Newport CBD 67, S.Newport

CBD 759, S.Newport

CBD 596, S.Newport

CBD 571, S.Newport

CBD 593, S.NewportCBD 572, S.Newport

CBD 587, S.Newport

CBD 597, S.Newport

CBD 598, S.Newport

CBD 591, S.NewportCBD 584, S.Newport

CBD 592, S.Newport

CBD 425, S.Newport

CBD 428, S.Newport

CBD 426, S.Newport CBD 427, S.Newport

CBD 588, S.Newport

CBD 590, S.Newport

CBD 586, S.NewportCBD 585, S.Newport

CBD 604, S.Newport

Human FLDOH

Turkey Carcasses

Human,FLDOH

Turkey Carcasses

Turkey CarcassesHuman,FLDOH

Human,FLDOH

ATCC

ATCCHuman FLDOH

Human,FLDOH

Turkey Carcasses

Turkey Carcasses

Turkey CarcassesTurkey Carcasses

Turkey Carcasses

Turkey Carcasses

Turkey Carcasses

Turkey CarcassesTurkey Carcasses

Turkey Carcasses

Human, WADOH

Human, WADOH

Human, WADOHHuman, WADOH

Turkey Carcasses

Turkey Carcasses

Turkey CarcassesTurkey Carcasses

Human,FLDOH

1 Class

1 Class

1 Class

1 Class

1 ClassS

S

S

SS

S

1 Class

MDR

MDRMDR

MDR

MDR

MDR

MDRMDR

MDR

MDR

MDR

MDRMDR

MDR

MDR

MDRMDR

MDR

D

susceptibilities to 31 different antibiotics or antibiotic combinations. Each cell indicates

the minimum inhibitory concentration (MIC) of the corresponding antimicrobial. The

darker the cell, the greater the MIC value therefore the greater the resistance to that

particular drug. S=susceptible, 1 class=R or I to only one class of antibiotic,

MDR=Multidrug Resistant to 2 or more classes of drugs. Ampicillin (Amp), piperacillin

(Pip), ticarcillin (Tic), amoxicillin/clavulanic acid (Aug), ampicillin/sublactum (A/S),

piperacillin/tazobactum (P/T), ticarcillin/ clavulanic acid (Tim), amikacin (Ami),

116

gentamicin (G), kanamycin (K), streptomycin (Str), tobramycin (Tob), ceftriaxone (Axo),

cephalothin (Cep), cefoxitin (Fox), ceftiofur (Tio), aztreonam (Azt), cefepime (Fep),

cefoperazone (Fop), cefotaxime (Fot), ceftazidime (Taz), nalidixic acid (Nal),

ciprofloxacin (Cip), levofloxacin (Levo), lomefloxacin (Lome), chloramphenicol (Ch),

tetracycline (Tet), trimethoprim/sulfamethaxazole (Cot), sulfamethoxazole (Smx),

sulfizoxazole (Fis), imipenem (Imi).

Antibiotic Susceptibility Testing

ental isolates and some of the ATCC control strains All the 100 clinical and environm

were tested for susceptibility to 32 antibiotics using two panels. All the isolates showed R

or I to carbenicillin including the ATCC strains of Salmonella. Therefore, carbenicillin

was not considered for further analysis. A complete list of the MIC values for all the 100

isolates tested with both panels is in the Appendix (Tables A2 and A3). Isolates that

showed any resistance to one or more drugs are shown in Tables 16 and 17. Of the

isolates comprising of clinical sources, 24/60 were R or I to at least one drug (Table 16).

A high percent (83%) of isolates obtained from WADOH were R or I. Twenty nine

percent of the clinical isolates from FLDOH were R or I to one or more antimicrobials.

Twenty out of the 24 (80%) clinical isolates showed multidrug resistance to two or more

classes of drugs. The four S. Newport isolates, CBD 425, 426, 427 and 428 from

WADOH were R or I to 17 or more drugs. The five S. Typhimurium isolates CBD 438,

746, 777, 816 and 823 showed pentadrug resistance to Amp, Ch, Str, Smx and Tet,

which, is a characteristic of S. Typhimurium DT104. These isolates also were R or I to

several other antibiotics including Fop, Tob and Tim. Out of the 40 environmental

117

isolates, 36 (90%) showed R or I to one or more antibiotics (Table 16). Seventy percent

of the resistant environmental isolates from WADOH were multidrug resistant to 6 or

more classes of drugs and 71% of resistant FLDOH were multidrug resistant to three or

more classes of drugs. The two S. Muenchen isolates have the same antibiotic resistance

profile. Of the isolates obtained from turkey carcasses, 96% were R or I to one or more

drugs, 86% of which were multiply resistant to two or more classes of drugs. Overall,

60/100 isolates from both clinical and environmental sources were R or I to at least one

drug of which 52 were multi resistant to two or more classes of drugs.

118

Table 16. Antibiotic Resistance of Clinical Salmonella Isolates

ntibiotic resistance of clinical isolates, Ch- Chloramphenicol, Aug-

Tobramycin, Nal- Nalidixic acid

213, S.Newport Ch425, S.Newport AugAmpFoxTioAxoCepChStrSmxTetA/SAztFopFotTazPipTicTim426, S.Newport AugAmpFoxTioAxoCepChStrSmxTetA/SAztFopFotTazPipP/TTicTim427, S.Newport AugAmpFoxTioAxoCepChStrSmxTetA/SAztFopFotTazPipTimTob428, S.Newport AugAmpFoxTioAxoCepChStrSmxTetA/SFopFotTazPiptTicTim433, S.arizonae AugAmpFoxTioAxoCepChStrSmxTetA/SFopTazPipTic434, S.Brandenburg AugAmpFoxTioCepChStrSmxTetTic436, S.Paratyphi A Nal437, S.Saintpaul AugAmpCepGKSmxTetA/SFopP/TTicTimTob438, S.Typhimurium AmpChStrSmxTetA/SFopPipTicTimTob439, S.Enteritidis ChStrSmxTet603, S.Javiana AmpGKSmx604, S.Newport AmpGKSmx746, S.Typhimurium A/SFopChGPipTetTicTim747, S.houtenae AmpChStrSmxTet777, S.Typhimurium AmpChStrSmxTetA/SFopPipTicTim810, S. Heildelberg Ch815, S.Newport FoxCep816, S.Typhimurium AugAmpChStrSmxTetA/SFopPipTicTim817, S.Typhimurium A/S823, S.Typhimurium AmpChStrSmxTetA/SFopPipTicTim824, S.Tallahassee A/SFopChPipTetTicTim825, S.Paratyphi AmpChNalSmxTetA/SFopPipTicTim826, S.Javiana A/SFopChPipTetTicTim

Isolate Antibiotic Resistance Profile

A

Amoxicillin/Clavulanic acid, Amp- Ampicillin, Fox- Cefoxitin, Tio- Ceftiofur, Cep-

Cephalothin, Str- Streptomycin, Smx- Sulfamethoxazole, Tet- Tetracycline, A/S-

Ampicillin/Sublactum, Azt- Aztreonam, Fop- Cefoperazone, Fot- Cefotaxime, Taz-

Ceftazidime, Pip- Piperacillin, Tic- Ticarcillin, Tim- Ticarcillin, Clavulanic acid, Tob-

119

Table 17. Antibiotic Resistance of Environmental Salmonella Isolates

Isolate Antibiotic Resistance Profile429, S.Oranienburg AugAmpFoxTioAxoCepChStrSmxTetA/SFopPipTicTim430, S.apapa AugAmpFoxTioCepChStrSmxTetA/SAxoTim431, S.Saintpaul AugAmpFoxTioAxoCepChStrSmxTetTim432, S.arizonae AugAmpFoxTioCepChStrSmxTet440, S.Muenchen A/SFopChGPipTetTicTimTob441, S.Muenchen A/SFopChGPipTetTicTimTob443, S.Hildgo AmpChStrSmxTet569, S.Alachua GSmxTetTob570, S.Anatum GSmxTetTob571, S.Newport GTetTob572, S.Newport GTetTob573, S.Istanbul StrTetGTob574, S.Istanbul StrTet575, S.Istanbul GStrSmxTet576, S.Kentucky Tet577, S.Kentucky StrTet579, S.Montvideo GKStrTob580, S.Muenster AmpChGKStrSmxTetA/SPipTicTim581, S.Muenster AmpGStrSmxTetA/SGPipTicTim582, S.Reading AmpChGKStrSmxTetA/SPipTicTob583, S.Reading ChGStrSmxTetA/SGPipTicTob584, S.Newport A/SGPipTetTicTob585, S.Newport GImi586, S.Newport GSmxTet587, S.Newport GTet588, S.Newport GTet589, S.Newport Tet590, S.Newport StrSmxTet591, S.Newport AugAmpStrSmxA/SFopPipP/TTicTim592, S.Newport StrSmxTetA/SPiTicTim593, S.Newport StrGTetTob594, S.Newport AmpTet595, S.Newport Ch596, S.Newport Ch597, S.Newport AmpCepGKStrSmxA/SFopPipTicTim598, S.Newport AmpCepGKNalStrSmxA/SFopPipTicTim

120

Antibiotic resistance of environmental isolates, Ch- Chloramphenicol, Aug-

Amoxicillin/Clavulanic acid, Amp- Ampicillin, Fox- Cefoxitin, Tio- Ceftiofur, Cep-

Cephalothin, Str- Streptomycin, Smx- Sulfamethoxazole, Tet- Tetracycline, A/S-

Ampicillin/Sublactum, Azt- Aztreonam, Fop- Cefoperazone, Fot- Cefotaxime, Taz-

Ceftazidime, Pip- Piperacillin, Tic- Ticarcillin, Tim- Ticarcillin, Clavulanic acid, Tob-

Tobramycin, Nal- Nalidixic acid, G- Gentamicin, K- Kanamycin, Imi- Imipenem

Resistance Determinants

PCR was carried out with primers targeting the entire integron on all the isolates

were R or I to at least one drug. The negative controls were two susceptible isolates CBD

28 and CBD 30. Twelve out of the 100 isolates showed the presence of class-1 integrons.

Eleven of the 52 multidrug resistant strains clearly showed the presence of

integrons, as shown in Figure 16. The twelfth isolate, S. Paratyphi (CBD 436), which was

not MDR, had a 1.6 Kb integron (data not shown). The five S. Typhi

CBD 438, 746, 777, 816 and 823 showed the presence of two integrons (1.0 Kb and 1.2

Kb) that is a characteristic feature of S. Typhimurium DT104 (Figure 17). S. Muenster

and S. Reading had a 1 Kb fragment and a small 750 bp fragment. The two S. Newport

isolates had one fragment of 1 Kb size. On the whole four integrons prof

fragments at 1.0 Kb and 1.2 Kb; 1.0 Kb and 0.75 Kb; 1 Kb; 1.6 Kb were observed among

the 12 isolates. The negative controls did not show an amplification product. The other

isolates when tested with PCR with primers directed against the 5’CS and 3’CS of the

that

class-1

murium isolates

iles with

121

integrons showed multiple non specific bands or no bands at all (data not shown). These

esults of the

11

outhern

isolates were further tested with the class-1 integrase gene as a target; the r

integrase genes PCR were similar to the integron PCR with multiple bands. The

isolates in Figure 17 were considered for further analysis by sequencing and S

blotting.

Figure 17. Integrons in Multidrug Resistant Isolates

Amplification of integrons of the MDR isolates. 438, 746, 777, 816, 823 belong to

serotype Typhimurium. 580, 581- S. Muenster, 583, 584 - S. Reading, 597, 598 - S.

Newport. M- molecular weight standard, NTC- no template control

M NTC 438 746 777 816 823 580 581 582 583 597 598 M

1 Kb1.2 Kb1.2 Kb

M NTC 438 746 777 816 823 580 581 582 583 597 598 M

1 Kb

122

Location of Integrons

To determine if the integrons in the 11 isolates are present on plasmids or chromosomes,

plasmids were purified and the product was subjected to amplification by PCR targeting

the integron. The results of the plasmid prep are shown in Figure 18. All the isolates had

a plasmid at approximately 23.1 Kb. These plasmids were not linearized, therefore it is

ossible that there are supercoiled and relaxed plasmids. On the whole, a total of five

Figure 18. Plasmid Profiling of Integron Positive Isolates

lasmids extracted from the 11 isolates in Figure 16 that had integrons. M=Molecular

eight standard, lane 1=CBD 438, lane 2= CBD 746, lane 3= CBD 777, lane 4=CBD

16, lane 5= CBD 823, lane 6= CBD 580, lane 7= CBD 581, lane 8= CBD 582, lane 9=

BD 583, lane 10= CBD 597, lane 11= CBD 598

p

different plasmid profiles were noted.

23. 1 Kb

M 1 2 3 4 5 6 7 8 9 10 11

P

w

8

C

123

The plasmid DNA was amplified by using primers directed against the entire integrons to

identify the location of the integrons and the results are shown in Figure 19. The plasmid

prep of all the 11 isolates (data of CBD 581 not shown) was positive for the presence of

integrons by PCR. These results suggest that the integrons are present on the plasmids of

these isolates. However, to make sure that there is no possible chromosomal DNA

contamination, real time PCR with the chromosomal marker gene, ompF was performed

on the plasmid DNA. The results of the real time PCR were positive for all isolates,

l DNA contamination in the

plasmids extracted. Therefore the location of the integrons could not be conclusively

determ

demonstrating that there was a possible chromosoma

ined based on these tests.

124

Figure 19. Detection of Integrons in Plasmids 19a. 19b.

M NTC 583 597 816 823 + M NTC 438 746 777 580 582 598 +

PCR amplification of plasmid prep with int primers. The isolate numbers are given,

NTC=no template control, + = positive control (chromosomal and plasmid DNA), M=

olecular weight standard

equencing of the Integrons

The 1.0 Kb and 1.2 Kb fragments of the integrons of the 11 isolates (Figure 17) were

sequenced to identify the nature of the genes located inside the integrons. The 1.6 Kb

fragment of CBD 436 was partially sequenced. Each band of each isolate was sequenced

repeatedly and the consensus was compared with the NCBI database. The consolidated

results of the BLAST match of the isolates are given in Tables 18 and 19. The complete

sequence of each fragment is shown in the Appendix (Figure A4). The 1.0 Kb band of all

the S. Typhimurium isolates harbored the gene aadA2 conferring resistance to

aminoglycosides including Str, G and K (Table 18). The 1.0 Kb integron of the

M

S

125

environmental isolates S. Muenster, S. Reading and S. Newport harbored genes including

sul1 conferring resistance to

sulfonamides. The 1.2 Kb band of the S. Typh

gene pse1 encoding resistance to β lactam

showed 96% similarity to Salmonella en

resistance to aminoglycosides. It is aadA2

gene, did not show R or I to any of the am

aadA1 encoding resistance to aminoglycosides and

imurium isolates showed the presence of

ases (Table 19). The 1.6 Kb band of CBD 436

terica class-1 integron, aadA2 gene encoding

interesting to note that CBD 436 though had

inoglycosides tested.

126

Table 18. Sequencing of 1.0 Kb Integron Fragments

Isolate Resistance Integron bands

Number of bp

Sequencing of the 1.0 Kb fragment of class -1 integron. The isolate names, source and

their resistance patterns are shown. The actual size of the integron, the number of base

pairs sequenced and their BLAST match is indicated. WADOH=Washington Department

of Health, FLDOH= Florida Department of Health. Amp=ampicillin,

sequenced

S.Typhimurium, SFopPipTicTimTob integron aadA2

FLDOH

to S.Typhimurium Class1 tegron aadA2

816, S. Typhimurium FLDOH

AugAmpChStrSmxTetA/SFopPipTicTim

1.0 Kb 1.0Kb 99% to S.Typhimurium Class1 integron aadA2

823, S. Typhimurium

AmpChStrSmxTetA/SfopPipTicTim

1.0 Kb 1.0 Kb 98% to S.Typhimurium Class1 integron aadA2

580, S.Muenster, Turke

NCBI Blast results

438,

WADOH

AmpChStrSmxTetA/ 1.0 Kb 975bp 98% to S.Typhimurium Class1

746, S.Typhimurium FLDOH

A/SFopChGPipTetTicTim

1.0 Kb 1.0 Kb 99% to S.Typhimurium Class1 integron aadA2

777, S.Typhimurium

AmpChStrSmxTetA/SFopPipTicTim

1.0Kb 1.0Kb 98%in

1.0Kb 1.0Kb 97% to S.Typhimurium integron aadA1 , y farms

AmpChGKStrSmxTetA/SPi spTicTim ul1

581, S.Muenster, Turkey farms

AmpGStrSmxTetA/SPipTicTim

1.0Kb 1.0bp 98%to S.Infantis class1 integron aadA 1

582, S.Reading, Turkey farms

AmpChGKStrSmxTetA/SPipTicTob

1.0Kb 975 bp 97%to S.Infantis class1 integron aadA1

583, S.Reading, Turkey farms

ChGStrSmxTetA/SGPipTicTob

1.0Kb 1.0 Kb 99%to S.Infantis class1 integron aadA1 , 99% to S.Typhimurium sul1 gene

597, S.Newport, Turkey farms

AmpCepGKStrSmxA/SFopPipTicTim

1.0Kb 994bp 98%to S.Infantis class1 integron aadA1 , 98% to S.Typhimurium sul1 gene

598, S.Newport, Turkey farms

AmpCepGKNalStrSmxA/SFopPipTicTim

1.0Kb 1.0 Kb 98%to S.Infantis class1 integron aadA1

127

Ch=chloramphenicol, Str= streptomycin, Smx=sulfamethoxizole, Tet=tetracycline, A/S=

Sequencing of the 1.2 Kb and 1.6 fragments of class-1 integron. The isolate names,

source and their resistance patterns are shown. The actual size of the integron, the number

of base pairs sequenced and their BLAST match is indicated. WADOH=Washington

Department of Health, FLDOH= Florida Department of Health. Amp=ampicillin,

Ch=chloramphenicol, Str=streptomycin, Smx=sulfamethoxizole, Tet= tetracycline,

ampicillin/ sublactum, Fop=cefoperazone, Pip=piperacillin, Tic=ticarcilllin, Tim=

ticarcillin/clavulanic acid, G=gentamicin, K=Kanamycin, Aug=amoxicillin/clavulanic

acid, Tob=tobramycin, Cep=cephalothin, Nal=nalidixic acid. aadA=aminoglycoside

adenyl transferase, sul1=sulfonamide resistance gene

Table 19. Sequencing of 1.2 Kb, 1.6 Kb Integron Fragments

Isolate Resistance Integron Bands

Number of bp Sequenced

NCBI Blast Results

438, S. yphimurium

FLDOH

AmpChStrSmxTetA/SFopPipTicTimTob

1.2 Kb 1.17 Kb 97% to S.Typhimurium pse 1, β-lactamse gene, 95% to Salmonella integron dfr gene

746, S.Typhimurium LDOH

A/SFopChGPipTetTicTim

1.2 Kb 1.2Kb 98% to S.Typhimurium pse 1, β-lactamse gene

777, S.Typhimurium LDOH

AmpChStrSmxTetA/SFopPipTicTim

1.2Kb 1.17Kb 98% to S.Typhimurium pse 1, β-lactamse gene

816, S. Typhimurium LDOH

AugAmpChStrSmxTetA/SFopPipTicTim

1.2Kb 1.2Kb 98% to S.Typhimurium pse 1, β-lactamse gene

823, S. yphoimurium, LDOH

AmpChStrSmxTetA/SfopPipTicTim

1.2 Kb 1.16 Kb 98% to S.Typhimurium pse 1, β-lactamse gene

436, S. ParatyphiA, WADOH

Nal 1.6 Kb 553 Kb 96% to Salmonella enterica , aadA2 gene

T

F

F

F

TF

128

A/S=ampicillin/ sublactum, Fop=cefoperazone, Pip= piperacillin, Tic= ticarcilllin,

Tim=ticarcillin/clavulanic acid, G=gentamicin, Aug=amoxicillin/clavulanic acid,

Tob=tobramycin, Nal=nalidixic acid

To see if the sequences of 1.0 Kb fragments of all

the S. Typhimurium isolates are

entical, the sequences were aligned using MegAlign program of the DNAstar®

ragment of all the five S.

least seven differences including insertions/deletions of base pairs were seen in a small

region (260 bp) shown in (Figure 21).

id

software. The results of the alignment of the 1.0 Kb f

Typhimurium isolates is shown in Figure 20. A very high similarity is seen in the 1.0 Kb

bands of all the S. Typhimurium isolates as indicated by the red bar of the alignment in

the Figure 20. Likewise, the 1.2 Kb integron fragments of the S. Typhimurium strains

were very similar (data not shown). When the 1.0 Kb sequences of the environmental

isolates (CBD 580, 581, 582, 583, 597 and 598) were aligned, similar results were

observed (data not shown). These results indicate that all the 1.0 bands were similar

between all the S. Typhimurium strains and between the environmental isolates. To see

the difference between the 1.0 Kb integron of S. Typhimurium, that harbored aadA2 gene

and the 1.0 Kb integron of environmental isolates that had aadA1 genes, all the 11

isolates were aligned. There were a number of differences between the two genes. At

129

Figure 20. Alignment of 1.0 Kb of Integrons of S. Typhimurium

Alignment of the 1.0 Kb integron sequence of the 5 S. Typhimurium isolates. Sequence

information from 1 bp to 840 bp is shown here. Sequences of CBD 438, 746, 777, 816

and 823 are represented here. BLAST analysis of the sequence shows 98% to 99% match

to aadA2 gene encoding resistance to aminoglycosides. The red bar represents 100%

identity of the sequences between isolates, orange and green regions represent lower

similarity.

130

Figure 21. Alignment of 1.0 Integrons of S. Typhimurium and Other Serotypes

Alignment of 1.0 integron sequences of S. Typhimurium isolates with six environmental

isolates including S. Muenster, S. Reading and S. Newport. Sequence information from

230 bp to 490 bp is represented. The 1.0 Kb integron of S. Typhimurium harbors aadA2

gene encoding resistance to aminoglycosides; 1.0 Kb integron of the other isolates has

aadA1 gene that also encodes resistance to aminoglycosides. Red bar indicates 100%

identity between sequences and blue bar shows lower similarity.

Others

Typhimuri

131

Association of Salmonella Pathogenicity Island (SPI) Genes and Integrons

. The location of two islands, SPI-1 and SPI-

was tested in the integron positive isolates. The five S. Typhimurium isolates have very

milar macrorestriction profiling, except for CBD 777 (Figure 22a). The two S.

uenster isolates: CBD 580 and 581 are identical (Figure 22b). Likewise, the two S.

eading isolates (CBD 582, 583) and the two S. Newport strains (CBD 597, 598) showed

entical PFGE profiles. The sitB gene, which is an iron transporter gene that is important

r the virulence of Salmonella species is part of SPI-1, and is located on the 668. 9 Kb

agment of XbaI gel in S. Typhimurium and S. Reading isolates (Figure 23a, 23b). The

t operon is present on the 173 Kb fragment in S. Muenster isolates and on the 104 Kb

agment in S. Newport isolates (Figure 23b). The sitB gene is absent in the negative

ontrol Proteus mirabilis. The magA gene, which is a magnesium transporter gene and is

ted S. Reading and S.

ewport are not clear in this gel. Based on these results it is clear that the integron of S.

uenster (CBD 580) is present on the chromosome.

Southern hybridization of PFGE gels was carried out to identify the location of the SPI

and the antibiotic resistance of the integrons

3

si

M

R

id

fo

fr

si

fr

c

located in SPI-3 was seen on the 104 Kb fragment of XbaI digested DNA in all the

isolates tested including serotypes Typhimurium, Muenster and Reading (Figure 24a,

24b). In S. Newport, however it was seen on the 173 Kb fragment (Figure 24b). The

integrons in the S. Typhimurium isolates were observed at a band lower than 33 Kb. In

CBD 580 (S. Muenster) the integron was located at 167 Kb band of the XbaI digested

DNA (Figure 25). The results of the other two serotypes tes

N

M

132

Figure 22. PFGE Gel of Integron Positive Isolates

Figure 22a Figure 22b

Figure 22a Figure 22b

XbaI digested PFGE of 11 integron positive isolates. 22a. 438, 746, 777, 816 and 823 =

S. Typhimurium. 22b. 580, 581= S. Muenster, 582, 583= S. Reading, 597, 598= S.

Newport, M= molecular weight standard

M 580 581 582 583 597 598

1135 Kb

668.9 Kb

452.7 Kb

336.5 Kb

173.4 Kb

54.7 Kb

M 438 746 777 816 823

133

Figure 23. Southern Hybridization with sitB Probe

Figure 23a Figure 23b

M 438 746 777

668.9 Kb

M 580 581 582 583 597

668.9 Kb

173.4

104 Kb

Figure 23c

- cntrl + cntrl

134

Southern blots of PFGE gel with sitB gene of Salmonella Pathogenicity Island 1 as a

hybridized

3c- dot blots, positive control= S. Typhimurium (CBD 746), Negative control= Proteus

irabilis (CBD 554), M= molecular weight standard (S. Braenderup, CBD 321)

igure 24. Southern Hybridization with magA Probe

Figure 24a Figure 24b

probe. The isolate numbers and the sizes of the fragments where the probe

with the DNA are shown. 23a- S. Typhimurium isolates, 23b – Environmental isolates,

2

m

F

173.4

104

104 Kb

M 580 581 582 583M 438 7746 77

135

Figure 24c

136

l

and 3 as a

ro

ith the DNA are shown. 24a- S. Typhimurium isolates, 24b – Environmental isolates,

4c- dot blots, positive control= S. Typhimurium (CBD 746), negative control= Proteus

irabilis (CBD 554), M= molecular weight standard (S. Braenderup, CBD 321)

+ cntrl - cntr

Southern blots of PFGE gel with magA gene of Salmonella pathogenicity Isl

p be. The isolate numbers and the sizes of the fragments where the probe hybridized

w

2

m

Figure 25. Southern Hybridization with 1 Kb Integron Probe

outhern blots of PFGE gel with1.0 Kb integron band of CBD 746 as a probe. The isolate

umbers and the sizes of the fragments and the location of integron are shown. M=

olecular weight standard (S. Braenderup, CBD 321), which is also a negative control

r integron

167 Kb

<33

M 438 746 777 823 580

S

n

m

fo

137

Chapter Four - Discussion

Since m the

fi m

the

and

s to

exam

see

and

this study, Salmonella species belonging to over 30 serotypes, and three subspecies

elective enrichment.

Primers targeting sopB, spvA and ompF genes were tested for rapid detection by real time

PCR. The sopB gene was present in all the 106 isolates of Salmonella subspecies I tested

but not in all of the isolates belonging to subspecies III and IV. The spvA gene was

olecular or phenotypic typing techniques require pure Salmonella culture,

rst aim of this project was to rapidly detect and isolate Salmonella species fro

artificially contaminated ready to eat foods. The second aim of the project was to build a

subtyping database with two DNA based typing techniques and a phenotypic typing

technique and to see if there is a correlation between the two. The application of

database was to identify unknown Salmonella species received from local hospitals

to analyze the discriminatory ability of the three typing methods. The third aim wa

ine the antibiotic susceptibility patterns of clinical and environmental Salmonella

isolates and study the underlying mechanisms of resistance. The last aim was to

whether there is an association between the antibiotic resistance determinants

pathogenicity island genes.

In

were subjected to primer and probe testing, molecular typing and antibiotic resistance

analysis. For rapid detection and isolation of Salmonella from food, eight food matrices

were intentionally contaminated and subjected to detection by real time PCR and

isolation by s

138

detected in selected serotypes I (Typhimurium, Enteritidis,

ullorum and Choleraesuis) tested as expected and spvA gene was also present in half of

the isolates tested that belonged to subspecies III and IV. ompF was present in all 114

isolates belonging to Salmonella subspecies I, III and IV. The fact that the sopB gene was

absent in certain isolates of subspecies III and IV and ompF was present in all the

subspecies tested suggests that SPI-5 is not very conserved among all Salmonella

subspecies whereas SPI-2 is relatively more conserved. Based on this data, PCR with

ompF gene primers could be used for identification of Salmonella subspecies I, III and IV

isolates. Whether this gene is present in subspecies II, V and VI remains to be tested. The

sopB gene can be used for the identification of strains of subspecies I, and spvA for the

specific detection of selected serotypes of subspecies I. All three genes were specific to

Salmonella because they were absent in other foodborne organisms tested including E.

coli, Shigella species, Listeria monocytogenes and Bacillus cereus. A number of studies

ested including 33 serotypes of subspecies I and

bspecies III and IV, we suggest that it is a good alternative to invA gene for

of Salmonella subspecies

P

have targeted invA gene for the detection of Salmonella species (54, 62, 70, 177). Some

studies have used other gene targets including sipA, and ttR for the detection of

Salmonella species (67, 133). However, no study has tested the potential of ompF gene

for identification of Salmonella species to our knowledge. Since ompF gene was present

in all 114 Salmonella isolates t

su

identification of Salmonella species. Of course, more serotypes of subspecies I and other

subspecies need to be tested.

139

Real time PCR with primers targeting the ompF gene was applied for identifying

Salmonella in artificially spiked ready-to-eat-food samples. The samples were artificially

contaminated with low counts of S. Typhimurium or S. Enteritidis (1-10 CFU) and also

mixed spiked with low cell numbers of Salmonella along with other members of

Enterobacteriaceae including E. coli, Citrobacter freundii and Proteus mirabilis. DNA

extracted from two broth enrichments, general enrichment in BPW (6 hours) and

selective enrichment (additional 4 hours in TT broth), was subjected to PCR. Overall, for

the eight food groups tested, 34/45 reactions (75%) were positive after BPW enrichment

and 31/45 (68%) were positive after the BPW and TT enrichment for the low and mixed

spiked samples. This data suggests that additional enrichment in TT broth for four hours

did not provide any additional benefit for the detection of Salmonella species in

intentionally seeded food samples. A longer enrichment in TT broth might have been

beneficial. Neither of the two broths tested provided 100% positive results for the

samples tested. Most of the studies that successfully detected Salmonella from BPW

enrichment have either incubated for a longer time period of up to 18 hours (70) or had a

very high initial inoculum (106 CFU) (58). Knutsson et al. detected 1 CFU of Salmonella

species after 8 hours of BPW enrichment. However, sterile BPW was inoculated and food

samples were not tested in that study (102). Agrawal et al. detected 3 CFU of Salmonella

species in artificially inoculated food samples but only ten grams and not the standard

25 grams of food samples were tested in that study (1). A study by Ellingson et al.

successfully detected 1 CFU of Salmonella species after 6 hours of BPW enrichment in

rtificially seeded food samples (67). In that study 15 ml of the enriched BPW sample a

140

was used for DNA extraction, which probably led to increased sensitivity of the assay.

However, they did not test the detection limit in mixed culture samples. To our

knowledge, our study is the first to detect very low amounts of Salmonella species from

mixed backgrounds of food matrices using a very short preenrichment.

Rapid isolation of S. Typhimurium and S. Enteritidis from low, mixed and unspiked food

samples was verified on samples enriched by general enrichment (BPW) and selective

enrichments (BPW+IMS and BPW+TT). Salmonella was not recovered from any of the

unspiked foods. For the low spiked foods, significantly greater number of colonies were

isolated after selective enrichment in IMS compared to BPW and BPW+TT. The results

for the mixed spiking were slightly different, where both the selective techniques IMS

and TT fared well and were better than BPW enrichment. However, this could be because

of the isolation results after overnight incubation of cheese, where BPW+TT isolated

TNTC Salmonella but IMS isolated only 31 CFU (Table 13). If the food group cheese is

not considered for the mixed spike analysis then BPW+IMS is significantly better than

BPW+TT (P=0.07). However, if cheese is included in the analysis the isolation results of

BPW +IMS and BPW+TT are very close with a P value of 0.9. The IMS technique was

successful in isolation of Salmonella colonies from all the tested food groups except for

cheese, which required an overnight incubation. This is possibly because of the high fat

content of cheese interfering with the magnetic beads, which has been reported in other

studies (95). Therefore, for foods with high fat content, a longer enrichment is suggested

and IMS is not recommended, although further studies are needed to prove this.

141

A number of studies have employed IMS for rapid isolation of Salmonella species from

artificially inoculated foods. Although these studies have been rapid compared to the

conventional protocol they are not very sensitive. For example Hanai et al. isolated

almonella from artificially spiked food in 30 hours. However, the detection limit in that S

study was 103 CFU/gm (84). Other studies involved a long pre-enrichment of 18-20 hours

prior to IMS (47, 136). In this study, we were successful in isolating numerous

Salmonella colonies starting with low inoculum (1-10 CFU) from artificially

contaminated food samples, which included foods contaminated with other members of

Enterobacteriaceae, in 25 hours using the IMS technique. To our knowledge this is the

first report on isolation of Salmonella, using a method that is both is very sensitive and

rapid. This technique does not involve complex machinery and is very simple to perform.

In conclusion BPW+TT did not provide any additional benefit for either detection by real

time PCR or for isolation for most of the food groups tested. Therefore, we suggest that

the general enrichment in BPW for detection and selective enrichment in IMS is adequate

for rapid identification and isolation of Salmonella species from food samples. For foods

with high fat content, however, further testing is needed. In this study, the application of

isolated colonies directly from XLD agar plate for molecular typing and antibiotic

susceptibility testing was shown. This technique is less time consuming especially for

mixed cultures, as Salmonella colonies can be easily distinguished on XLD plates from

other common food organisms.

142

A Salmonella fingerprinting database was created based on the ribotypes and pulsotypes

identification of a Salmonella serotype. The fact that

botyping with EcoRI is appropriate for serotype level identification was demonstrated

of known Salmonella serotypes obtained from ATCC, CDC, WADOH and turkey

carcasses. The unknown Salmonella serotypes received from various hospitals in Tampa

were typed by ribotyping and PFGE to validate the database. Based on the results of the

two typing techniques (Table 15) it is clear that the ribotyping gives a closer match to the

particular serotype compared to PFGE. The unknown S. Newport isolates demonstrated

90 to 100% similarity to S. Newport isolates in the database, whereas PFGE similarity

was only 65% to S. Newport. Similarly, the unknown S. Typhimurium isolates were 90 –

100% identical to the known S. Typhimurium in the database by ribotyping, whereas they

were only 55-72% related to S. Typhimurium by PFGE clusters. This was not the case

with S. Enteritidis, where both the techniques showed a high similarity of 80 – 95%

relatedness to the known S. Enteritidis. This demonstrates that S. Newport and S.

Typhimurium has a very diverse genome whereas S. Enteritidis has a homogenous

genome. The fact that S. Enteritidis has a homogenous genome was observed in many

studies (56, 118), therefore, it is not surprising that PFGE of S. Enteritidis generated a

closely related cluster. The ribotyping and PFGE data of the unknown S. Newport and S.

Typhimurium suggest that PFGE is more discriminatory compared to ribotyping for the

serotypes with less well-conserved genomes. However, being more discriminatory is not

necessarily an ideal feature for identification purposes, especially if the database has a

limited number of known isolates. Therefore ribotyping, which is not as discriminatory as

PFGE, could be used for initial

ri

143

(56). Since ribotyping with the automated RiboPrinter® is more rapid (nine hours

including sample preparation) than PFGE (26 hours), initial identification of Salmonella

species by ribotyping is suggested in a foodborne outbreak situation. However,

ribotyping by the RiboPrinter® is more expensive and may not be appropriate for use in

public health laboratories.

The discriminatory power of the two molecular typing methods including ribotyping and

PFGE and the phenotypic method, antibiotic susceptibility profiling was tested on the

100 wild type isolates from clinical and environmental sources. Manual ribotyping

analysis by using the TIFF images was more discriminatory compared to the automated

analysis by the RiboPrinter®. Manual analysis using BioNumerics® generated 62 types

for the 100 isolates whereas the automated analysis generated 58 types; the major

difference was seen in the closely related environmental isolates obtained from turkey

farms. The manual analysis is worth considering for all analyses using the RiboPrinter®

since it does not require a significantly longer time compared to the automated analysis.

Macrorestriction digestion analysis with XbaI enzyme generated the highest number of

profiles (74) compared to all the other typing techniques. A good correlation was seen

between profiles using XbaI and SpeI enzymes; however XbaI is preferable, not only

because it was slightly more discriminatory compared to SpeI but also because the bands

of XbaI digested gels were spread apart and were easy to interpret compared to SpeI,

bands. Dendrograms derived from antibiograms were the least discriminatory for the 100

isolates tested generating only 42 profiles. This could be because of the greater number of

144

susceptible clinical isolates from FLDOH. The data in this study illustrates that PFGE is

the most discriminatory compared to the other two techniques tested and this is consistent

with previous studies (66, 81, 119). Ribotyping using a combination of enzymes has

previously been shown to be more discriminatory than using one enzyme. For example,

ribotyping with PstI and SphI has proven to be very discriminatory for certain Salmonella

rotypes including S. Enteritidis and S. Typhimurium (118, 120). A combination of se

macrorestriction patterns from PFGE, ribotyping and antibiotic resistance profiles will be

very useful for rapid source tracking of Salmonella strains in an outbreak situation

Out of the 100 isolates, strains belonging to S. Newport represented the highest number

belonging to a single serotype. Therefore, these 30 isolates were analyzed in detail to

assess the discriminatory ability of the molecular typing methods and antibiotic resistance

profiling. This analysis was also done to see if there is any correlation between the DNA

fragment patterns and their respective antibiograms as observed by two studies involving

S. Newport (76, 213). PFGE with XbaI as well as SpeI generated 14 pulsotypes for the 30

isolates, illustrating the consensus between the two enzymes. Likewise, ribotyping

divided the isolates into fourteen types, clearly demonstrating that ribotyping using the

RiboPrinter® can be equally discriminatory when compared to PFGE for typing S.

Newport. It is interesting to note again that ribotyping using the automated RiboPrinter®

was more discriminatory when the fragment profiles were analyzed manually from TIFF

files than when the patterns were normalized by the RiboPrinter®. Fourteen profiles were

seen by manual analysis compared to the ten profiles obtained by the automated

145

normalization. A greater discrimination was seen in the environmental isolates using the

manual analysis compared to the automated analysis. Previous studies have shown that

PFGE further resolved the ribogroups (10, 42). However, we observed that both PFGE

and ribotyping further resolved groupings not differentiated by the other method. For

example, ribotype cluster 2 (Figure 14a) was further discriminated by PFGE into two

groups, B and C (Figure 15a). Likewise, PFGE cluster A (Figure 15a) was further divided

into clusters 1 and 3 by ribotyping (Figure 14a). This is the first report to our knowledge

that ribotyping using the automated RiboPrinter® with the enzyme EcoRI is as

discriminatory as PFGE for S. Newport, when analyzed manually from TIFF files.

All the environmental isolates from turkey carcasses formed a single major cluster using

both the ribotyping and PFGE. With ribotyping, the environmental isolates clustered at

92% or more similarity along with some clinical isolates (Figure 14a). With XbaI PFGE,

all the environmental isolates formed a unique cluster at 88% or more relatedness (Figure

15a). Similarly, PFGE performed on the environmental isolates with SpeI generated a

distinct group at 90% or more similarity (Figure 15b). This demonstrates that all the

environmental isolates are very closely related and PFGE clearly distinguished the

environmental isolates from the clinical isolates, as opposed to ribotyping. The PFGE and

ribotyping profiles of the four clinical isolates from WADOH were identical. These four

isolates were obtained from different sources (Table 5), and the fact that they have the

same molecular typing patterns suggests the possibility of an outbreak strain.

146

Two isolates, CBD 571 and CBD 572, which were previously serotyped as Salmonella

enterica serotype Bardo (S. Bardo) by conventional methods, showed very high

similarity with S. Newport using molecular subtyping methods. S. Newport and S. Bardo

have very similar antigenic formulas and differ by the presence or absence of O: 6

antigen. Ribotyping showed that CBD 571 was 96% similar to S. Newport (Figure 14a);

PFGE with Xba-1 showed 92% similarity (Figure 15a) and the SpeI PFGE showed 95%

relatedness (Figure 15b) to the S. Newport. Similarly, ribotyping of CBD 572 showed

100% identity with the S. Newport cluster (Figure 14a) and PFGE analysis with XbaI and

SpeI displayed 93% (Figure 15a) and 100% identity (Figure 15b) with the S. Newport,

spectively, prompting us to serotype the two putative S. Bardo isolates again. Both

g & PFGE

endrograms (Figure 14 and 15). Therefore, there was no clear distinction of the

re

strains typed as S. Newport, demonstrating that molecular techniques are not only rapid

but are also very powerful tools for identifying Salmonella serotypes, provided the profile

from the serotype is present in the database. Discrimination of these S. Newport strains

also confirms that molecular typing methods are very useful for outbreak investigations.

The typing of the strains based on their antibiotic susceptibilities, which gave rise to 23

profiles, was more discriminatory than either ribotyping or PFGE. When cluster analysis

of the macrorestriction profiles and the ribotypes were compared to the antibiotic

resistance dendrograms, no correlation was observed. The susceptible isolates, the

multidrug resistant strains and the isolates that were R or I to only one class of antibiotics

were distributed among various clusters as shown in the both the ribotypin

d

147

susceptible isolates from the resistant ones with PFGE, contrary to the results observed

(76, 213). Likewise, no such correlation was seen between the antibiotic resistance

patterns and the ribotyping patterns. A greater selection of antimicrobials was used in this

study and could be a factor contributing to the lack of correlation between PFGE and

resistance profiles. Cluster analysis of antibiotic susceptibilities was more discriminatory

compared to either of the molecular typing techniques and this could be because of very

high resistance in most of the S. Newport isolates tested.

Of the 100 clinical and environmental isolates tested, 60% were R or I to one or more

antimicrobials of which the majority were multiply resistant to antimicrobials. Forty

percent of the clinical isolates were R or I, of which, 83% belonged to isolates from

WADOH. The isolates from Tampa hospitals obtained through FLDOH were relatively

less resistant (29%). The cause of higher resistance among the clinical isolates of

WADOH compared to FLDOH is not known, but depends on the nature of the serotype

nd the year of isolation. A very large number of environmental strains (90%) were R or I a

to one or more antibiotics. The three environmental isolates, S. Oranienburg (CBD 429),

S. Apapa (CBD 430) and S. arizonae (CBD 432) that were isolated from bearded dragon,

lizard and snake respectively, showed R or I to nine or more drugs. Reptiles are not

usually subjected to antibiotic treatment like food animals or humans and the fact that

multidrug resistant Salmonella species were obtained from these sources is a cause for

concern. It was not surprising that 96% of turkey carcass isolates comprised of eight

serotypes were R or I to one or more drugs. These results imply that multiple antibiotic

148

resistance in Salmonella species is a major crisis especially in poultry farms as

demonstrated in several studies (29, 39, 163). The fact that the majority of the

environmental isolates (75%) in this study were obtained from two turkey plants might

have affected the antibiotic resistance distribution and possibly skewed the data. The high

antibiotic resistance in poultry isolates is consistant with other studies (29, 50). We

observed that the majority of resistant clinical isolates (70%) were R or I to Ch. Sixty two

percent of the clinical isolates showed R or I to extended spectrum cephalosporins or

ephams, which are a method of choice for treating salmonellosis in children (4). A high c

incidence of resistance to Str, Amp and Tet was also observed among the clinical and the

environmental isolates. On the whole 86% (52/60) of the resistant isolates showed

multiple drug resistant phenotype.

The presence of integrons was tested by PCR to identify the basis for the high occurrence

of multiple drug resistance among the resistant isolates. Integrons with four different

profiles were seen in 21% of the multidrug resistant isolates and one isolate of the non-

MDR phenotype. Five S. Typhimurium isolates had two integrons (1.2 Kb and 1.0 Kb)

harboring the genes pse1 and aadA2 respectively. This two-integron pattern is a

characteristic feature of S. Typhimurium DT104 (11, 131). Whether these five isolates

are DT104 is yet to be determined. The integrons of six environmental isolates from

turkey farms were identical based on the sequencing results. Similarly, sequencing

revealed that the 1.0 Kb integrons are identical and the 1.2 Kb integrons are identical

among the five S. Typhimurium isolates. S. Paratyphi A (CBD 436) was R or I to only

149

Nal, and was susceptible to all aminoglycosides including Str, G, K and Tob tested.

However, the 1.6 Kb integron of S. Paratyphi A had the aadA2 gene encoding resistance

to aminoglycosides. This suggests that the aadA2 gene in this integron cassette is not

expressed. Whether this is due to the lack of promoter in the 5’ region or mutation of the

gene is yet to be determined. The presence of silent aadA2 or strA genes encoding

resistance to streptomycin is not unusual (169, 206). aadA2 genes were seen on the 2 Kb

integrons in three isolates that were susceptible to aminoglycosides in a study by White et

al. (206).

It was surprising to see no integrons in the multidrug resistant isolates that were R or I to

ten or more antibiotics, including the four S. Newport isolates from WADOH. It was

ssumed that the integron gene cassettes are of several Kb and therefore were not a

amplified by the primers targeting the entire integrons. Therefore, PCR with primers

targeting only the integrase gene was performed. However, these results were not

encouraging and were similar to the ones obtained with the primers targeting the

integron. So it is possible that there are no integrons in those isolates, and integrons are

probably not as prevalent as hypothesized in multiply resistant isolates. Overall, 12% of

the 100 isolates had class-1 integrons, and this finding is consistent with other studies (2,

83). However, further studies with more primers targeting integrons and subsequent

sequencing is needed to conclude that the rest of the 39 multidrug resistant isolates do not

have integrons. Also, the presence of integrons of other classes including class-2 and

class-3 is possible and needs to be verified.

150

To identify the location of the integrons, plasmid DNA was amplified with primers

targeting the integrons in 11 isolates shown in Figure 17. The plasmid prep of all 11

isolates tested was positive for integrons. However, further testing of the plasmid DNA

with a chromosomal marker revealed contamination of the plasmid DNA with

chromosomal DNA. Southern hybridization of the XbaI digested PFGE gel isolates

containing the 1.0 integron fragments revealed that the integrons are present below the 33

Kb region in the four S. Typhimurium isolates and on the 173 Kb fragment in S.

uenster, CBD 580. Based on this data it is clear that the integron of CBD 580 is in fact M

chromosomal as hypothesized. Also, chromosomal location of the integron of CBD 581,

which is also a S. Muenster and appears to be a clone of CBD 580 is expected. Based on

several studies and our data, it is reasonable to speculate that the integrons of the S.

Typhimurium isolates are not located on plasmids, but are in fact on the 10 Kb band of

XbaI digested gel which is a part of SGI (53, 64). The pentadrug resistance profiles

(resistance to ACSuST), the two-integron pattern and also the location of the integrons

suggest that the five clinical isolates S. Typhimurium (CBD 438, 746, 777, 816 and 823)

are of phage type DT104. Further testing is needed to prove this. In general, resistance to

sulfonamides is a characteristic feature of the presence of class-1 integrons, as integrons

have sul1 gene on the 3’ end (185). However, out of 35 isolates that were R or I to Smx,

only 11 had class-1 integrons. It is also possible that some of the isolates have partial

integrons with only a functional 5’ end.

151

Association of integrons with two ion transporter genes belonging to SPI-1 and SPI-3

ended for accurate identification of Salmonella

ecies in food. Application of IMS for isolation of Salmonella species from foods with

was verified. The integrons and the two ion transporter genes (iron transporter gene sitB

and magnesium transporter gene magA) were located in different bands showing clearly

that there was no association between the two. Studies in Shigella flexneri have shown

the iron transporter system is located on a pathogenicity island and is associated with

multiple antibiotic resistance genes encoding resistance to Tet, Ch and Amp (127, 195).

This association of antibiotic resistance genes and pathogenicity island was also observed

in the high pathogenicity island (HPI) of Yersinia. It was observed by deChamps et al.

that the Klebsiella isolates that were resistant to Nal and Aug were more likely to possess

the Yersinia HPI (57). However, in this study any physical association of the integrons

with SPI-1 and SPI-3 genes (with iron and magnesium transport systems) was not

observed. It is possible that other antibiotic resistance genes that are not on the integrons

are associated with one of the five SPI. Further studies involving antibiotic resistance

genes that are not associated with integrons but are chromosomal in location are needed

to verify any association with SPI.

In conclusion, ompF gene was shown to be the most reliable marker when compared to

other genes for the rapid detection of Salmonella species by real time PCR. General

enrichment in BPW is adequate for the detection for Salmonella from food by real time

PCR; further enrichment in TT broth was not beneficial. However, a longer general

enrichment of about 8 hours is recomm

sp

152

low Salmonella inoculum was demonstrated to recover significantly greater numbers of

colonies compared to TT broth enrichment. IMS was shown to be a superior enrichment

for isolation of Salmonella compared to TT broth for most foods with mixed

backgrounds. Since IMS takes three hours less than TT broth enrichment and provides

pure colonies in 25 hours, it is the method of choice for Salmonella isolation for most

food groups. As hypothesized, macrorestriction profiling with PFGE was the most

discriminatory technique for typing of clinical and environmental Salmonella isolates.

However, ribotyping with EcoRI by the automated RiboPrinter® that requires only 9

hours is suggested for preliminary identification and typing of Salmonella species in case

of an outbreak or a BT event. When the clinical and environmental isolates from three

different geographical locations were tested for resistance to 31 antibiotics, 60% were R

or I to one or more drugs and the majority showed multidrug resistant phenotype. It was

interesting to observe that the clinical isolates from FL were the least resistant compared

any other isolates. Class-1 integrons were noted in 12/60 (20%) resistant isolates. The

location of the integrons seems to be chromosomal for at least five of the isolates as

ypothesized. Contrary to our hypothesis, no physical association between the h

pathogenicity islands and the integrons was observed.

153

Chapter Five - Significance of the Research

The gene ompF, which has not been previously used as a target by any study for the

detection of Salmonella by PCR, was established to be a reliable marker for the detection

of Salmonella subspecies I, III and IV. Primers for the gene ompF gene were also tested

for the detection of Salmonella species form artificially contaminated food samples

enriched in general enrichment and selective enrichment. It was shown in this study that

further enrichment in TT broth was not required for detection of Salmonella from

artificially contaminated food samples. A detection limit of 1-10 CFU of Salmonella in

25 gm of food was achieved in 8 hours, 75% of the time by means of the real time PCR.

Pure culture of Salmonella is a prerequisite to do any biochemical or molecular analysis

for source tracking. Isolating pure Salmonella colonies in a rapid fashion is especially

important during an outbreak or a BT event when time is the rate-limiting step. However,

not many studies have focused on the rapid isolation of Salmonella species from food.

We have shown for the first time that isolation of pure Salmonella colonies on selective

agar is possible in 25 hours starting from contaminated food samples. This accelerated

isolation protocol yielded pure culture and could be applied for molecular subtyping,

ntibiotic susceptibility testing and further serological and biochemical analyses. This

rotocol could be applicable to other organisms or other matrices including stool or

lood. In this study, a DNA fingerprinting database of more than 100 Salmonella strains

as created. This database included both ribotyping and PFGE profiles of strains from

linical and environmental sources. This database will be useful for identification of

a

p

b

w

c

154

unknown Salmonella database could be

ompared with the CDC PulseNet database in future to unravel any epidemiological links

isolates received by FLDOH. The PFGE

c

between the Florida isolates and other isolates. The incorrect serotyping of two S.

Newport isolates was determined by using the database. The antibiotic susceptibility

patterns and the resistance mechanisms of 100 isolates from three different geographical

locations were studied. Difference in the susceptibility patterns of Florida isolates and the

isolates from two other locations was observed. A study probing the association of

Salmonella virulence genes and antibiotic resistance genes was initiated. Southern

hybridization probes for various antibiotic resistance genes (β-lactamase, tetracycline,

and chloramphenicol) and virulence genes including invA, and phoP/Q were designed to

study the association further.

155

Chapter Six - Future Directions

Salmonella enterica isolates from subspecies II, VI, other serotypes of subspecies I and

also Salmonella bongeri strains need to be tested for the presence of ompF gene to

confirm that this target is applicable for the detection of all Salmonella isolates. For the

detection of Salmonella species from spiked food, the samples were incubated for six

hours in BPW, this resulted in positive PCR results only 75% of the time. To get 100%

results, the samples need to be incubated for longer time. Therefore, in the future the

DNA needs to be extracted and tested every two hours, after the six hour enrichment. In

this study it was observed that enrichment in conventional selective broth (TT) provided

a greater number of colonies compared to IMS for cheese. Further studies should verify if

is is true for other foods with high fat content.

he Salmonella isolates obtained from WADOH and turkey farms from the Midwest,

owed a higher prevalence of resistance to antibiotics compared to the ones from

LDOH. In future it will be interesting to observe if this represents a trend in these states.

ntibiotic susceptibility testing of isolates from various geographical distributions will

elp us understand if the isolates from FL are truly more susceptible compared to other

gions. In this study the integrons of at least five isolates have been tentatively

etermined to be present in the chromosomes; however, to prove the precise location of

e integrons, conjugation experiments need to be performed. If the resistance is not

ansferred it can be confirmed that the integrons are indeed chromosomal. A vast

th

T

sh

F

A

h

re

d

th

tr

156

majority of multidrug resist resence of integrons, it is

ossible that these isolates have integrons with several gene cassettes and are not being

ant isolates did not show the p

p

amplified using conventional PCR. A long PCR with primers directed against the entire

integrons might elucidate the presence or absence of integrons. Also, it is possible that

these isolates harbor other classes of integrons including class-2 or class-3. The

association between integrons and SPI-1 and SPI-3 was verified in this study. The

possible relationship between integrons and other SPIs, or between antibiotic resistance

genes outside integrons and SPI needs to be tested. An alternative way to verify the

association between virulence and antibiotic resistance would be to see if any of the

antibiotic resistance genes are located on the Salmonella virulence plasmid as observed

by Villa and Carotolli recently (199).

157

References

1. Agarwal, A., A. Makker, and S. K. Goel. 2002. Application of the PCR

technique for a rapid, specific and sensitive detection of Salmonella spp. in foods.

Mol Cell Probes 16:243-50.

2. Ahmed, A. M., H. Nakano, and T. Shimamoto. 2005. Molecular

characterization of integrons in non-typhoid Salmonella serovars isolated in

Japan: description of an unusual class 2 integron. J Antimicrob Chemother

55:371-4.

3. Ahmed, R., G. Soule, W. H. Demczuk, C. Clark, R. Khakhria, S. Ratnam, S.

Marshall, L. K. Ng, D. L. Woodward, W. M. Johnson, and F. G. Rodgers.

2000. Epidemiologic typing of Salmonella enterica serotype enteritidis in a

Canada-wide outbreak of gastroenteritis due to contaminated cheese. J Clin

Microbiol 38:2403-6.

4. Allen, K. J., and C. Poppe. 2002. Occurrence and characterization of resistance

to extended-spectrum cephalosporins mediated by beta-lactamase CMY-2 in

Salmonella isolated from food-producing animals in Canada. Can J Vet Res

66:137-44.

5. Amavisit, P., D. Lightfoot, G. F. Browning, and P. F. Markham. 2003.

Variation between pathogenic serovars within Salmonella pathogenicity islands. J

Bacteriol 185:3624-35.

6. Angulo, F. J., V. N. Nargund, and T. C. Chiller. 2004. Evidence of an

association between use of anti-microbial agents in food animals and anti-

158

microbial resistance among bac from humans and the human health

consequences of such resistance. J Vet Med B Infect Dis Vet Public Health

51:374-9.

7. Antunes, P., J. Machado, J. C. Sousa, and L. Peixe. 2004. Dissemination

amongst humans and food products of animal origin of a Salmonella typhimurium

clone expressing an integron-borne OXA-30 beta-lactamase. J Antimicrob

Chemother 54:429-34.

8. Antunes, P., J. Machado, J. C. Sousa, and L. Peixe. 2005. Dissemination of

sulfonamide resistance genes (sul1, sul2, and sul3) in Portuguese Salmonella

enterica strains and relation with integrons. Antimicrob Agents Chemother

49:836-9.

9. Armand-Lefevre, L., V. Leflon-Guibout, J. Bredin, F. Barguellil, A. Amor, J.

M. Pages, and M. H. Nicolas-Chanoine. 2003. Imipenem resistance in

Salmonella enterica serovar Wien related to porin loss and CMY-4 beta-

lactamase production. Antimicrob Agents Chemother 47:1165-8.

10. Badrinath, P., T. Sundkvist, H. Mahgoub, and R. Kent. 2004. An outbreak of

Salmonella enteritidis phage type 34a infection associated with a Chinese

restaurant in Suffolk, United Kingdom. BMC Public Health 4:40.

11. Baggesen, D. L., D. Sandvang, and F. M. Aarestrup. 2000. Characterization of

Salmonella enterica serovar typhimurium DT104 isolated from Denmark and

comparison with isolates from Europe and the United States. J Clin Microbiol

38:1581-6.

teria isolated

159

12.

J

82:3467-74.

a,

14. tto, A. Martinez, M. Pereira, G. Algorta, M. A.

to

n Microbiol 42:1155-62.

16.

biol Rev 7:311-

17. iotic-

949-53.

19.

K. Kaneko, and M. Ogawa. 1998. Epidemiological analysis of

Barbosa, T. M., and S. B. Levy. 2000. Differential expression of over 60

chromosomal genes in Escherichia coli by constitutive expression of MarA.

Bacteriol 1

13. Belgrader, P., W. Benett, D. Hadley, J. Richards, P. Stratton, R. Mariell

Jr., and F. Milanovich. 1999. PCR detection of bacteria in seven minutes.

Science 284:449-50.

Betancor, L., F. Schelo

Rodriguez, R. Vignoli, and J. A. Chabalgoity. 2004. Random amplified

polymorphic DNA and phenotyping analysis of Salmonella enterica serovar

enteritidis isolates collected from humans and poultry in Uruguay from 1995

2002. J Cli

15. Beuchat, L. R., and J. H. Ryu. 1997. Produce handling and processing practices.

Emerg Infect Dis 3:459-65.

Bingen, E. H., E. Denamur, and J. Elion. 1994. Use of ribotyping in

epidemiological surveillance of nosocomial outbreaks. Clin Micro

27.

Bjorkman, J., D. Hughes, and D. I. Andersson. 1998. Virulence of antib

resistant Salmonella typhimurium. Proc Natl Acad Sci U S A 95:3

18. Blanc-Potard, A. B., F. Solomon, J. Kayser, and E. A. Groisman. 1999. The

SPI-3 pathogenicity island of Salmonella enterica. J Bacteriol 181:998-1004.

Boonmar, S., A. Bangtrakulnonth, S. Pornrunangwong, J. Terajima, H.

Watanabe,

160

Salmonella enteritidis isolates from humans and broiler chickens in Thailan

phage typing and pulsed-field gel electrophoresis. J Clin Microbiol 36:971-4.

Bopp, C. A., F.W. Bren

d by

20. ner, J.G. Wells, N.A. Stockbine. 1999. Escherichia,

.

Microbiology, Washington, DC.

22. d M. R. Mulvey. 2000. Partial

a Typhymurium DT104. FEMS Microbiol Lett

23.

. Salmonella nomenclature. J Clin Microbiol 38:2465-7.

ona

25.

Shigella and Salmonella, p.459-474. In P.R. Murray, E.J. Barron, M.A. Pfaller,

F.C. Tenover, and R.H. Yolken (ed.), Manual of clinical microbiology, 7th ed

American Society for

21. Botteldoorn, N., L. Herman, N. Rijpens, and M. Heyndrickx. 2004.

Phenotypic and molecular typing of Salmonella strains reveals different

contamination sources in two commercial pig slaughterhouses. Appl Environ

Microbiol 70:5305-14.

Boyd, D. A., G. A. Peters, L. Ng, an

characterization of a genomic island associated with the multidrug resistance

region of Salmonella enteric

189:285-91.

Brenner, F. W., R. G. Villar, F. J. Angulo, R. Tauxe, and B. Swaminathan.

2000

24. Brenner Michael, G., M. Cardoso, and S. Schwarz. 2005. Class 1 integron-

associated gene cassettes in Salmonella enterica subsp. enterica serovar Ag

isolated from pig carcasses in Brazil. J Antimicrob Chemother 55:776-9.

Briggs, C. E., and P. M. Fratamico. 1999. Molecular characterization of an

antibiotic resistance gene cluster of Salmonella typhimurium DT104. Antimicrob

Agents Chemother 43:846-9.

161

26.

27.

M. A.

sm of

g

icrob Agents Chemother 48:3934-9.

h

30. , and F. M. Collins. 1974. The route of enteric infection in normal

31. ornax, M. C.

of a

ns

ortal Wkly Rep 52:613-5.

Brown, A. W., S. C. Rankin, and D. J. Platt. 2000. Detection and

characterisation of integrons in Salmonella enterica serotype enteritidis. FEMS

Microbiol Lett 191:145-9.

Burr, M. D., K. L. Josephson, and I. L. Pepper. 1998. An evaluation of ERIC

PCR and AP PCR fingerprinting for discriminating Salmonella serotypes. Lett

Appl Microbiol 27:24-30.

28. Cabrera, R., J. Ruiz, F. Marco, I. Oliveira, M. Arroyo, A. Aladuena,

Usera, M. T. Jimenez De Anta, J. Gascon, and J. Vila. 2004. Mechani

resistance to several antimicrobial agents in Salmonella Clinical isolates causin

traveler's diarrhea. Antim

29. Carraminana, J. J., C. Rota, I. Agustin, and A. Herrera. 2004. Hig

prevalence of multiple resistance to antibiotics in Salmonella serovars isolated

from a poultry slaughterhouse in Spain. Vet Microbiol 104:133-9.

Carter, P. B.

mice. J Exp Med 139:1189-203.

Castro, D., M. A. Morinigo, E. Martinez-Manzanares, R. C

Balebona, A. Luque, and J. J. Borrego. 1992. Development and application

new scheme of phages for typing and differentiating Salmonella strains from

different sources. J Clin Microbiol 30:1418-23.

32. 2003, CDC. Multistate outbreak of Salmonella serotype typhimurium infectio

associated with drinking unpasteurized milk--Illinois, Indiana, Ohio, and

Tennessee, 2002-2003. Morb M

162

33. 2005, CDC. Outbreaks of Salmonella infections associated with eatin

tomatoes--United States and Canada, 2004. Morb Mortal Wkly Rep 54:325-8.

2001, CDC. Recognition of

g Roma

34. illness associated with the intentional release of a

35.

g salad--Oregon, 2003. Morb Mortal Wkly Rep

36. .

M. S.

Serovar

ous

l

biologic agent. Morb Mortal Wkly Rep 50:893-7.

2004 CDC. Salmonella serotype Typhimurium outbreak associated with

commercially processed eg

53:1132-4.

Chadfield, M., M. Skov, J. Christensen, M. Madsen, and M. Bisgaard. 2001

An epidemiological study of Salmonella enterica serovar 4, 12:b:- in broiler

chickens in Denmark. Vet Microbiol 82:233-47.

37. Chang, C. C., Y. H. Lin, C. F. Chang, K. S. Yeh, C. H. Chiu, C. Chu,

Chien, Y. M. Hsu, L. S. Tsai, and C. S. Chiou. 2005. Epidemiologic

relationship between fluoroquinolone-resistant Salmonella enterica

Choleraesuis strains isolated from humans and pigs in Taiwan (1997 to 2002). J

Clin Microbiol 43:2798-804.

38. Chen, J., and M. W. Griffiths. 2001. Detection of Salmonella and simultane

detection of Salmonella and Shiga-like toxin-producing Escherichia coli using the

magnetic capture hybridization polymerase chain reaction. Lett Appl Microbio

32:7-11.

39. Chen, S., S. Zhao, D. G. White, C. M. Schroeder, R. Lu, H. Yang, P. F.

McDermott, S. Ayers, and J. Meng. 2004. Characterization of multiple-

163

antimicrobial-resistant Salmonella serovars isolated from retail meats. Appl

Environ Microbiol 70:1-7.

40. Chen, W., G. Martinez, and A. Mulchandani. 2000. Molecular beacons: a re

time polymerase chain reaction assay for detecting

al-

Salmonella. Anal Biochem

41. r

ion of an enterotoxin from Salmonella typhimurium. Microb Pathog

42.

al isolates of Salmonella

43. . Rodgers.

l and

44. B. A. Vallance, and B. B. Finlay. 2005.

45. . L., and R. V. Tauxe. 1986. Drug-resistant Salmonella in the United

280:166-72.

Chopra, A. K., J. W. Peterson, P. Chary, and R. Prasad. 1994. Molecula

characterizat

16:85-98.

Chu, C., C. H. Chiu, W. Y. Wu, C. H. Chu, T. P. Liu, and J. T. Ou. 2001.

Large drug resistance virulence plasmids of clinic

enterica serovar Choleraesuis. Antimicrob Agents Chemother 45:2299-303.

Clark, C. G., T. M. Kruk, L. Bryden, Y. Hirvi, R. Ahmed, and F. G

2003. Subtyping of Salmonella enterica serotype enteritidis strains by manua

automated PstI-SphI ribotyping. J Clin Microbiol 41:27-33.

Coburn, B., Y. Li, D. Owen,

Salmonella enterica serovar Typhimurium pathogenicity island 2 is necessary for

complete virulence in a mouse model of infectious enterocolitis. Infect Immun

73:3219-27.

Cohen, M

States: an epidemiologic perspective. Science 234:964-9.

164

46.

ed by the integron DNA integrase. J Bacteriol

47. n

from foods and their detection using immunomagnetic particle

48.

ing Dynabeads anti-Salmonella and a conventional reference method.

49. ment

5.

8-11.

52. uckley, E. Power, C. O'Hare, M. Cormican, B. Cryan, P. G.

ns and assessment of

genetic relationships by DNA amplification fingerprinting. Appl Environ

Microbiol 66:614-9.

Collis, C. M., and R. M. Hall. 1992. Site-specific deletion and rearrangement of

integron insert genes catalyz

174:1574-85.

Cudjoe, K. S., T. Hagtvedt, and R. Dainty. 1995. Immunomagnetic separatio

of Salmonella

(IMP)-ELISA. Int J Food Microbiol 27:11-25.

Cudjoe, K. S., and R. Krona. 1997. Detection of Salmonella from raw food

samples us

Int J Food Microbiol 37:55-62.

Cudjoe, K. S., R. Krona, and E. Olsen. 1994. IMS: a new selective enrich

technique for detection of Salmonella in foods. Int J Food Microbiol 23:159-6

50. Cui, S., B. Ge, J. Zheng, and J. Meng. 2005. Prevalence and antimicrobial

resistance of Campylobacter spp. and Salmonella Serovars in organic chickens

from Maryland retail stores. Appl Environ Microbiol 71:410

51. Daly, M., J. Buckley, E. Power, and S. Fanning. 2004. Evidence for a

chromosomally located third integron in Salmonella enterica serovar

Typhimurium DT104b. Antimicrob Agents Chemother 48:1350-2.

Daly, M., J. B

Wall, and S. Fanning. 2000. Molecular characterization of Irish Salmonella

enterica serotype typhimurium: detection of class I integro

165

53. Daly, M., and S. Fanning. 2000. Characterization and chromosomal mapping of

antimicrobial resistance genes in Salmonella enterica serotype Typhimurium

Appl Environ M

.

icrobiol 66:4842-8.

02.

ct foods from a gastroenteritis

55.

, P. T. Amuso, and J. Cattanii. 2004. Real-time

56.

morphic DNA

57. C.

l

al.

58. Toti.

NA extraction methods for use in combination with SYBR

54. Daum, L. T., W. J. Barnes, J. C. McAvin, M. S. Neidert, L. A. Cooper, W. B.

Huff, L. Gaul, W. S. Riggins, S. Morris, A. Salmen, and K. L. Lohman. 20

Real-time PCR detection of Salmonella in suspe

outbreak in Kerr county, Texas. J Clin Microbiol 40:3050-2.

Davis, C. R., L. C. Heller, K. K. Peak, D. L. Wingfield, C. L. Goldstein-Hart,

D. W. Bodager, A. C. Cannons

PCR detection of the thermostable direct hemolysin and thermolabile hemolysin

genes in a Vibrio parahaemolyticus cultured from mussels and mussel

homogenate associated with a foodborne outbreak. J Food Prot 67:1005-8.

De Cesare, A., G. Manfreda, T. R. Dambaugh, M. E. Guerzoni, and A.

Franchini. 2001. Automated ribotyping and random amplified poly

analysis for molecular typing of Salmonella enteritidis and Salmonella

typhimurium strains isolated in Italy. J Appl Microbiol 91:780-5.

De Champs, C., C. Rich, P. Chandezon, C. Chanal, D. Sirot, and

Forestier. 2004. Factors associated with antimicrobial resistance among clinica

isolates of Klebsiella pneumoniae: 1-year survey in a French university hospit

Eur J Clin Microbiol Infect Dis 23:456-62.

De Medici, D., L. Croci, E. Delibato, S. Di Pasquale, E. Filetici, and L.

2003. Evaluation of D

166

green I real-time PCR to detect Salmonella enterica serotype enteritidis in

poultry. Appl Environ Microbiol 69:3456-61.

Deiwick, J., T. Nikolaus, J. E. Shea59. , C. Gleeson, D. W. Holden, and M.

60. nd A. Brandelli.

61. with dairy

. P.

chicken

cla, and

64. isabois, D. Boyd, M. R. Mulvey, E.

Hensel. 1998. Mutations in Salmonella pathogenicity island 2 (SPI2) genes

affecting transcription of SPI1 genes and resistance to antimicrobial agents. J

Bacteriol 180:4775-80.

Dias de Oliveira, S., F. Siqueira Flores, L. R. dos Santos, a

2005. Antimicrobial resistance in Salmonella enteritidis strains isolated from

broiler carcasses, food, human and poultry-related samples. Int J Food Microbiol

97:297-305.

Donnelly, C. W. 1990. Concerns of microbial pathogens in association

foods. J Dairy Sci 73:1656-61.

62. dos Santos, L. R., V. P. do Nascimento, S. D. de Oliveira, M. L. Flores, A

Pontes, A. R. Ribeiro, C. T. Salle, and R. F. Lopes. 2001. Polymerase chain

reaction (PCR) for the detection of Salmonella in artificially inoculated

meat. Rev Inst Med Trop Sao Paulo 43:247-50.

63. Doublet, B., P. Butaye, H. Imberechts, J. M. Collard, E. Chaslus-Dan

A. Cloeckaert. 2004. Salmonella agona harboring genomic island 1-A. Emerg

Infect Dis 10:756-8.

Doublet, B., R. Lailler, D. Meunier, A. Br

Chaslus-Dancla, and A. Cloeckaert. 2003. Variant Salmonella genomic island 1

167

antibiotic resistance gene cluster in Salmonella enterica serovar Albany. Em

Infect Dis 9:585-91.

erg

mic

67. 2004.

eat meat products. Mol Cell Probes 18:51-7.

-

Appl Microbiol 34:37-41.

65. Ebner, P., K. Garner, and A. Mathew. 2004. Class 1 integrons in various

Salmonella enterica serovars isolated from animals and identification of geno

island SGI1 in Salmonella enterica var. Meleagridis. J Antimicrob Chemother

53:1004-9.

66. Ebner, P. D., and A. G. Mathew. 2001. Three molecular methods to identify

Salmonella enterica serotype Typhimurium DT104: PCR fingerprinting,

multiplex PCR and rapid PFGE. FEMS Microbiol Lett 205:25-9.

Ellingson, J. L., J. L. Anderson, S. A. Carlson, and V. K. Sharma.

Twelve hour real-time PCR technique for the sensitive and specific detection of

Salmonella in raw and ready-to-

68. Eriksson, J., C. Lofstrom, A. Aspan, A. Gunnarsson, I. Karlsson, E. Borch,

B. de Jong, and P. Radstrom. 2005. Comparison of genotyping methods by

application to Salmonella livingstone strains associated with an outbreak of

human salmonellosis. Int J Food Microbiol.

69. Esteban, E., K. Snipes, D. Hird, R. Kasten, and H. Kinde. 1993. Use of

ribotyping for characterization of Salmonella serotypes. J Clin Microbiol 31:233

7.

70. Eyigor, A., K. T. Carli, and C. B. Unal. 2002. Implementation of real-time PCR

to tetrathionate broth enrichment step of Salmonella detection in poultry. Lett

168

71. g

ry ability of pulsed-field gel electrophoresis for typing

72.

Salmonella enterica serovar enteritidis in broth. Appl Environ

73. A. C.

monella

74.

75.

ction

es in E. coli O157:H7. Mol Cell

76.

typing and pulsed-field gel electrophoresis for rapid identification of

Fakhr, M. K., L. K. Nolan, and C. M. Logue. 2005. Multilocus sequence typin

lacks the discriminato

Salmonella enterica serovar Typhimurium. J Clin Microbiol 43:2215-9.

Favrin, S. J., S. A. Jassim, and M. W. Griffiths. 2001. Development and

optimization of a novel immunomagnetic separation- bacteriophage assay for

detection of

Microbiol 67:217-24.

Fernandes, S. A., A. C. Ghilardi, A. T. Tavechio, A. M. Machado, and

Pignatari. 2003. Phenotypic and molecular characterization of Sal

Enteritidis strains isolated in Sao Paulo, Brazil. Rev Inst Med Trop Sao Paulo

45:59-63.

Finlay, B. B. 1994. Molecular and cellular mechanisms of Salmonella

pathogenesis. Curr Top Microbiol Immunol 192:163-85.

Fitzmaurice, J., M. Glennon, G. Duffy, J. J. Sheridan, C. Carroll, and M.

Maher. 2004. Application of real-time PCR and RT-PCR assays for the dete

and quantitation of VT 1 and VT 2 toxin gen

Probes 18:123-32.

Fontana, J., A. Stout, B. Bolstorff, and R. Timperi. 2003. Automated

ribo

multidrug-resistant Salmonella serotype Newport. Emerg Infect Dis 9:496-9.

169

77. Fukushima, H., Y. Tsunomori, and R. Seki. 2003. Duplex real-time SYBR

green PCR assays for detection of 17 species of food- or waterborne pathogen

stools. J Clin Microbiol 41:5134-46.

s in

blin

retion

a. Mol Microbiol 25:903-12.

of

80. W. E. Keene, J. C. Mohle-Boetani, J. A. Farrar, P. L. Waller, C.

82. ., H. Hardardottir, and E. Gunnarsson. 2003. Subtyping of

humans

83. nce

and spread of class 1 integrons among Salmonella serotypes. Antimicrob Agents

Chemother 44:2166-9.

78. Galyov, E. E., M. W. Wood, R. Rosqvist, P. B. Mullan, P. R. Watson, S.

Hedges, and T. S. Wallis. 1997. A secreted effector protein of Salmonella Du

is translocated into eukaryotic cells and mediates inflammation and fluid sec

in infected ileal mucos

79. Gebreyes, W. A., and S. Thakur. 2005. Multidrug-resistant Salmonella enterica

serovar Muenchen from pigs and humans and potential interserovar transfer

antimicrobial resistance. Antimicrob Agents Chemother 49:503-11.

Gill, C. J.,

G. Hahn, and P. R. Cieslak. 2003. Alfalfa seed decontamination in a Salmonella

outbreak. Emerg Infect Dis 9:474-9.

81. Gorman, R., and C. C. Adley. 2004. Characterization of Salmonella enterica

serotype Typhimurium isolates from human, food, and animal sources in the

Republic of Ireland. J Clin Microbiol 42:2314-6.

Gudmundsdottir, S

Salmonella enterica serovar Typhimurium outbreak strains isolated from

and animals in Iceland. J Clin Microbiol 41:4833-5.

Guerra, B., S. Soto, S. Cal, and M. C. Mendoza. 2000. Antimicrobial resista

170

84. Hanai, K., M. Satake, H. Nakanishi, and K. Venkateswaran. 1997.

Comparison of commercially available kits with standard methods for detection of

Salmonella strains in foods. Appl Env

iron Microbiol 63:775-8.

sfer

86. based identification of

87. .

n of

88. uing problem. Postgrad Med J 80:541-5.

of

er

Escherichia coli by real-time

91.

lymerase chain reaction product by utilizing the 5'----3'

85. Hansen-Wester, I., D. Chakravortty, and M. Hensel. 2004. Functional tran

of Salmonella pathogenicity island 2 to Salmonella bongori and Escherichia coli.

Infect Immun 72:2879-88.

Hansen-Wester, I., and M. Hensel. 2002. Genome-

chromosomal regions specific for Salmonella spp. Infect Immun 70:2351-60.

Hara-Kudo, Y., S. Kumagai, T. Masuda, K. Goto, K. Ohtsuka, H. Masaki, H

Tanaka, K. Tanno, M. Miyahara, and H. Konuma. 2001. Detectio

Salmonella enteritidis in shell and liquid eggs using enrichment and plating. Int J

Food Microbiol 64:395-9.

Hardy, A. 2004. Salmonella: a contin

89. He, X. Q., and R. N. Pan. 1992. Bacteriophage lytic patterns for identification

Salmonellae, shigellae, Escherichia coli, Citrobacter freundii, and Enterobact

cloacae. J Clin Microbiol 30:590-4.

90. Heller, L. C., C. R. Davis, K. K. Peak, D. Wingfield, A. C. Cannons, P. T.

Amuso, and J. Cattani. 2003. Comparison of methods for DNA isolation from

food samples for detection of Shiga toxin-producing

PCR. Appl Environ Microbiol 69:1844-6.

Holland, P. M., R. D. Abramson, R. Watson, and D. H. Gelfand. 1991.

Detection of specific po

171

exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl

U S A 88:7276-80.

Hollis, R. J., J. L. Bruce, S. J. Fritschel, and M. A. Pfaller. 19

Acad Sci

92. 99. Comparative

34:263-8.

ation

94. tem

ol 35:1146-55.

a

96. iew, and G. L. Gilbert. 2001. Practical

ue

97.

uires the Salmonella pathogenicity

d 1

evaluation of an automated ribotyping instrument versus pulsed-field gel

electrophoresis for epidemiological investigation of clinical isolates of bacteria.

Diagn Microbiol Infect Dis

93. Hsih, H. Y., and H. Y. Tsen. 2001. Combination of immunomagnetic separ

and polymerase chain reaction for the simultaneous detection of Listeria

monocytogenes and Salmonella spp. in food samples. J Food Prot 64:1744-50.

Janakiraman, A., and J. M. Slauch. 2000. The putative iron transport sys

SitABCD encoded on SPI1 is required for full virulence of Salmonella

typhimurium. Mol Microbi

95. Jenikova, G., J. Pazlarova, and K. Demnerova. 2000. Detection of Salmonell

in food samples by the combination of immunomagnetic separation and PCR

assay. Int Microbiol 3:225-9.

Jeoffreys, N. J., G. S. James, R. Ch

evaluation of molecular subtyping and phage typing in outbreaks of infection d

to Salmonella enterica serotype Typhimurium. Pathology 33:66-72.

Jones, M. A., P. Wigley, K. L. Page, S. D. Hulme, and P. A. Barrow. 2001.

Salmonella enterica serovar Gallinarum req

island 2 type III secretion system but not the Salmonella pathogenicity islan

type III secretion system for virulence in chickens. Infect Immun 69:5471-6.

172

98.

gy:61-66.

using

100. ituria, A. Munyalo, D.

are

separate type III secretion systems.

102.

me responses for optimization of a high-throughput

0.

103.

ratory

104.

Jordan, J. A. 2000. Real Time Detection of PCR Products and Microbiology.

Trends in Microbiolo

99. Kakinuma, K., M. Fukushima, and R. Kawaguchi. 2003. Detection and

identification of Escherichia coli, Shigella, and Salmonella by microarrays

the gyrB gene. Biotechnol Bioeng 83:721-8.

Kariuki, S., G. Revathi, N. Kariuki, J. Muyodi, J. Mw

Kagendo, L. Murungi, and C. Anthony Hart. 2005. Increasing prevalence of

multidrug-resistant non-typhoidal Salmonellae, Kenya, 1994-2003. Int J

Antimicrob Agents 25:38-43.

101. Knodler, L. A., J. Celli, W. D. Hardt, B. A. Vallance, C. Yip, and B. B.

Finlay. 2002. Salmonella effectors within a single pathogenicity island

differentially expressed and translocated by

Mol Microbiol 43:1089-103.

Knutsson, R., C. Lofstrom, H. Grage, J. Hoorfar, and P. Radstrom. 2002.

Modeling of 5' nuclease real-ti

enrichment PCR procedure for Salmonella enterica. J Clin Microbiol 40:52-6

Kolavic, S. A., A. Kimura, S. L. Simons, L. Slutsker, S. Barth, and C. E.

Haley. 1997. An outbreak of Shigella dysenteriae type 2 among labo

workers due to intentional food contamination. JAMA 278:396-8.

Kotetishvili, M., O. C. Stine, A. Kreger, J. G. Morris, Jr., and A.

Sulakvelidze. 2002. Multilocus sequence typing for characterization of clinical

and environmental Salmonella strains. J Clin Microbiol 40:1626-35.

173

105. Kumao, T., W. Ba-Thein, and H. Hayashi. 2002. Molecular subtyping metho

for detection of Salmonella ente

ds

rica serovar Oranienburg outbreaks. J Clin

106.

bution and characterization of class

107. za.

tiation of pathogenic strains of Salmonella

108. t

DT104. J Clin Microbiol 42:4843-5.

.

,

ntial for the

Microbiol 40:2057-61.

Kwon, H. J., T. E. Kim, S. H. Cho, J. G. Seol, B. J. Kim, J. W. Hyun, K. Y.

Park, S. J. Kim, and H. S. Yoo. 2002. Distri

1 integrons in Salmonella enterica serotype Gallinarum biotype Gallinarum. Vet

Microbiol 89:303-9.

Landeras, E., M. A. Gonzalez-Hevia, R. Alzugaray, and M. C. Mendo

1996. Epidemiological differen

enteritidis by ribotyping. J Clin Microbiol 34:2294-6.

Lawson, A. J., J. Stanley, E. J. Threlfall, and M. Desai. 2004. Fluorescen

amplified fragment length polymorphism subtyping of multiresistant Salmonella

enterica serovar Typhimurium

109. Lee, A. K., C. S. Detweiler, and S. Falkow. 2000. OmpR regulates the two-

component system SsrA-ssrB in Salmonella pathogenicity island 2. J Bacteriol

182:771-81.

110. Lee, L. A., N. D. Puhr, E. K. Maloney, N. H. Bean, and R. V. Tauxe. 1994

Increase in antimicrobial-resistant Salmonella infections in the United States

1989-1990. J Infect Dis 170:128-34.

111. Leung, K. Y., and B. B. Finlay. 1991. Intracellular replication is esse

virulence of Salmonella Typhimurium. Proc Natl Acad Sci U S A 88:11470-4.

174

112. Levesque, C., L. Piche, C. Larose, and P. H. Roy. 1995. PCR mapping of

integrons reveals several novel combinations of resistance genes. Antimicro

Agents Chemother 39:1

b

85-91.

c.

ther S. enterica serovars. J Bacteriol 187:4401-9.

vic.

de

38-41.

d

f gyrA mutations, cyclohexane resistance, and the presence of class

117. Migura, F. A. Clifton-Hadley, E.

humans in the UK. Vet Microbiol 100:189-95.

113. Levings, R. S., D. Lightfoot, S. R. Partridge, R. M. Hall, and S. P. Djordjevi

2005. The genomic island SGI1, containing the multiple antibiotic resistance

region of Salmonella enterica serovar Typhimurium DT104 or variants of it, is

widely distributed in o

114. Levings, R. S., S. R. Partridge, D. Lightfoot, R. M. Hall, and S. P. Djordje

2005. New integron-associated gene cassette encoding a 3-N-aminoglycosi

acetyltransferase. Antimicrob Agents Chemother 49:12

115. Libby, S. J., M. Lesnick, P. Hasegawa, M. Kurth, C. Belcher, J. Fierer, an

D. G. Guiney. 2002. Characterization of the spv locus in Salmonella enterica

serovar Arizona. Infect Immun 70:3290-4.

116. Liebana, E., C. Clouting, C. A. Cassar, L. P. Randall, R. A. Walker, E. J.

Threlfall, F. A. Clifton-Hadley, A. M. Ridley, and R. H. Davies. 2002.

Comparison o

I integrons in Salmonella enterica from farm animals in England and Wales. J

Clin Microbiol 40:1481-6.

Liebana, E., C. Clouting, L. Garcia-

Lindsay, E. J. Threlfall, and R. H. Davies. 2004. Multiple genetic typing of

Salmonella Enteritidis phage-types 4, 6, 7, 8 and 13a isolates from animals and

175

118. Liebana, E., L. Garcia-Migura, M. F. Breslin, R. H. Davies, and M. J.

Woodward. 2001. Diversity of strains of Salmonella enterica serotype enteriti

from English poultry farms asse

dis

ssed by multiple genetic fingerprinting. J Clin

119.

2.

ca

120. adley, E.

t

T49) from animals and humans in

121. n-

con-

d

Microbiol 39:154-61.

Liebana, E., L. Garcia-Migura, C. Clouting, C. A. Cassar, F. A. Clifton-

Hadley, E. A. Lindsay, E. J. Threlfall, S. A. Chappell, and R. H. Davies. 200

Investigation of the genetic diversity among isolates of Salmonella enteri

serovar Dublin from animals and humans from England, Wales and Ireland. J

Appl Microbiol 93:732-44.

Liebana, E., L. Garcia-Migura, C. Clouting, F. A. Clifton-H

Lindsay, E. J. Threlfall, S. W. McDowell, and R. H. Davies. 2002. Multiple

genetic typing of Salmonella enterica serotype typhimurium isolates of differen

phage types (DT104, U302, DT204b, and D

England, Wales, and Northern Ireland. J Clin Microbiol 40:4450-6.

Liebana, E., D. Guns, L. Garcia-Migura, M. J. Woodward, F. A. Clifto

Hadley, and R. H. Davies. 2001. Molecular typing of Salmonella serotypes

prevalent in animals in England: assessment of methodology. J Clin Microbiol

39:3609-16.

122. Liming, S. H., and A. A. Bhagwat. 2004. Application of a molecular bea

real-time PCR technology to detect Salmonella species contaminating fruits an

vegetables. Int J Food Microbiol 95:177-87.

176

123. Lin, A. W., M. A. Usera, T. J. Barrett, and R. A. Goldsby. 1996. Applic

of random amplified polymorphic DNA analysis to differentiate strains of

Salmonella enteritidis. J Clin Microbiol 34:870-6.

Lindstedt, B. A., E. H

ation

124. eir, I. Nygard, and G. Kapperud. 2003. Characterization

125. us

eats analysis of Salmonella enterica subsp. enterica

126.

by

kery. BMC

127. 1.

ed

thogenicity island carrying multiple antibiotic resistance genes.

128.

oclonal antibody-based assays. J

Immunol Methods 137:1-8.

of class I integrons in clinical strains of Salmonella enterica subsp. enterica

serovars Typhimurium and Enteritidis from Norwegian hospitals. J Med

Microbiol 52:141-9.

Lindstedt, B. A., T. Vardund, L. Aas, and G. Kapperud. 2004. Multiple-loc

variable-number tandem-rep

serovar Typhimurium using PCR multiplexing and multicolor capillary

electrophoresis. J Microbiol Methods 59:163-72.

Lu, P. L., I. J. Hwang, Y. L. Tung, S. J. Hwang, C. L. Lin, and L. K. Siu.

2004. Molecular and epidemiologic analysis of a county-wide outbreak caused

Salmonella enterica subsp. enterica serovar Enteritidis traced to a ba

Infect Dis 4:48.

Luck, S. N., S. A. Turner, K. Rajakumar, H. Sakellaris, and B. Adler. 200

Ferric dicitrate transport system (Fec) of Shigella flexneri 2a YSH6000 is encod

on a novel pa

Infect Immun 69:6012-21.

Luk, J. M., and A. A. Lindberg. 1991. Rapid and sensitive detection of

Salmonella (O:6,7) by immunomagnetic mon

177

129. Luna, V. A., D. King, C. Davis, T. Rycerz, M. Ewert, A. Cannons, P. Amuso,

and J. Cattani. 2003. Novel sample preparation method for safe and rapid

detection of Bacillus anthracis spores in environmental powders and nasal swabs.

130. .

apid

la species in poultry environmental samples. J Microbiol

131.

ak

cephalosporins. J Clin Microbiol 41:2940-5.

134. , and R. Helmuth. 1999. Incidence of quinolone

rom

J Clin Microbiol 41:1252-5.

Lynch, M. J., C. G. Leon-Velarde, S. McEwen, and J. A. Odumeru. 2004

Evaluation of an automated immunomagnetic separation method for the r

detection of Salmonel

Methods 58:285-8.

Majtan, V., L. Majtanova, and L. Kovac. 2004. Analysis of integrons in human

isolates of Salmonella enterica serovar Typhimurium isolated in the Slov

Republic. FEMS Microbiol Lett 239:25-31.

132. Makanera, A., G. Arlet, V. Gautier, and M. Manai. 2003. Molecular

epidemiology and characterization of plasmid-encoded beta-lactamases produced

by Tunisian clinical isolates of Salmonella enterica serotype Mbandaka resistant

to broad-spectrum

133. Malorny, B., E. Paccassoni, P. Fach, C. Bunge, A. Martin, and R. Helmuth.

2004. Diagnostic real-time PCR for detection of Salmonella in food. Appl

Environ Microbiol 70:7046-52.

Malorny, B., A. Schroeter

resistance over the period 1986 to 1998 in veterinary Salmonella isolates f

Germany. Antimicrob Agents Chemother 43:2278-82.

178

135. Mammina, C., L. Cannova, S. Massa, E. Goffredo, and A. Nastasi. 2002.

Drug resistances in Salmonella isolates from animal foods, italy 1998-2000.

Epidemiol Infect 129:155-61.

Mansfield, L., and S. Forsyt

136. he. 1996. Collaborative ring-trial of Dynabeads anti-

137. la

s: big virulence in small packages. Microbes Infect 2:145-56.

n from 1981 to 2003. Antimicrob

139.

140. tegies associated

n

141. tz, L. F. McCaig, J. S. Bresee, C. Shapiro, P.

ted

142. Martel, and A.

Cloeckaert. 2003. Florfenicol resistance in Salmonella enterica serovar Newport

Salmonella for immunomagnetic separation of stressed Salmonella cells from

herbs and spices. Int J Food Microbiol 29:41-7.

Marcus, S. L., J. H. Brumell, C. G. Pfeifer, and B. B. Finlay. 2000. Salmonel

pathogenicity island

138. Marimon, J. M., M. Gomariz, C. Zigorraga, G. Cilla, and E. Perez-Trallero.

2004. Increasing prevalence of quinolone resistance in human nontyphoid

Salmonella enterica isolates obtained in Spai

Agents Chemother 48:3789-93.

Martinez, E., and F. de la Cruz. 1988. Transposon Tn21 encodes a RecA-

independent site-specific integration system. Mol Gen Genet 211:320-5.

Martinez, J. L., and F. Baquero. 2002. Interactions among stra

with bacterial infection: pathogenicity, epidemicity, and antibiotic resistance. Cli

Microbiol Rev 15:647-79.

Mead, P. S., L. Slutsker, V. Die

M. Griffin, and R. V. Tauxe. 1999. Food-related illness and death in the Uni

States. Emerg Infect Dis 5:607-25.

Meunier, D., S. Baucheron, E. Chaslus-Dancla, J. L.

179

mediated by a plasmid related to R55 from Klebsiella pneumoniae. J Antimicr

Chemother 51:1007-9.

Meunier, D., D. Boyd, M. R. M

ob

143. ulvey, S. Baucheron, C. Mammina, A. Nastasi,

phi

145. , F.

ng Salmonella typhimurium by phenotypic and

146. , A. J.

phimurium bovine isolates from farm to

E. Chaslus-Dancla, and A. Cloeckaert. 2002. Salmonella enterica serotype

Typhimurium DT 104 antibiotic resistance genomic island I in serotype paraty

B. Emerg Infect Dis 8:430-3.

144. Meyerholz, D. K., T. J. Stabel, M. R. Ackermann, S. A. Carlson, B. D. Jones,

and J. Pohlenz. 2002. Early epithelial invasion by Salmonella enterica serovar

Typhimurium DT104 in the swine ileum. Vet Pathol 39:712-20.

Mhand, R. A., N. Brahimi, N. Moustaoui, N. El Mdaghri, H. Amarouch

Grimont, E. Bingen, and M. Benbachir. 1999. Characterization of extended-

spectrum beta-lactamase-produci

genotypic typing methods. J Clin Microbiol 37:3769-73.

Miao, E. A., C. A. Scherer, R. M. Tsolis, R. A. Kingsley, L. G. Adams

Baumler, and S. I. Miller. 1999. Salmonella Typhimurium leucine-rich repeat

proteins are targeted to the SPI1 and SPI2 type III secretion systems. Mol

Microbiol 34:850-64.

147. Millemann, Y., S. Gaubert, D. Remy, and C. Colmin. 2000. Evaluation of

IS200-PCR and comparison with other molecular markers to trace Salmonella

enterica subsp. enterica serotype Ty

meat. J Clin Microbiol 38:2204-9.

180

148.

ng, ribotyping, and detection of IS200 for tracing avian

149.

cherichia coli K-12 chromosome. Mol Microbiol

150.

l strain due to

r

151.

dT+, Canada. Emerg

152.

nella

strain harbouring a class 1 integron containing novel

153.

valuation of DNA fingerprinting by PFGE as

an epidemiologic tool for Salmonella infections. Microbiol Immunol 39:673-6.

Millemann, Y., M. C. Lesage, E. Chaslus-Dancla, and J. P. Lafont. 1995.

Value of plasmid profili

isolates of Salmonella typhimurium and S. enteritidis. J Clin Microbiol 33:173-9.

Mills, D. M., V. Bajaj, and C. A. Lee. 1995. A 40 kb chromosomal fragment

encoding Salmonella typhimurium invasion genes is absent from the

corresponding region of the Es

15:749-59.

Miriagou, V., L. S. Tzouvelekis, S. Rossiter, E. Tzelepi, F. J. Angulo, and J.

M. Whichard. 2003. Imipenem resistance in a Salmonella clinica

plasmid-mediated class A carbapenemase KPC-2. Antimicrob Agents Chemothe

47:1297-300.

Mulvey, M. R., D. Boyd, A. Cloeckaert, R. Ahmed, and L. K. Ng. 2004.

Emergence of multidrug-resistant Salmonella Paratyphi B

Infect Dis 10:1307-10.

Mulvey, M. R., D. A. Boyd, L. Baker, O. Mykytczuk, E. M. Reis, M. D.

Asensi, D. P. Rodrigues, and L. K. Ng. 2004. Characterization of a Salmo

enterica serovar Agona

OXA-type beta-lactamase (blaOXA-53) and 6'-N-aminoglycoside

acetyltransferase genes [aac(6')-I30]. J Antimicrob Chemother 54:354-9.

Murase, T., T. Okitsu, R. Suzuki, H. Morozumi, A. Matsushima, A.

Nakamura, and S. Yamai. 1995. E

181

154. Nesse, L. L., K. Nordby, E. Heir, B. Bergsjoe, T. Vardund, H. Nygaard, an

G. Holstad. 2003. Molecular analyses of Salmonella enterica isolates from fish

feed factories and fish feed ingredients. Appl Environ Microbiol 69:1075-81.

d

lasses from

156. , M. Basina, V. Nguyen, and E. Y. Rosenberg. 1998. Multidrug

157.

. Infect Immun 64:5410-2.

i U S A 93:7800-4.

face

160. aard. 1997.

g and

155. Nield, B. S., A. J. Holmes, M. R. Gillings, G. D. Recchia, B. C. Mabbutt, K.

M. Nevalainen, and H. W. Stokes. 2001. Recovery of new integron c

environmental DNA. FEMS Microbiol Lett 195:59-65.

Nikaido, H.

efflux pump AcrAB of Salmonella typhimurium excretes only those beta-lactam

antibiotics containing lipophilic side chains. J Bacteriol 180:4686-92.

Ochman, H., and E. A. Groisman. 1996. Distribution of pathogenicity islands in

Salmonella spp

158. Ochman, H., F. C. Soncini, F. Solomon, and E. A. Groisman. 1996.

Identification of a pathogenicity island required for Salmonella survival in host

cells. Proc Natl Acad Sc

159. Oh, B. K., Y. K. Kim, K. W. Park, W. H. Lee, and J. W. Choi. 2004. Sur

plasmon resonance immunosensor for the detection of Salmonella Typhimurium.

Biosens Bioelectron 19:1497-504.

Olsen, J. E., M. N. Skov, O. Angen, E. J. Threlfall, and M. Bisg

Genomic relationships between selected phage types of Salmonella enterica

subsp. enterica serotype typhimurium defined by ribotyping, IS200 typin

PFGE. Microbiology 143 ( Pt 4):1471-9.

182

161. Pancetti, A., and J. E. Galan. 2001. Characterization of the mutS-proximal

region of the Salmonella typhimurium SPI-1 identifies a group of pathogenicity

island-associated genes. FEMS Microbiol Lett 197:203-8.

162. Patrick, M. E., P. M. Adcock, T. M. Gomez, S. F. Altekruse, B. H. Holland,

R. V. Tauxe, and D. L. Swerdlow. 2004. Salmonella Enteritidis infections,

United States, 1985-1999. Emerg Infect Dis 10:1-7.

163. Pezzella, C., A. Ricci, E. DiGiannatale, I. Luzzi, and A. Carattoli. 2004.

Tetracycline and streptomycin resistance genes, transposons, and plasmids in

Salmonella enterica isolates from animals in Italy. Antimicrob Agents Chemother

164. elland. 2002. Evolutionary genomics

atl Acad

165. . R. Ward, B. Rowe, and E. J.

166. nd Courvalin, P. 1999. Mechanisms of

.

48:903-8.

Porwollik, S., R. M. Wong, and M. McCl

of Salmonella: gene acquisitions revealed by microarray analysis. Proc N

Sci U S A 99:8956-61.

Punia, P., M. D. Hampton, A. M. Ridley, L

Threlfall. 1998. Pulsed-field electrophoretic fingerprinting of Salmonella Indiana

and its epidemiological applicability. J Appl Microbiol 84:103-7.

Quintiliani, R., Sahm, D. F JR., a

Resistance to Antimicrobial Agents. In P.R. Murray, E.J. Barron, M.A. Pfaller,

F.C. Tenover, and R.H. Yolken (ed.), Manual of clinical microbiology, 7th ed

American Society for Microbiology, Washington, DC

183

167. Rahman, M., A. Ahmad, and S. Shoma. 2002. Decline in epidemic of multi

resistant Salmonella Typhi is not associated with increased incidence of

antibiotic-susceptible strain in Bangladesh. Epidemiol Infec

drug

t 129:29-34.

ing purposes. J Clin

169.

n thirty-five serotypes of Salmonella enterica isolated from humans

170.

rica serovar Typhimurium DT104. Appl Environ

171.

Med

172. .

in-

from animals in

Pennsylvania. J Clin Microbiol 40:4679-84.

168. Ramisse, V., P. Houssu, E. Hernandez, F. Denoeud, V. Hilaire, O. Lisanti, F.

Ramisse, J. D. Cavallo, and G. Vergnaud. 2004. Variable number of tandem

repeats in Salmonella enterica subsp. enterica for typ

Microbiol 42:5722-30.

Randall, L. P., S. W. Cooles, M. K. Osborn, L. J. Piddock, and M. J.

Woodward. 2004. Antibiotic resistance genes, integrons and multiple antibiotic

resistance i

and animals in the UK. J Antimicrob Chemother 53:208-16.

Randall, L. P., and M. J. Woodward. 2001. Multiple antibiotic resistance (mar)

locus in Salmonella ente

Microbiol 67:1190-7.

Randall, L. P., and M. J. Woodward. 2001. Role of the mar locus in virulence

of Salmonella enterica serovar Typhimurium DT104 in chickens. J

Microbiol 50:770-9.

Rankin, S. C., H. Aceto, J. Cassidy, J. Holt, S. Young, B. Love, D. Tewari, D

S. Munro, and C. E. Benson. 2002. Molecular characterization of cephalospor

resistant Salmonella enterica serotype Newport isolates

184

173. Reche, M. P., M. A. Echeita, J. E. de los Rios, M. A. Usera, P. A. Jimenez, A.

M. Rojas, J. Colas, and I. Rodriguez. 2003. Comparison of phenotypic

genotypic markers for characterization of an outbreak of Salmonella serot

and

ype

174. of

lsed-

. J Clin Microbiol 36:2314-21.

. De

177. , M. Hernandez, T. Esteve, J. Hoorfar, and M. Pla.

178. . Heuzenroeder. 2005. Discrimination within

179. oncard, B. Dychinco, J. Davies,

and D. Mazel. 2001. The evolutionary history of chromosomal super-integrons

Havana in captive raptors. J Appl Microbiol 94:65-72.

Ridley, A. M., E. J. Threlfall, and B. Rowe. 1998. Genotypic characterization

Salmonella Enteritidis phage types by plasmid analysis, ribotyping, and pu

field gel electrophoresis

175. Rijpens, N., L. Herman, F. Vereecken, G. Jannes, J. De Smedt, and L

Zutter. 1999. Rapid detection of stressed Salmonella spp. in dairy and egg

products using immunomagnetic separation and PCR. Int J Food Microbiol

46:37-44.

176. Robinson-Dunn, B. 2002. The microbiology laboratory's role in response to

bioterrorism. Arch Pathol Lab Med 126:291-4.

Rodriguez-Lazaro, D.

2003. A rapid and direct real time PCR-based method for identification of

Salmonella spp. J Microbiol Methods 54:381-90.

Ross, I. L., and M. W

phenotypically closely related definitive types of Salmonella enterica serovar

Typhimurium by the multiple amplification of phage locus typing technique. J

Clin Microbiol 43:1604-11.

Rowe-Magnus, D. A., A. M. Guerout, P. Pl

185

provides an ancestry for multiresistant integrons. Proc Natl Acad Sci U S A

98:652-7.

Sandvang, D., F. M. Aarestrup, and L. B. Jensen. 1998. Characterisation of

integrons and antibiotic resistance genes in Danish mult

180.

iresistant Salmonella

181.

ella pneumoniae

182. beads

nella system in the detection of Salmonella species in foods, animal

183. id-Cycle Real-Time PCR:A

184. f

-enzyme amplified fragment

lmonella

185. A

ic gene-integration functions: integrons. Mol

enterica Typhimurium DT104. FEMS Microbiol Lett 160:37-41.

Schmidt, F., and I. Klopfer-Kaul. 1984. Evolutionary relationship between

Tn21-like elements and pBP201, a plasmid from Klebsi

mediating resistance to gentamicin and eight other drugs. Mol Gen Genet

197:109-19.

Shaw, S. J., B. W. Blais, and D. C. Nundy. 1998. Performance of the Dyna

anti-Salmo

feeds, and environmental samples. J Food Prot 61:1507-10.

Cockerill F. R. III, and T. F. Smith 2002. Rap

Revolution for Clinical Microbiology. ASM News 68:77-83.

Sood, S., T. Peters, L. R. Ward, and E. J. Threlfall. 2002. Combination o

pulsed-field gel electrophoresis (PFGE) and single

length polymorphism (SAFLP) for differentiation of multiresistant Sa

enterica serotype typhimurium. Clin Microbiol Infect 8:154-61.

Stokes, H. W., and R. M. Hall. 1989. A novel family of potentially mobile DN

elements encoding site-specif

Microbiol 3:1669-83.

186

186. 97.

urine model of chronic Salmonella infection. Infect Immun

187.

based

188. ella

. Am J Pathol 50:109-36.

f Salmonella

gel electrophoresis.

190.

191. . Pang. 1995.

192. ntimicrobial drug resistance in Salmonella: problems and

perspectives in food- and water-borne infections. FEMS Microbiol Rev 26:141-8.

Sukupolvi, S., A. Edelstein, M. Rhen, S. J. Normark, and J. D. Pfeifer. 19

Development of a m

65:838-42.

Taitt, C. R., Y. S. Shubin, R. Angel, and F. S. Ligler. 2004. Detection of

Salmonella enterica serovar Typhimurium by using a rapid, array-

immunosensor. Appl Environ Microbiol 70:152-8.

Takeuchi, A. 1967. Electron microscope studies of experimental Salmon

infection. I. Penetration into the intestinal epithelium by Salmonella

Typhimurium

189. Tamada, Y., Y. Nakaoka, K. Nishimori, A. Doi, T. Kumaki, N. Uemura, K.

Tanaka, S. I. Makino, T. Sameshima, M. Akiba, M. Nakazawa, and I.

Uchida. 2001. Molecular typing and epidemiological study o

enterica serotype Typhimurium isolates from cattle by fluorescent amplified-

fragment length polymorphism fingerprinting and pulsed-field

J Clin Microbiol 39:1057-66.

Tauxe, R. V. 1997. Emerging foodborne diseases: an evolving public health

challenge. Emerg Infect Dis 3:425-34.

Thong, K. L., Y. F. Ngeow, M. Altwegg, P. Navaratnam, and T

Molecular analysis of Salmonella enteritidis by pulsed-field gel electrophoresis

and ribotyping. J Clin Microbiol 33:1070-4.

Threlfall, E. J. 2002. A

187

193. Torok, T. J., R. V. Tauxe, R. P. Wise, J. R. Livengood, R. Sokolow, S.

Mauvais, K. A. Birkness, M. R. Skeels, J. M. Horan, and L. R. Foster. 1997.

A large community outbreak of salmonellosis caused by intentional

194. nd A.

tibiotic resistance carried by

195. s, K. Rajakumar, and B. Adler. 2003.

196. nce

197.

M. T. Kelly, V. K. Balan, W. R. Mac Kenzie,

e

alfalfa sprouts. JAMA 281:158-62.

ellae in Greece during 1990-97.

contamination of restaurant salad bars. Jama 278:389-95.

Tosini, F., P. Visca, I. Luzzi, A. M. Dionisi, C. Pezzella, A. Petrucca, a

Carattoli. 1998. Class 1 integron-borne multiple-an

IncFI and IncL/M plasmids in Salmonella enterica serotype typhimurium.

Antimicrob Agents Chemother 42:3053-8.

Turner, S. A., S. N. Luck, H. Sakellari

Molecular epidemiology of the SRL pathogenicity island. Antimicrob Agents

Chemother 47:727-34.

van Asten, A. J., and J. E. van Dijk. 2005. Distribution of "classic" virule

factors among Salmonella spp. FEMS Immunol Med Microbiol 44:251-9.

Van Beneden, C. A., W. E. Keene, R. A. Strang, D. H. Werker, A. S. King, B.

Mahon, K. Hedberg, A. Bell,

and D. Fleming. 1999. Multinational outbreak of Salmonella enterica serotyp

Newport infections due to contaminated

198. Velonakis, E. N., A. Markogiannakis, L. Kondili, E. Varjioti, Z. Mahera, E.

Dedouli, A. Karaitianou, N. Vakalis, and K. Bethimouti. 2001. Evolution of

antibiotic resistance of non-typhoidal Salmon

Euro Surveill 6:117-20.

188

199. Villa, L., and A. Carattoli. 2005. Integrons and transposons on the Salmon

enterica serovar typhimurium virulence plasmid. Antimicrob Agents Chemother

49:1194-7.

Wain, J., N. T. Hoa, N. T. Chinh, H. Vinh, M. J. Everet

ella

200. t, T. S. Diep, N. P.

201. . Functions and effectors of the

202. e Molecular nature of genes. In K.T Kane (ed), Molecular

203.

o

un

Day, T. Solomon, N. J. White, L. J. Piddock, and C. M. Parry. 1997.

Quinolone-resistant Salmonella Typhi in Vietnam: molecular basis of resistance

and clinical response to treatment. Clin Infect Dis 25:1404-10.

Waterman, S. R., and D. W. Holden. 2003

Salmonella pathogenicity island 2 type III secretion system. Cell Microbiol

5:501-11.

Weaver, R. F. 1999. Th

Biology, 1st ed. McGraw-Hill companies Inc. United States.

Weigel, R. M., B. Qiao, B. Teferedegne, D. K. Suh, D. A. Barber, R. E.

Isaacson, and B. A. White. 2004. Comparison of pulsed field gel electrophoresis

and repetitive sequence polymerase chain reaction as genotyping methods for

detection of genetic diversity and inferring transmission of Salmonella. Vet

Microbiol 100:205-17.

204. Weinstein, D. L., B. L. O'Neill, D. M. Hone, and E. S. Metcalf. 1998.

Differential early interactions between Salmonella enterica serovar Typhi and tw

other pathogenic Salmonella serovars with intestinal epithelial cells. Infect Imm

66:2310-8.

189

205. Werber, D., J. Dreesman, F. Feil, U. van Treeck, G. Fell, S. Ethelberg, A. M.

Hauri, P. Roggentin, R. Prager, I. S. Fisher, S. C. Behnke, E. Bartelt, E.

Weise, A. E

llis, A. Siitonen, Y. Andersson, H. Tschape, M. H. Kramer, and

206.

1. The isolation

207. K. Mc Gill, J. D. Collins, and E. Gormley. 2002. The prevalence

pley,

ther

E. E.

A. Ammon. 2005. International outbreak of Salmonella Oranienburg due to

German chocolate. BMC Infect Dis 5:7.

White, D. G., S. Zhao, R. Sudler, S. Ayers, S. Friedman, S. Chen, P. F.

McDermott, S. McDermott, D. D. Wagner, and J. Meng. 200

of antibiotic-resistant Salmonella from retail ground meats. N Engl J Med

345:1147-54.

Whyte, P.,

and PCR detection of Salmonella contamination in raw poultry. Vet Microbiol

89:53-60.

208. Winokur, P. L., A. Brueggemann, D. L. DeSalvo, L. Hoffmann, M. D. A

E. K. Uhlenhopp, M. A. Pfaller, and G. V. Doern. 2000. Animal and human

multidrug-resistant, cephalosporin-resistant Salmonella isolates expressing a

plasmid-mediated CMY-2 AmpC beta-lactamase. Antimicrob Agents Chemo

44:2777-83.

209. Wood, M. W., M. A. Jones, P. R. Watson, S. Hedges, T. S. Wallis, and

Galyov. 1998. Identification of a pathogenicity island required for Salmonella

enteropathogenicity. Mol Microbiol 29:883-91.

190

210. Wright, D. J., P. A. Chapman, and C. A. Siddons. 1994. Immunomagnetic

separation as a sensitive method for isolating Escherichia coli O157 from foo

samples. Epidemiol Infect 113:31-9.

Yao, J. D. C. a. M., R.C.JR. 1999. Antimicrobial Agents. In P.R. Murray, E

Barron, M.A. Pfaller, F.C. Tenover, and R

d

211. .J.

.H. Yolken (ed.), Manual of clinical

.

212.

ance

among Salmonella strains isolated from healthy humans in China.

213.

t, T. Donkar, C. Bolin, S. Munro, E. J. Baron, and R. D. Walker.

214.

Immun 67:1974-81.

microbiology, 7th ed. American Society for Microbiology, Washington, DC

Zhang, H., L. Shi, L. Li, S. Guo, X. Zhang, S. Yamasaki, S. Miyoshi, and S.

Shinoda. 2004. Identification and characterization of class 1 integron resist

gene cassettes

Microbiol Immunol 48:639-45.

Zhao, S., S. Qaiyumi, S. Friedman, R. Singh, S. L. Foley, D. G. White, P. F.

McDermot

2003. Characterization of Salmonella enterica serotype Newport isolated from

humans and food animals. J Clin Microbiol 41:5366-71.

Zhou, D., W. D. Hardt, and J. E. Galan. 1999. Salmonella typhimurium

encodes a putative iron transport system within the centisome 63 pathogenicity

island. Infect

191

Appendix A

Table A1. Detection and Isolation of Salmonella from Food Food and average PCR Number of CFU on CFU spiked Enrichments result XLD agar

BPW 40, - 0 BPW+IMS 0 C

(Unspiked) hicken cuts

BPW+TT 40, - 0 BPW 39.16, - 1-S BPW+IMS 0 Chicken cuts (10 CFU

BPW+TT 34.77, + 8-S of S.Typhimurium)

BPW 35.26, + 38-S BPW+IMS 17-S Chicke

of S.Typhi+ 159-S

n cuts (264 CFU murium)

BPW+TT 29.1, BPW 40, - 0 BPW+IMS 0 C

(BPW+TT 40, - 0

hicken cuts Unspiked)

BPW 39.0, + 70-S BPW+IMS 215-S Chicken cuts (4 CFU of

S.TBPW+TT 29.8, + 27-S

yphimurium)

BPW 39.4, + 164-S, 34-NS Chicken cuts (4 CFU of BPW+IMS 327-S, 34-NS S.Typhimurium, 73

oCFU of E.coli and

CFU f Citrobacter, 74

Proteus)

BPW+TT 30.03, + 90-S, 20-NS

BPW 40, - 0 BPW+IMS 3-possible

contamination C(unspiked)

BPW+TT 40, - 0

hicken cuts

BPW 33.29, + 111-S BPW+IMS 295-S Chicken cuts (5 CFU of

S.Enteritidis) BPW+TT 33.8, + 14-S BPW 35.26, + 101-S, 193-NS Chicken cuts (5 CFU ofBPW+IMS 134-S, 71-NS

S.Enteritidis, 99 CFU Citrobacter, 59 CFU

of E.coli and Proteus) BPW+TT 33.68, + 22 of

192

Food and average CFU spiked Enrichments result

Number of CFU on XLD agar

PCR

BPW 40, - 0 BPW+IMS 0 Egg salad (unspiked) BPW+TT 40, - 0 B 2PW 6.52, + 82-S BPW+IMS 91-S Egg salad (7 CFU

S ) 27 + 17-S

.TyphimuriumBPW+TT .3,BPW 3 600-S 1.5, +BPW+IMS 1200-S Egg salad (58 CFU

23. , + 525-S S.Typhimurium)

BPW+TT 03BPW 40, - 0 BPW+IMS 0 Egg salad (unspiked)

4 - BPW+TT 0, 0 BPW 36.71, + 42-S BPW+IMS 130-S Egg salad (6 CFU

S ) 33. , + 29-S

.TyphimuriumBPW+TT 47BPW 3 40-S 3.42, +BPW+IMS 270-S Egg salad (62 CFU

N S.Typhimurium)

BPW+TT D 181-S BPW 40, - 0 BPW+IMS 0 Egg salad (unspiked) BPW+TT 4 - 0, 0 BPW 29.4, - 44-S BPW+IMS 43-S Egg salad (7 CFU

yphimuriuS.T m) TT 30.9, 13-S BPW+ +

BPW 39.7, - 128-S, 10-NS BPW+IMS 193-S

Egg salad (7 CFU S.Ty

CFU Citrobacter, 167 CFU -E.coli and

29.28, + 37-S, 2-NS phimurium, 12

BPW+TT

Proteus) BPW 4 - 0, 0 BPW+IMS 0 Egg salad (unspiked)

TT 40, BPW+ - 0 BPW 34 + .8, 27-S Egg salad (7 CFU

S.Typhimurium) BPW+IMS 56-S

193

Food and average CFU spiked

PCR result

Number of CFU on XLD agar Enrichments

BPW+TT 40, 3-S - BPW 35 + 52-S .7,Egg salad (7 CFU BPW+IMS 0, 2-NS S.Typhimurium, 12

CFU Citrobacter, 167 TT 36.8, BPW+ + 46-S CFU -E.coli and Proteus)

BPW 40, - 0 BPW+IMS 0 Hamburger Patty

4 - (unspiked)

BPW+TT 0, 0 BPW 36.3, + 36-S, Low background BPW+IMS 6-S, Low background Hamburger patty (8

30 + 56-S CFU S.Typhimurium)

BPW+TT .0,BPW 32, + 133-S, Low background BPW+IMS 57-S, Low background

Hamburger Patty (8 CFU S.Typhimurium, 8

C

Proteus)

33 + FU Citrobacter, 82CFU E.coli and

BPW+TT .5, 1-S

BPW 40, - 32 –NS BPW+IMS 46-NS Ha )

3mburger (unspiked

BPW+TT 5.4, + 0 BPW 3 230-S 4.07, +BPW+IMS 800-S Hamburger (4 CFU of

S.Typhimurium) 3 50-S BPW+TT 8.24, +

BPW 3 212-S, 129-NS 4.04, +BPW+IMS 352-S, 71-NS

H f S

CF 3 12-S, 2-NS

amburger (4 CFU o.Typhimurium, 74 U of Citrobacter, 4 BPW+TT 38.27, +CFU of E.coli and

Proteus) BPW 4 - 0, 12-NS BPW+IMS 115-NS Ha d) BPW+TT 40, - 0

mburger (unspike

BPW 39.72, - 13-S, 97-NS BPW+IMS 46-S, 188-NS Hamburger (5 CFU

S.Enteritidis) 3 50-S BPW+TT 6.2, +

BPW 38.0, + 64-S, 53-NS HS.Enteritidis, 138 CFU 87-S, 68-NS

amburger (5 CFU BPW+IMS

194

Food and average CFU spiked

PCR result

Number of CFU on XLD agar Enrichments

Citrobacter, 71 CFU E

36.44 + 600-S, 30-NS BPW+TT .coli and Proteus)

BPW 40, - High background BPW+IMS Low background Tuna sushi (unspiked) BPW+TT 40, - Low background BPW 32.4, + 107-S, High background BPW+IMS 19-S, 6-NS Tuna sushi (6 CFU,

29.4, + 49-S, 0-NS S.Typhimurium)

BPW+TT BPW 31.9, + 260-S, High background BPW+IMS 230-S, Low background Tuna sushi (47 CFU,

S.Typhimurium) BPW+TT 28.3, + 360-S, 0-NS BPW Low background BPW+IMS Low background Tuna sushi (unspiked) BPW+TT 0 BPW 40, + 18-S, Low background BPW+IMS 39-S Tuna sushi (6 CFU,

S.Typhimurium) TT 40, BPW+ - 1-S

BPW 40, + 250-S, Low background BPW+IMS 560-S Tuna sushi (46 CFU,

S.Typhimurium) TT 40, BPW+ + 9-S

BPW 39.3, - Low background BPW+IMS Low background salmon Sushi

TT 40, (unspiked)

BPW+ - 0 BPW 34.5, + 12-S, Low background BPW+IMS 28-S Salmon sushi (7 CFU,

S.Typhimurium) BPW+TT 40, + 2-S BPW 40, - 18-S, Low background BPW+IMS 5-S

Salmon sushi (7 CFU,

Citrobacter, 45 CFU E.coli and Proteus) 45-S

S.Typhimurium, 3 CFU

BPW+TT 40, -

BPW 40, - 1-NS BPW+IMS 0 Blueberries (unspiked)

TT BPW+ 40, - 0 BPW 40, - 19-S, Low background Blueberries (13 CFU

195

Food and average CFU spiked

PCR result

Number of CFU on XLD agar Enrichments

BPW+IMS 239-S S.Enteritidis) BPW+TT 40, - 9-S BPW 40, - 390-S BPW+IMS 8-S Blueberries (37 CFU

S.Typhimurium) BPW+TT 40, - 280-S BPW 40, - 0 BPW+IMS 0 Blueberries (unspiked) BPW+TT 40, - 0 BPW 40, - 17-S BPW+IMS 19-S Blueberries (4 CFU

S.Enteritidis) BPW+TT 40, - 17-S BPW 40, - 62-S BPW+IMS 162-S Blueberries (8 CFU

S.Typhimurium) BPW+TT 40, - 21-S BPW 40, - 0 BPW+IMS 0 Blueberries (unspiked) BPW+TT 0 BPW 40, - 25-S BPW+IMS 10-S Blueberries (3 CFU

S.Enteritidis) BPW+TT 40, - 6-S BPW 40, - 60-S BPW+IMS 136-S

Blueberries (3 CFU S. En U

CitrobacterE.coli and Proteus)

teritidis, 2 CF, 48 CFU BPW+TT 40, - 19-S

BPW 40, - 0 BPW+IMS 0 Blueberries (unspiked)

TT BPW+ 0 BPW 40, - 33-S, 1-NS BPW+IMS 61-S, 1-NS Blueberries (4 CFU

S.Enteritidis) BPW+TT 40, - 16-S BPW 40, - 26-S, 1-NS BPW+IMS 22-S, 1-NS

Blueberries (4 CFU S.

Citrobacter, 48 CFU Enteritidis, 3 CFU

BPW+TT E.coli and Proteus) 40, - 325-S

Blueberries (unspiked) BPW 40, -

196

Food and average CFU spiked

PCR result

Number of CFU on XLD agar Enrichments

For PCR only BPW +TT 40, - BPW + Low spiked (7 CFU of

S. Typhimurium) TT BPW + + BPW + Mixed Spiked (7 CFU

f S. Typhimurium, oCitrobacter, E.coli and

BPW+TT +

Proteus BPW 4 - 0, 0 BPW+IMS 0 Cheese (unspiked)

TT 40, BPW+ - 0 BPW 4 - 0, 1-S BPW+IMS 0 Cheese (12 CFU of

S.Typhimurium) TT 40, BPW+ - 0

BPW 38.71, + 1-S, 28-NS BPW+IMS 1-S, 1-NS

Cheese (12 CFU of Salmonella; 92 CFU of

Citrobacter and 76 TT 40, BPW+ - 0 CFU of E.coli, Proteus-

N/A BPW 4 - 0, 0 BPW+IMS 0 Cheese (unspiked) BPW+TT 4 - 0, 0 BPW 40, - 0 BPW+IMS 0 Cheese (8 CFU of

S.Typhimurium) BPW+TT 38 + .7, 0 BPW 40, - 5-S, 9-NS Cheese (8 CFU BPW+IMS 4-S S.Typhimurium, 83

Proteus)

4 - CFU of Citrobacter, 70 CFU of E.coli and BPW+TT 0, 0

BPW 40, - 0 BPW+IMS 0 Cheese (unspiked) BPW+TT 40, - 0 BPW 3 6.4, + 0 BPW+IMS 0 Cheese (5 CFU-

S.Enteritidis) BPW+TT 40, - 0 BPW 37.78, + 5-S, 9-NS Cheese (5CFU

197

Food and average CFU spiked

PCR result

Number of CFU on XLD agar Enrichments

BPW+IMS 4-S STT 40,

.Enteritidis, 90-Citrobacter, 59-E.coli

and Proteus) BPW+ - 0

BPW 40, - 0 BPW+IMS 0 Cheese (unspiked) BPW+TT 40, - 0 BPW 40, - 0 BPW+IMS 0 Cheese (5 CFU of

36. , +S.Enteritidis)

BPW+TT 73 0 BPW 38. 74, + 0 BPW+IMS 0

Cheese (5 CFU of S.Enteritidis, 94 CFU,

C f E 34 + itrobacter, 48 CFU o

.coli and Proteus BPW+TT .6, 0

BPW-O/N 40, - 0 BPW+IMS 0 Cheese (unspiked) BPW+TT 38 - .8, 0 BPW-O/N 1 TNTC-S 8.9, +BPW+IMS TNTC-S Cheese (2 CFU,

S.Enteritidis) TT 16. 47, + TNTC-S BPW+

BPW-O/N 29.6, + 0, high background BPW+IMS 31-S, 85-NS

Cheese (2 CFU

BPW+TT-O/N 17.45, TNTC-S +S.Enteritidis, 130 CFU C

S 450-S itrobacter, 67 CFU

E.coli and Proteus) BPW+TT+IM BPW 40, - 0 BPW+IMS 0 M )

4 - ayonnaise (unspiked

BPW+TT 0, 0 BPW 3 107-S 6.0, +BPW+IMS 121-S Mayonnaise (5 CFU

S.Typhi ) TT 40, 47-S

muriumBPW+ - BPW 35.8, + 197–S, 18-NS BPW+IMS 400-S, 0

Mayonnaise (5 CFU S.Typhimurium, 66

CFU Citrobacter, 44 TT 228-S, 33-NS BPW+ 40, + CFU E.coli and

Proteus) BPW 40, - 0 Mayonnaise (unspiked)

IMS BPW+ 0

198

Food and average CFU spiked

PCR result

Number of CFU on XLD agar Enrichments

BPW+TT 4 - 0, 0 BPW 3 154-S 6.6, +BPW+IMS 206-S Mayonnaise (4 CFU

S.Typhiumurium) 102-S BPW+TT 40, -

BPW 35.6, + 295-S, 19-NS BPW+IMS 339-S, 1-NS

Mayonnaise (4 CFU S.Typhimurium, 79

CFU 215-S, 35-NS Citrobacter, 47 CFU E.coli and

Proteus)

BPW+TT 40, -

BPW 40, - 0 BPW+IMS 0 Mayonnaise (unspiked) BPW+TT 39.7, - 0 BPW 39.6, + 7-S BPW+IMS 19-S Mayonnaise (7 CFU,

39 + 5-S S.Enteritidis)

BPW+TT .9,BPW 40, - 18-S, 20 -NS BPW+IMS 28-S, 6-NS

Mayonnaise (7 CFU S.Enteritidis, 144 CFU C E.c s)

40, - 60-S, 6-NS itrobacter, 41 CFUoli and Proteu

BPW+TT

BPW 40, - 0 BPW+IMS 0 Orange juice (unspiked) BPW+TT 40, - 0 BPW 36. , +01 24-S BPW+IMS 106-S Orange juice (5 CFU of

S.Typhimurium) 34. , + 14-S BPW+TT 53

BPW 38.10, + 26-S, 21-NS BPW+IMS 40-S, 13-NS

Orange juice (5 CFU of S. Typhimurium, 113

C 40, - 27-S, 12-NS FU of Citrobacter, 59CFU of E.coli and

Proteus)

BPW+TT

BPW 40, - 0 BPW+IMS 0 Orange Juice

(unspiked) BPW+TT 40, - 0 BPW 37.92, + 11-S BPW+IMS 5-S Orange juice (7 CFU of

34. , + 13-S S.Typhimurium)

BPW+TT 68

199

Food and average CFU spiked

PCR result

Number of CFU on XLD agar Enrichments

BPW 37.3, + 28-S, 6-NS BPW+IMS 21-S, 4-NS

Orange juice (7 CFU of S. Typhimurium, 93

C

Proteus)

35. , +FU of Citrobacter, 59CFU of E.coli and

BPW+TT 76 15-S

BPW 40, - 0 BPW+IMS 0 Orange juice (unspiked)

3BPW+TT 9.5, - 0 BPW 38.34, + 1-S BPW+IMS 6-S Orange juice (5 CFU of

S.Enteritidis) 39 - 2-S BPW+TT .8.

BPW 39.12, - 4-S, 7-NS BPW+IMS 3-S, 15-NS

Orange juice (5 CFU of S. Enteritidis, 100 CFU o of E us) 39.5, +f Citrobacter, 50 CFU

.coli and Prote BPW+TT 18-S

species from artificially seeded food samples. The

or s Salmonella E.coli and

teus species was not determined. BPW=Buffered

Peptone Water, BPW+IM

PCR ind te the CT values. + = positive PCR

tion. XLD -Lysin ate, S= Salmonella

e . The PCR results

for blueberries (Gray cells) were negative for four experiments because the samples were

store over ich m ve caused cell lysis and possible DNA

degradation.

Detection and isolation o

iginal spiking count i

f Salmonella

shown for each of the organism species,

Citrobacter. The viable count for Pro

S= BPW + immunomagnetic separation, BPW+TT= BPW+

tetrathionate broth. The numbers for ica

reaction, - = negative PC

on XLD agar, NS= Non-

R reac = Xylose e Desoxychol

Salmonella, TNTC= Too Num rous to Count

d at –80 oC for a month, wh ight ha

200

Figure A1.Ribotypin

g of Wild type Salmon olat

dicated. The percent similarity between isolates is represented

ella Is es

Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]Ribotyping-EcoR1 Ribotyping-EcoR1

Ribotyping results of the 100 wild type Salmonella isolates. The serotype names and

sources are in

100

959085807570656055

CBD 436 S.Paratyphi A

ratyphiCBD 825,S.Pa

CBD 813,S.Jav

CBD 445 S.Jav

CBD 429 S. Or

CBD 585, S.Ne

iana

iana

anienburg

wport

CBD 604, S.Newport

CBD 587, S.Newport

CBD 592, S.Newport

CB 3, S.Newport

CB S.Newport

CB S.Newport

CB S.Newport

CB S.NewportCB S.Sspp1

CB S.Newport

CB S.Newport

CB S.Newport

CB S.Newport

CB S.Newport

CB S.Newport

CB S.Newport

Newport Newport

Newport

atum

Newport

Newport

Newport

Newport

ndiego

andiegoading

ading

n

teritidis

eritidis

eritidis

ta

CBD 437,S.Saintpaul

CBD 782, S.Stanley

CBD 576 S.Kentucky

CBD 577 S.Kentucky

CBD 578 S. Mbandaka

CBD 580 S.Muenster

CBD 581 S.Muenster

CBD 438 S.TyphimuriumCBD 820,S.Typhimurium

CBD 746 S.Typhimurium

CBD 427, S.Newport

CBD 443 S.Hildgo

CBD 434 S.Branderburg

CBD 574 S.Istanbul

CBD 830 S.Javiana

CBD 69 S.Javiana

CBD 569 S.Alachua

Clinical

Clinical

Clinical

Environmental

Environmental

Environmental

Clinical

Environmental

Environmental

Clinical

Environmental

Environmental

Environmental

ClinicalClinical

Environmental

Environmental

Environmental

Environmental

Environmental

Clinical

Environmental

EnvironmentalEnvironmental

Clinical

Clinical

Environmental

Environmental

Clinical

Environmental

Clinical

ClinicalEnvironmental

Environmental

Clinical

Clinical

Environmental

Environmental

Environmental

Clinical

Clinical

Clinical

Clinical

Clinical

Clinical

Clinical

Clinical

Clinical

Clinical

Environmental

Environmental

Environmental

Environmental

Environmental

ClinicalClinical

Clinical

Clinical

Environmental

Clinical

Environmental

Clinical

Clinical

Environmental

70 80

D 21

D 572,

D 595,

D 596,

D 829,D 806,

D 586,

D 589,

D 598,

D 571,

D 590,

D 815,

D 588,

CBD 597, S.CBD 593, S.

CBD 759, S.

CBD 814,S.An

CBD 591, S.

CBD 594, S.

CBD 827, S.

CBD 584, S.

CBD 821,S.Sa

CBD776, S.SCBD 582 S.Re

CBD 583 S.Re

CBD 32 S.Nima

CBD 831, S.Muenche

CBD 440 S.Muenchen

CBD 441 S.Muenchen

CBD 442 S.Muenchen

CBD 809,S.Muenchen

CBD 822,S.subsp.1

CBD 832 S.Enteritidis

CBD 781, S.Enteritidis

CBD779, S.En

CBD 439 S.Ent

CBD 818,S.Ent

CBD 805,S.Ber

CBD 33 S.Aberdeen

CBD 810,S.Heildelberg

CBD 446 S.Typhimurium

CBD 775, S.Typhimurium

CBD 828 S.Tyhpimurium

CBD 757 S.Typhimurium

CBD 431,S.Saintpaul

CBD778, S.Typhimurium

CBD 811,S.I 4,12:i :-

CBD 816,S.Typhimurium

CBD 823,S.Typhimurium

CBD777, S.TyphimuriumCBD 817,S.Typhimurium

CBD 570 S.Anatum

CBD 425, S.Newport

CBD 426, S.Newport

CBD 428, S.Newport

CBD 444 S.Alamo

CBD 435 S.Westhampton

CBD 430 S.ApapaCBD 579 S.Montvideo

CBD 67, S.Newport

CBD 824,S.Tallahassee

CBD 808,S.Muenchen

CBD 575 S.Istanbul

CBD 573 S.Istanbul

CBD 807,S.Javiana

CBD 819,S.Javiana

CBD 603 S.Javiana

CBD 222 S.Javiana

CBD 826 S.Javiana

CBD 833 S.IV 50:z4,z23:-

CBD 780 S.IV 50:z4,z23:-CBD 747 S.IV 50:z4,z23:--

CBD 432 S.arizonae

CBD 433 S.arizonae

Clinical

Clinical

Clinical

Clinical

Clinical

Clinical

Environmental

Clinical

Clinical

Clinical

Clinical

ClinicalClinical

Environmental

Clinical

Clinical

Clinical

Environmental

Clinical

EnvironmentalEnvironmental

Clinical

Clinical

Clinical

Environmental

Environmental

Clinical

Clinical

Clinical

Clinical

Clinical

Clinical

ClinicalClinical

Environmental

Clinical

201

Figure A2. PFGE of Wild type Salmonella Isolates

Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]

PFGE Xba-1

100

959085807570656055504540353025

PFGE Xba-1

CBD 821,S.Sandiego

CBD776, S.Sandiego

CBD 582 S.Reading CBD 583 S.Reading

CBD 814,S.Anatum

CBD 815,S.Newport

CBD 436 S.Paratyphi A CBD 825,S.Paratyphi

CBD 570 S.Anatum CBD 833 S.IV 50:z4,z23:-

CBD 747 S.IV 50:z4,z23:-- CBD 780 S.IV 50:z4,z23:-

CBD 432 S.arizonae

CBD 437,S.SaintpaulCBD 434 S.Branderburg

CBD 806,S.Sspp1CBD 425, S.Newport

CBD 426, S.Newport CBD 427, S.Newport

CBD 428, S.Newport

CBD 808,S.Muenchen

CBD 831, S.Muenchen

CBD 33 S.AberdeenCBD 809,S.Muenchen

CBD 444 S.Alamo

CBD 575 S.Istanbul

CBD 573 S.IstanbulCBD 574 S.Istanbul

CBD 813,S.JavianaCBD 782, S.Stanley

CBD 822,S.subsp.1CBD 569 S.Alachua

CBD 440 S.Muenchen

CBD 441 S.MuenchenCBD 442 S.Muenchen

CBD 826 S.Javiana

CBD 578 S. Mbandaka

CBD 604, S.NewportCBD 759, S.Newport

CBD 571, S.NewportCBD 591, S.Newport

CBD 590, S.NewportCBD 595, S.Newport

CBD 585, S.Newport

CBD 587, S.NewportCBD 592, S.Newport

CBD 593, S.NewportCBD 594, S.Newport

CBD 596, S.NewportCBD 584, S.Newport

CBD 588, S.Newport

CBD 586, S.Newport

CBD 589, S.Newport

CBD 597, S.Newport CBD 598, S.Newport

CBD 572, S.Newport

CBD 827, S.Newport

CBD 67, S.NewportCBD 829, S.Newport

CBD 213, S.Newport CBD 805,S.Berta

CBD 429 S. Oranienburg CBD 819,S.Javiana

CBD 603 S.Javiana

CBD 830 S.JavianaCBD 445 S.Javiana

CBD 807,S.JavianaCBD 222 S.Javiana

CBD 69 S.JavianaCBD 576 S.Kentucky

CBD 577 S.Kentucky

CBD 580 S.Muenster

CBD 581 S.Muenster CBD 579 S.Montvideo

CBD 435 S.Westhampton

CBD 433 S.arizonae CBD 32 S.Nima

CBD 824,S.TallahasseeCBD 832 S.Enteritidis

CBD779, S.EnteritidisCBD 818,S.Enteritidis

CBD 439 S.Enteritidis

CBD 781, S.Enteritidis

CBD 817,S.Typhimurium

CBD 430 S.ApapaCBD 810,S.Heildelberg

CBD 431,S.Saintpaul

CBD 446 S.Typhimurium

CBD 757 S.TyphimuriumCBD778, S.Typhimurium

CBD 820,S.TyphimuriumCBD 828 S.Tyhpimurium

CBD 775, S.TyphimuriumCBD 438 S.Typhimurium

CBD 746 S.Typhimurium

CBD777, S.TyphimuriumCBD 823,S.Typhimurium

CBD 443 S.Hildgo CBD 811,S.I 4,12:i :-

CBD 816,S.Typhimurium

Clinical

Clinical

EnvironmentalEnvironmental

Clinical

Clinical

ClinicalClinical

EnvironmentalClinical

ClinicalClinical

Environmental

ClinicalClinical

ClinicalClinical

ClinicalClinical

Clinical

Clinical

Clinical

ClinicalClinical

Environmental

Environmental

EnvironmentalEnvironmental

ClinicalClinical

ClinicalEnvironmental

Environmental

EnvironmentalEnvironmental

Clinical

Environmental

ClinicalClinical

EnvironmentalEnvironmental

EnvironmentalEnvironmental

Environmental

EnvironmentalEnvironmental

EnvironmentalEnvironmental

EnvironmentalEnvironmental

Environmental

Environmental

Environmental

EnvironmentalEnvironmental

Environmental

Clinical

ClinicalClinical

ClinicalClinical

EnvironmentalClinical

Clinical

ClinicalEnvironmental

ClinicalClinical

ClinicalEnvironmental

Environmental

Environmental

EnvironmentalEnvironmental

Clinical

ClinicalClinical

ClinicalClinical

ClinicalClinical

Clinical

Clinical

Clinical

EnvironmentalClinical

Environmental

Clinical

ClinicalClinical

ClinicalClinical

ClinicalClinical

Clinical

ClinicalClinical

EnvironmentalClinical

Clinical

70 80 90 Macrorestriction profiling of the 100 wild type Salmonella isolates with the enzyme

XbaI. The serotype names and sources are indicated. The percent similarity between

isolates is represented

202

203

Salmonella Isolates

Dice (> 50%MEAN)Antibiotic resistance

sources are indicated. The percent similarity between isolates is represented

Figure A3. Antibiotic Resistance Profiling of Wild type

Antibiograms of the 100 wild type Salmonella for 31 drugs. The serotype names and

100

989694929088868482807876747270686664626056 58 AMI

AUG

AMP

FOX

TIO

AXO

CEP

CH

CIP

G K NAL

STR

SMX

TET

COT

A/S

AZT

FEP

FOP

FOT

TAZ

IMI

LEVO

LOM

PIP

P/T

FIS

TIC

TIM

TOB

Antibiotic resistance

70 80CBD 587, S.NewportCBD 574 S.Istanbul

CBD 589, S.NewportCBD 594, S.NewportCBD 830 S.Javiana

CBD 832 S.Enteritidis

CBD 807,S.JavianaCBD 814,S.AnatumCBD 435 S.WesthamptonCBD 442 S.Muenchen

CBD 445 S.Javiana CBD 32 S.Nima CBD 33 S.AberdeenCBD 69 S.Javiana

CBD 596, S.Newport

CBD 810,S.HeildelbergCBD 820,S.TyphimuriumCBD 821,S.Sandiego

CBD 817,S.TyphimuriumCBD 781, S.Enteritidis

CBD 222 S.JavianaCBD 595, S.Newport

CBD 213, S.Newport CBD 827, S.NewportCBD 828 S.Tyhpimurium

CBD 829, S.Newport

CBD 831, S.MuenchenCBD 833 S.IV 50:z4,z23:-CBD 578 S. Mbandaka

CBD 780 S.IV 50:z4,z23:-

CBD 782, S.StanleyCBD 805,S.BertaCBD 819,S.Javiana

CBD 806,S.Sspp1CBD 811,S.I 4,12:i :-CBD 813,S.Javiana

CBD 444 S.Alamo

CBD 446 S.TyphimuriumCBD 67, S.NewportCBD 809,S.Muenchen

CBD 818,S.Enteritidis

CBD 822,S.subsp.1CBD 808,S.MuenchenCBD 757 S.Typhimurium

CBD 759, S.NewportCBD 775, S.Typhimurium

CBD776, S.SandiegoCBD778, S.Typhimurium

CBD779, S.EnteritidisCBD 571, S.NewportCBD 593, S.Newport

CBD 572, S.Newport

CBD 815,S.NewportCBD 436 S.Paratyphi A CBD 579 S.MontvideoCBD 573 S.Istanbul

CBD 580 S.Muenster CBD 582 S.Reading CBD 581 S.Muenster CBD 826 S.Javiana

CBD 440 S.Muenchen

CBD 441 S.MuenchenCBD 592, S.NewportCBD 824,S.Tallahassee

CBD 584, S.Newport CBD 583 S.Reading

CBD 437,S.SaintpaulCBD 597, S.Newport

CBD 591, S.NewportCBD 598, S.NewportCBD 816,S.Typhimurium

CBD 746 S.Typhimurium

CBD 823,S.TyphimuriumCBD777, S.TyphimuriumCBD 438 S.Typhimurium

CBD 825,S.ParatyphiCBD 569 S.Alachua

CBD 586, S.NewportCBD 588, S.Newport

CBD 590, S.NewportCBD 570 S.Anatum CBD 575 S.Istanbul

CBD 576 S.Kentucky

CBD 577 S.Kentucky CBD 585, S.NewportCBD 428, S.Newport

CBD 429 S. Oranienburg

CBD 425, S.Newport CBD 433 S.arizonae CBD 426, S.Newport

CBD 427, S.Newport CBD 431,S.Saintpaul

CBD 430 S.ApapaCBD 432 S.arizonae

CBD 434 S.Branderburg CBD 603 S.JavianaCBD 604, S.Newport

CBD 747 S.IV 50:z4,z23:.

CBD 439 S.EnteritidisCBD 443 S.Hildgo

EnvironmentalEnvironmental

EnvironmentalEnvironmentalClinical

Clinical

ClinicalClinicalClinicalEnvironmental

EnvironmentalClinicalClinicalClinical

Environmental

ClinicalClinicalClinical

ClinicalClinical

ClinicalEnvironmental

ClinicalClinicalClinical

Clinical

ClinicalClinicalEnvironmental

Clinical

ClinicalClinicalClinical

ClinicalClinicalClinical

Environmental

ClinicalClinicalClinical

Clinical

ClinicalClinicalClinical

ClinicalClinical

ClinicalClinical

ClinicalEnvironmentalEnvironmental

Environmental

ClinicalClinicalEnvironmentalEnvironmental

EnvironmentalEnvironmentalEnvironmentalClinical

Environmental

EnvironmentalEnvironmentalClinical

EnvironmentalEnvironmental

ClinicalEnvironmental

EnvironmentalEnvironmentalClinical

Clinical

ClinicalClinicalClinical

ClinicalEnvironmental

EnvironmentalEnvironmental

EnvironmentalEnvironmentalEnvironmental

Environmental

EnvironmentalEnvironmentalClinical

Environmental

ClinicalClinicalClinical

ClinicalEnvironmental

EnvironmentalEnvironmental

ClinicalClinicalClinical

Clinical

ClinicalEnvironmental

204

AM CA FE FO FO TA A

O

CH CIP GE IM LEVO LO PI P/ FIS TE TI TI TO SXI

A/S AZT R P P T Z X L N I M P T T C M B T

CBD# 32

4 S 2 S S 2 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

1 S 1 S

.12 S .5 S

8 S

8 S

256S

1 S

8 S 16 S

1 S .5 S

CBD# 33

4 S 2 S S 2 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

1 S 1 S

.12 S .5 S

8 S

8 S

256S

1 S

8 S 16 S

1 S .5 S

CBD# 67

4 S 4 S S 2 64 R

2 S 4 S 4 S 1 S 4 S

8 S .25S

1 S 1 S

.12 S .5 S

16 S

8 S

256S

1 S

8 S 16 S

1 S 1 S

CBD# 69

4 S 2 S S 2 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

1 S 1 S

.12 S .5 S

8 S

8 S

256S

1 S

8 S 16 S

1 S .5 S

CBD# 213

4 S 2 S S 2 32 I

2 S 4 S 4 S 1 S 4 S

8 S .25S

1 S 1 S

.12 S .5 S

8 S

8 S

256S

2 S

8 S 16 S

1 S .5 S

CBD# 222

4 S 2 S S 2 32 I

2 S 4 S 4 S 1 S 4 S

8 S .25S

1 S 1 S

.12 S .5 S

8 S

8 S

256S

1 S

8 S 16 S

1 S .5 S

CBD# 425

4 S 16 I 16 I 64 R

2 S 32 I 32 I 16 I 32 I

16 I .25S

1 S 1 S .12 S .5 S 64 I

8 S 256S 8 I 64 I

64 I 1 S 0.5S

CBD# 426

4 S 16 I 16 I 128R

2 S 32 I 32 I 16 I 32 I

16 I .25S

1 S 1 S .12 S .5 S 64I 64 I

256S 8 I 64 I

128R

1 S .5 S

CBD# 427

4 S 16 I 16 I 64R 2 S 32 I 32 I 16 I 32 I

16 I .25S

1 S 1 S .12 S .5 S 64I 16S

256S 8 I 64 I

128R

8 I .5 S

CBD# 428

4 S 16 I S 8 64 R

2 S 32 I 16 I 16 I 16 I

16 I .25S

1 S 1 S .12 S .5 S 64 I

8S 256S 8 I 64 I

64 I 1 S .5 S

CBD# 429

4 S 16 I S 4 32 I 2 S 32 I 8S 2S 4 S

16 I .25S

1 S 1 S .12 S .5 S 64 I

8 S 256S 8 I 32 I

32 I 1 S .5 S

CBD# 430

4 S 16 I S 2 32 I 2 S 8S 4 S 1 S 16 I

4 S .25S

1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 32 I 1 S .5 S

CBD# 431

4 S 4S S 4 32 I 2 S 4 S 4 S 1 S 4 S

8 S .25S

1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 32 I 1 S .5 S

CBD# 432

4 S 2 S S 8 32 I 2 S 4 S 4 S 4 S 4 S

2 S .25S

1 S 1 S .12 S .5 S 8 S 8 S 256S 1 S 8 S 16 S

1 S .5 S

CBD# 433

4 S 16 I S 4 64R 2 S 32 I 4 S 16 I 8 S

16 I .25S

1 S 1 S .12 S .5 S 64 I

8 S 256S 8 I 64 I

16 S

1 S .5 S

CBD# 434

4 S 2 S S 4 32 I 2 S 4 S 4 S 8S 4 S

16 I .25S

1 S 1 S .12 S .5 S 8 S 8 S 256S 2S 64 I

16S 1S .5 S

CBD# 435

4 S 2 S S 2 32 I 2 S 4 S 4 S 1 S 4 S

8 S .25 S

I S I S .12 S .5 S 8 S 8 S 256 S

1 S 8 S 16 S

I S .5 S

CBD #436

4 S 4 S S 2 64 R

2 S 4 S 4 S 1 S 4 S

8 S .5 S 1 S I S I S 2 S 16 S

8 S 256 S

1 S 8 S 16 S

1S 1S

CBD# 437

4 S 16 I 2 S 256 R

2S 32 I 4 S 1 S 4 S

8 S .5 S 8 I 1 S .25 S 2 S 64 I

64 I

256 S

8 I 64 I

128 R

8 I 1 S

CBD# (438

4 S 16 I 2 S 256 R

2 S 32 I 4 S 1S 4 S

16 I .25 S

8 I 1 S .25 S .5 S 64 I

8 S 256 S

8 I 64 I

128 R

8 I .5 S

CBD# 439

4 S 4 S 2 S 64 R

2 S 4 S 4 S 1 S 4 S

8 S .25 S

1 S 1 S .12 S .5 S 16 S

8 S 256 S

1 S 16 S

16 S

1 S 1 S

205

AMI

A/S AZT

CAR

FEP

FOP

FOT

TAZ

AXO

CHL

CIP GEN

IMI

LEVO LOM

PIP

P/T

FIS TET

TIC

TIM

TOB

SXT

CBD# 440

4 S 16 I 2 S 256 R

2 S 32 I 4 S 1 S 4 S

16 I .25 S

8 I 1 S .5 S 2 S 64 I

8 S 256 S

8 I 64 I

128 R

8 I .5 S

CBD# 4 S 441

16 I 2 S 256 R

2 S 32 I 4 S 1 S 4 S

16 I .25 S

8 I 1 S .5 S 2 S 64 I

8 S 256 S

8 I 64 I

128 R

8 I .5 S

CBD# 442

4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S

4 S .25 S

1 S 1 S .12 S .5 S 8 S 8 S 256 S

1 S 8 S 16 S

1 S .5 S

CBD# 443

4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S

4 S .25 S

1 S 1 S .12 S .5 S 8 S 8 S 256 S

1 S 8 S 16 S

1 S .5 S

CBD# 444

4S 4 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S

8 S .25 S

1 S 1 S .12 S .5 S 16 S

8 S 256 S

1 S 8 S 16 S

1 S .5 S

CBD# 445

4 S 2 S 2 S 32 I S 2 S 4 S 4 S 1 S 4 S

4 S .25 S

1 S 1 S .12 S .5 8 S 8 S 256 S

1 S 8 S 16 S

1 S .5 S

CBD# 446

4 S 2 S 2 S 32 I 2 S 4 S 4 S 1 S 4 S

4 S .25 S

1 S 1 S .12 S .5 S 8 S 8 S 256 S

1 S 8 S 16 S

1 S .5 S

CBD# 569

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

8 I 1 S

.12 S .5 S

8 S

8 S

256S

8 I 8 S 16 S

8 I 0.5S

CBD# 570

4 S 4 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

8 I 1 S

.12 S .5 S

8 S

8 S

256S

8 I 8 S 16 S

8 I .5 S

CBD# 571

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

8 I 1 S

.12 S .5 S

8 S

8 S

256S

8 I 8 S 16 S

8 I .5 S

CBD# 4 S 2 S 2 S 572

32 I

2 S 4 S 4 S 1 S 4 S 4 S

.25S

8 I 1 .12 S .5 8 256S S S

8SS

8 I S 8 16 S

8 I .5 S

CBD# 4 S 4 S 2 S 573

32 I

2 S 4 S 4 S 1 S 4 S 4 S

.25S

8 I 1 .12 S .5 8 256S S

16S S S

8 I S 16 8 S

8 I .5 S

CBD#574

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

1 S 1 S

.12 S .5 S

8 S

8 S

256S

8 I 8 S 16 S

2 S .5 S

CBD# 575

4 S 4 S 2 S 64 R

2 S 4 S 4 S 1 S 4 S

8 S .25S

1 S 1 S

.12 S .5 S

16 S

8 S

256 S

8 I 8 S 16 S

1 S 1 S

CBD# 576

4 S 4 S 2 S 64 R S S S S S S

2 S 4 S 4 S 1 S 4 S

8 S .25S

1 S 1 .12 S .5 16 8 256 2 8 S 16 S

1 S 1 S

CBD# 577

4 S 4 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

1 S 1 S

.12 S .5 S

16 S

8 S

256 S

1 S

8 S 16 S

1 S .5 S

CBD# 578

4 S 4 S 2 S 64 R

2 S 4 S 4 S 1 S 4 S

8 S .25S

1 S 1 S

.12 S .5 S

16 S

8 S

256 S

1 S

8 S 16 S

2 S .5 S

CBD# 579

4 S 4 S 2 S 64 R

2 S 4 S 4 S 1 S 4 S

8 S .25S

4 S 1 S

.12 S .5 S

16 S

8 S

256 S

1 S

8 S 16 S

8 I 2 S

CBD# 4 S 580

16 I

2S 256 R

2 S 4 S 4 S 1 S 8 S .254 S S

8 I 1 .12 S .5 S S

64 I

8 6 S

25S

8 I 64 I

32 I

4 S .5 S

CBD# 4 S 581

16 I

2S 256 R

2 S 4 S 4 S 1 S 8 S .254 S S

8 I 1 .12 S .5 S S

64 I

8 S

256 S

8 I 64 I

32 I

4 S .5 S

CBD#(582

4 S 16 I

2S 256 R

2 S 4 S 4 S 1 S 4 S

8 S .25S

8 I 1 S

.12 S .5 S

32 I

8 S

256 S

8 I 64 I

16 S

8 I .5 S

206

AMI

A/S AZT

CAR

FEP

FOP

FOT

TAZ

AXO

CHL

CIP GEN

IMI

LEVO LOM

PIP

P/T

FIS TET

TIC

TIM

TOB

SXT

CBD# 583

4 S 16 I

2S 256 R

2 S 4 S 4 S 1 S 4 S

8 S .25S

8 I 1 S

.12 S .5 S

32 I

8 S

256 S

8 I 64 I

16 S

8 I .5 S

CBD# 584

4 S 16 I

2S 256 R

2 S 4 S 4 S 1 S 4 S

8 S .25S

8 I 1 S

S

.12 S .5 64 I

8 S

256 S

8 I 64 I

16 S

8 I .5 S

CBD# 585

4 S 4 S 2 S 32 I

2S 4S 4S 1S 4S 4S .25 S

1 S 8 I .12S .5S 8S 8S 256S

1S 16S

16S

1S .5S

CBD# 586

4 S 4 S 2 S 32 I

2S 4S 4S 1S 4S 4S .25 S

1 S 1 S

.12S .5S 8S 8S 256S

1S 8S 16S

1S .5S

CBD# 587

4 S 4 S 2 S 32 I S

2S 4S 4S 1S 4S 4S .25 S

1 S 1 .12S .5S 8S 8S 256S

1S 8S 16S

1S .5S

CBD# 588

4 S 4 S 2 S 32 I

2S 4S 4S 1S 4S 4S .25 S

1 S 1 S

.12S .5S 8S 8S 256S

1S 8S 16S

1S .5S

CBD# 589

4 S 4 S 2 S 32 I

S

2S 4S 4S 1S 4S 4S .25 S

1 S 1 .12S .5S 8S 8S 256S

1S 8S 16S

1S .5S

CBD# 590

4 S 4 S 2 S 32 I

2S 4S 4S 1S 4S 4S .25 S

1 S 1 S

.12S .5S 8S 8S 256S

1S 8S 16S

1S .5S

CBD# 591

4 S 16I 2S 256 R

2S 32 I

4 S 1S 4S 4S .25S

1S 1S .12S .5S 64I

64I

256 S

1S 64I 128R

1S .5S

CBD# 592

4 S 16I 2S 256 R S

2S 16 4 S 1S 4S 4S .25S

1S 1S .12S .5S 64I

8S 256 S

1S 64 I

64 I

1S .5 S

CBD# 593

4S 2S 2S 32I 2S 4S 4S 1 S 4S 4S .25S

8 I 1S .12S .5S 8S 8S 256S

8 I 8S 16S

8 I .5S

CBD# 594

4S 2S 2S 32I 2S 4S 4S 1 S 4S 4S .25S

1 S 1S .12S .5S 8S 8S 256S

8 I 8S 16S

1S .5S

CBD# 595

4S 4S 2S 64R

2S 4S 4S 1 S 4S 16I .25S

1 S 1S .12S .5S 16S

8S 256S

2S 8S 16S

1S .1S

CBD# 596

4S 2S 2S 32I 2S 4S 4S 1 S 4S 8S .25S

1 S 1S .12S .5S 8S 8S 256S

2S 8S 16S

1S .5S

CBD# 597

4S 16I 2S 256R

2S 32 I

4S 1 S 4S 8S .25S

8 I 1S .12S .5S 64 I

16S

256S

1 S

64 I

64 I

4 S .5S

CBD# 598

4S 16 I

2S 256 R

2S 32 I

4S 1 S 4S 4S .25S

8 1 1S .12S .5S 64 I

8S 256S

1 S

64 I

64 I

4 S .5S

CBD #603

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

1S 1 S

.12 S .5 S

8 S

8 S

256S

1S S

8 S 16 S

1S 0.5

CBD# 604

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

1S 1 S

.12 S .5 S

8 S

8 S

256S

1S S

8 S 16 S

1S 0.5

CBD# 746

4S 16 I

2S 256 R

2S 32 I

4S 1 S 4S 16 I .25S

8 1 1S .12S .5S 64 I

8S 256S

8 I 64 I

128 R

2 S .5S

CBD #747

4 S 4 S 2 S 64 R

2 S 4 S 4 S 1 S 4 S

4 S .25S

1S 1 S 1S 0.5S S

.12 S .5 S

16 S

8 S

256S

1S 8 16 S

CBD 4 S 2 S 2 S 32 2 S 4 S 4 S 1 S 4 4 S .25 1S 1 .12 S .5 8 8 256 1S 8 S 16 1S 0.5

207

AMI

A/S AZT

CAR

FEP

FOP

FOT

TAZ

AXO

CHL

CIP GEN

IMI

LEVO LOM

PIP

P/T

FIS TET

TIC

TIM

TOB

SXT

#757 I S S S S S S S S S CBD #759

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

1S 1 S 1S 0.5S

.12 S .5 S

8 S

8 S

256S

1S 8 16 S S

CBD #775

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

1S 1 S 1S 0.5S

.12 S .5 S

8 S

8 S

256S

1S 8 16 S S

CBD #776

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

8 S .25S

1S 1 S 1S 0.5S

.12 S .5 S

8 S

8 S

256S

1S 8 16 S S

CBD #777

4 S 16I 2 S 256R

2 S 32 I

4 S 1 S 4 S

16 I .25S

1 S 1 S

.12 S .5 S

64 I

8 S

256 S

8 I 64 I

128 R

1 S .5 S

CBD #778

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

1 S 1 S

.12 S .5 S

8 S

8 S

256 S

1 S

8 S 16 S

1 S .5 S

CBD #779

4 S 4 S 2 S 32I 2 S 4 S 4 S 1 S 4 S

8 S .25S

1 S 1 S

.12 S .5 S

8 S

8 S

256 S

1 S

8 S 16 S

1 S .5 S

CBD #780

4 S 4 S 2 S 64 R

2 S 4 S 4 S 1 S 4 S

4 S .25S

1 S 1 S

.12 S .5 S

16 S

8 S

256 S

1 S

8 S 16 S

1 S 1 S

CBD #781

4 S 4 S 2 S 64 R

2 S 4 S 4 S 1 S 4 S

8 S .25S

1 S 1 S

.12 S .5 S

16 S

8 S

256 S

1 S

8 S 16 S

1 S 1 S

CBD #782

4 S 4 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

4 S .25S

1 S 1 S

.12 S .5 S

8 S

8 S

256 S

1 S

8 S 16 S

1 S .5 S

CBD #805

4 S 2 S 2 S 64R

2 S 4 S 4 S 1 S 4 S

8 S .25S

1S 1 1S 0.5S

.12 .5 S

16S

8 S

256S

1S 8S 16 S S

CBD #806

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

8 S .25S

1S 1 1S 0.5S

.12 .5 S

8S 8 S

256S

1S 16 S

16 S S

CBD #807

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

8 S .25S

1S 1 S 1S 0.5S

.12 S .5 S

8S 8 S

256S

1S 8 16 S S

CBD #808

4 S 2 S 2 S 64 R

2 S 4 S 4 S 1 S 4 S

8 S .25S

1S 1 S S

.12 S .5 S

16 S

8 S

256S

1S 8 16 S

2 S 0.5S

CBD #809

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

8 S .25S

1S 1 1S 0.5S

.12 .5 S

8S 8 S

256S

2S 16 S

16 S S

CBD #810

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

16I .25 1S 1 S 2S 0.5S S

.12 S .5 S

8 S

8 S

256S

2S 8 16 S S

CBD #811

4 S 2 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

8 S .25S

1S 1 S 1S 0.5S

.12 S .5 S

8 S

8 S

256S

1S 8 16 S S

CBD #813

4 S 4 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

8S .25 1S 1 1S 0.5S S

.12 S .5 S

8 S

8 S

256S

1S 8 S 16 S S

CBD #814

4 S 4 S 2 S 32 I

2 S 4 S 4 S 1 S 4 S

8 S .25S

1S 1 1S 0.5S

.12 S .5 S

16S

8 S

256S

1S 8 S 16 S S

CBD #815

4 S 4S 2 S 64RR

2 S 4S 4 S 1 S 4 S

8 S .25S

1 S 1 S

.12 S .5 S

16S

8 S

256 S

1S 8S 16S

2 S 1 S

CBD #816

4 S 16I 2 S 256R

2 S 32I 4 S 1 S 4 S

16I .25S

1 S 1 S

.12 S .5 S

64I

8 S

256 S

8I 64I 128R

1 S .5 S

208

AMI

A/S AZT

CAR

FEP

FOP

FOT

TAZ

AXO

CHL

CIP GEN

IMI

LEVO LOM

PIP

P/T

FIS TET

TIC

TIM

TOB

SXT

CBD #817

4 S 16I 2 S 64 R

2 S 4 S 4 S 1 S 4 S 1 S .12 S 6 1 8 S 1 S S 4 S

.25S

1 S

.5 S

16S

8 S

25S S

16S

1

CBD #818

4 S 4 S 2 S 64 R

2 S 4 S 4 S 1 S 4 S

8 S .25S

1S 1 1S 0.5S

.12 S .5 S

16S

8 S

256S

1S 8 S 16 S S

CBD #819

4 S 4 S 2 S 64R

2 S 4 S 4 S 1 S 4 S

8 S .25S

1S 1 1S 0.5S

.12 S .5 S

16S

8 S

256S

1S 16 S

16 S S

CBD #820

4 S 4 S

2 S 64R

2 S 4 S

4 S 1 S

4 S

8 S .25S

1S 1 1S 0.5S

.12 S .5 S

8S 8 S

256S

1S 8S 16 S S

CBD #821

4 S 2 S

2 S 32 I

2 S 4 S

4 S 1 S

4 S

8 S .25S

1S 1 1S 0.5S

.12 S .5 S

8S 8 S

256S

1S 8S 16 S S

CBD #822

4 S 4 S

2 S 64R

2 S 4 S

4 S 1 S

4 S

8 S .25S

1S 1 S

.12 S .5 S

16S

8 S

256S

1S 8S 16 S

2S 1S

CBD #823

4 S 16 I

2 S 256 R

2 S 32I

4 S 1 S

4 S

16 I .25S

1S 1 S

.12 S .5 S

64I

8 S

256S

8I 64I 128R

1S 0.5S

CBD #824

4 S 16 I

2 S 256 R

2 S 32I

4 S 1 S

4 S

16 I .25S

1S 1 S

.12 S .5 S

64I

8 S

256S

8I 64I 128R

1S 0.5S

CBD #825

4 S 16 I

2 S 256 R

2 S 32I

4 S 1 S

4 S

16 I .5S 1S 1 S

.5 S 2 S 64I

8 S

256S

8I 64I 128R

1S 0.5S

CBD #826

4 S 16I

2 S 256 R

2 S 32I

4 S 1 S

4 S

16 I .25S

1S 1 S

.5 S 2S 64I

8 S

256S

8I 64I 128R

1S 0.5S

CBD# 827

4 S 2 S

2 S 32 I

2 S 4 S

4 S 1 S

4 S

4 S .25S

1S 1 1S 0.5S

.12 S .5 S

8 S

8 S

256S

1S 8 S 16 S S

CBD #828

4 S 2 S

2 S 32 I

2 S 4 S

4 S 1 S

4 S

8 S .25S

1S 1 1S 0.5S

.12 S .5 S

8 S

8 S

256S

1S 8 S 16 S S

CBD #829

4 S 2 S

2 S 32 I

2 S 4 S

4 S 1 S

4 S

4 S .25S

1S 1 S 1S 0.5S

.12 S .5 S

8 S

8 S

256S

1S 8 16 S S

CBD #830

4 S 4 S

2 S 64 R

2 S 4 S

4 S 1 S

4 S

8 S .25S

1 S 1 S

.12 S .5 S

16 S

8 S

256 S

1 S

8 S 16 S

2 S 1 S

CBD #831

4 S 4 S

2 S 32 I

2 S 4 S

4 S 1 S

4 S

4 S .25S

1 S 1 S

.12 S .5 S

8 S

8 S

256 S

1 S

8 S 16 S

1 S .5 S

CBD #832

4 S 2 S

2 S 32 I

2 S 4 S

4 S 1 S

4 S

8 S .25S

1 S 1 S

.12 S .5 S

8S 8 S

256 S

1 S

8 S 16 S

1 S .5 S

CBD #833

4 S 2 S

2 S 32 I

2 S 4 S

4 S 1 S

4 S

4 S .25S

1 S 1 S

.12 S .5 S

8S 8 S

256 S

1 S

8 S 16 S

1 S .5 S

Table A i c s e b f la u ng p l. AMI- Am n S m ci , ZT zt nam,

- e l C p T ef ax T -C a im X - r on

ra nicol, CIP- Ciprofloxacin, E G ta Levofloxacin, LOME- Lome

rac n, - e ill Ta ba um

ulanic d, TOB obramy in, SXT- Trimethoprim ulpham oxazole. = resist , I Intermediately resistant. Gray

in t o T v s i / .

e A i tic Sus ng M -7 e

A2. ntib oti usc pti ility o iso tes si NF ane ikaci , A/ - A pi llin/Sublactum A - A reo

CAR Carb nici in, FEP- efe ime, FOP- Cefoperazone, FO - C ot ime, AZ eft zid e, A O Ceft iax e, CHL-

Chlo mphe G N- en micin, IMI- Imipenem, LEVO- floxacin, PIP-

Pipe illi P/T Pip rac in/ zo ct , FIS- Sulfizoxazole, TET- Tetracycline, TIC- Ticarcillin, TIM- Ticarcillin/

Clav Aci - T c /S eth R ant =

cells dica e R r I. he alue are n μg ml

Tabl A3. ntib o ceptibility Testi C V Pan l

AMI AUG AMP FOX TIO XO CEP CHL CIP EN KAN NAL STR X TET A G SM COT CBD# 32

1S 1S S 1S .5S .25S 8S .01S .5S 8S 4S 32 S 64S 4S .12S 2

CBD# 33

1S 1S 1S 1S .5S 5S .01S .25S 8S 4S S 4S .2 8S 32 S 32 .12S

CBD# 67

1S 5S 4S 1S 1S 2S .5S .2 2S 4S .01S .25S 8S 32S 32S 4S .12S

CBD# 69

1 5S 4S S 1S 1S 4S .5S .2 2S 8S .01S .1S 8S 32S 32S 4S .12S

CBD# 213

1S 5S 1S 4S 4S 1S .2 8S 16I .3S 5S 3 4S .2 8S 16S 2S 32S .12S

CBD# 222

1S 5S 3 1S 2S 2S 1S .2 4S 8S 01S 1S 8S 8S 2S 16S 4S .12S

CBD# 1S 425

32R 32R 16I 8R 16I 32R 32R .01S .25S S 8S 4 64R 512R 32R 2.1 S

CBD# 1S 426

32R 32R 16I 8R 32R 32R 32R .01S .25S 4S 8S 64R 512R 32R 2.1 S

CBD# 1S 427

32R 32R 16I 8R 32R 32R 32R .01S .25S 4S 8S 64R 512R 32R 2.1 S

CBD# 428

1S 32R 32R 16I 8R 16I 32R 32R .01S .25S 8S 2S 64R 512R 32R .12S

209

210

AMI AUG AMP FOX TIO AXO CEP CHL CIP GEN KAN NAL STR SMX TET COT CBD# 2S 429

32R 32R 16I 8R 16I 32R 32R .01S .5S 8S 4S 64R 512R 32R .12S

CBD# 430

1S 32R 32R 16I 8R 8S 32R 32R .01S .25S 8S 4S 64R 512R 32R .12S

CBD# 431

2S 32R 32R 16I 8R 16I 32R 32R .01S 1 S 8S 4S 64R 512R 32R .12S

CBD# 1S 432

32R 32R 16I 8R 8S 32R 32R .01S .5S 8S 2S 64R 512R 32R .12S

CBD# 1S 433

32R 32R 16I 8R 16I 32R 32R .01S 1S 8S 2S 64R 512R 32R .12S

CBD# 434

2S 32R 32R 16I 8R 8S 32R 32R .01S .5S 8S 4S 64R 512R 32R .12S

CBD# 435

1S 1S 1S 4S .5S .25S 2S 8S .01S .5S 8S 4S 32S 16S 4S .12S

CBD# 436

.5S 2S 2S 8S 1S .25S 8S 8S .5S .25S 8S 32R 32S 16S 4S .12S

CBD# 2S 437

16I 32R 2S 1S .25S 32R 4S .01S 16R 64R 2S 32S 512R 32R .25S

CBD# 2S 8S 438

32R 2S .5S .25S 2S 32R .01S 1S 8S 4S 64R 512R 32R .25S

CBD# 39

1S 8S 4

32R 2S .5S .25S 2S 32R .01S .25S 8S 4S 64R 512R 16R .12S

CBD# 440

1S 1S 2S 2S .5S .25S 2S 4S .01S .25S 8S 4S 32S 32S 4S .12S

CBD# 441

1S 1S 2S 1S .5S .25S 8S .01S .25S 8S 4S 32S 32S 4S .25S

CBD# 442

1S 1S 2S 1S .5S .25S 8S .01S .25S 8S 4S 32S 32S 4S .25S

CBD# 443

2S 8S 32R 2S .5S .25S 2S 32R .01S .5S 8S 4S 64R 512R 16R .12S

CBD# 444

1S 1S 1S 2S .5S .25S 2S 4S .01S .25S 8S 4S 32S 16S 4S .12S

CBD# 445

1S 1S 1S 1S .5S .25S 2S 8S .01S 1S 8S 4S 32S 16S 4S .12S

CBD# 446

2S 1S 1S 1S .5S .25S 2S 4S .01S 1S 8S 4S 32S 16S 4S .12S

CBD# 569

1S 1S 2S 2S .5S .25S 2S 4S .01S 16R 8S 4S 32S 512R 32R .25S

CBD# 570

2S 1S 1S 4S .5S .25S 2S 4S .01S 8I 8S 4S 32S 512R 32R .12S

CBD# 571

2S 1S 1S 4S .5S .25S 2S 4S .01S 4S 8S 4S 32S 16S 4S .12S

CBD# 1S 1S 1S 1S .5S .25S 8S .01S .5S 8S 2S 32 S 32S 4S .12S

211

AMI AUG AMP FOX TIO AXO CEP CHL CIP GEN KAN NAL STR SMX TET COT 572 CBD# 573

2S .5S .25S .01S .25S 4S 2S 1S 1S 8S 4S 64R 32S 32R .12S

CBD# 574

2S .5S .25S 8S 2S 1S 1S 4S 4S .01S .5S 64R 32S 32R .12S

CBD# 575

1S 1S .25S 1S 1S 4S 2S 4S .01S 8I 8S 4S 64R 512R 32R .12S

CBD# 576

4S .5S .25S 8S 4S 1S 1S 2S 2S 4S .01S .5S 32S 128S 32R .12S

CBD# 577

4S .5S .25S .5S 8S 4S 1S 1S 2S 8S .01S 64R 32S 32R .12S

CBD# 578

1S .5S .25S 1S 1S 4S 2S 4S .01S 1S 8S 4S 32S 16S 4S .12S

CBD# 579

4S 1S 1S 4S 4S 4S .5S .25S .01S 8I 64R 4S 64R 16S 4S .12S

CBD# 580

2S 4S 32R 4S .01S 1S .25S 8S 8S 16R 64R 4S 64R 512R 32R .12S

CBD# 581

2S 8S 32R 8S 1S .25S 8S .01S 16R 16S 4S 64R 265R 32R .12S

CBD# 582

2S 4S 32R 8S 1S .25S 8S 16I .03S 16R 64R 8S 64R 512R 32R .25S

CBD# 583

2S 2S 2S 8S 1S .25S 16I .01S 16R 8S 4S 64R 265R 16R .12S

CBD# 584

1S 1S 2S 1S 2S 4S .5S .25S .01S .25S 8S 4S 32S 16S 4S .25S

CBD# 585

1S 1S 2S 4S 8S 1S .25S .01S 8I 8S 2S 128S 4S 32S .12S

CBD# 586

2S 1S 2S 4S 8S 1S .25S .01S 16R 8S 4S 32S 265R 16R .12S

CBD# 587

2S 1S 2S 4S 1S .25S 4S .01S 16R 8S 4S 32S 64S 8I .12S

CBD# 588

1S 1S 4S 4S 8S .5S .25S .01S 8I 8S 2S 32S 64S 32R .25S

CBD# 589

2S 1S 2S 2S .5S 8S 2S 1S .25S 8S .01S 32S 32S 16R .12S

CBD# 590

1S 1S 2S 2S .01S .25S 8S 4S .5S .25S 4S 64R 256R 32R .12S

CBD# 591

2S 16I 32R 4S .5S .25S 4S .01S .25S 8S 2S 64R 256R 4S .12S

CBD# 592

1S 1S 2S 2S .01S .25S 8S 4S .5S .25S 4S 64R 256R 32R .25S

CBD# 593

2S 2S 1S 2S .01S .25S 8S 2S .5S .25S 4S 64R 64S 4S .12S

212

AMI AUG AMP FOX TIO AXO CEP CHL CIP GEN KAN NAL STR SMX TET COT CBD# 594

2S 2S 32R 2S .01S .5S .5S .5S 8S 8S 4S 32S 64S 8I .12S

CBD# 595

1S 1S 4S 4S 4S 1S .25S 16I .03S 1S 8S 16S 32S 16S 4S .25S

CBD# 596

4S 1S 4S 4S 4S 1S .25S 16I .03S .25S 8S 4S 32S 32S 4S .25S

CBD# 597

1S 8S 32R 2S 1S .25S 32R 8S .03S 16R 64R 8S 64R 512R 4S .25S

CBD# 598

2S 8S 32R 4S 1S .25S 16I 8S .03S 16R 64R 32R 64R 512R 4S .12S

CBD# 603

1S 8S 32R 2S 8S .5S .25S 8S .01S 16R 64R 4S 32S 512R 4S .12S

CBD# 604

2S 8S 32R 2S 1S .25S 8S 8S .03S 16R 64R 8S 32S 512R 4S .12S

CBD# 746

2S 8S 32R 2S 1S .25S 2S 32R .015S 1S 8S 8S 64R 512R 16R .25S

CBD# 747

2S 8S 32R 4S 1S .25S 4S 32R .03S 1S 8S 8S 64R 512R 16R .12S

CBD# 757

1S 1S 2S 4S 015S .5S 1S 2S 2S .25S . 8S 4S 32S 16S 4S .12S

CBD# 759

1S .5S S 1S 1S 4S .25S 2 4S .015S .25S 8S 4S 32S 16S 4S .12S

CBD# 775

1S 1S 1S 2S .5S 2S .25S 4S .015S .25S 8S 4S 32S 16S 4S .12S

CBD# 776

2S 1S 1S 2S 2S 4S 015S 1S .5S .25S . 8S 4S 32S 16S 4S .12S

CBD# 777

1S 8S 32R 2S .5S 2S .25S 32R .015S .5S 8S 4S 64R 512R 16R .25S

CBD# 778

1S 1S 1S 2S .5S 2S 4S 015S 1S .25S . 8S 4S 32S 16S 4S .12S

CBD# 779

1S 1S 1S 2S 1S 4S 4S .25S .015S .25S 8S 4S 32S 16S 4S .12S

CBD# 780

1S 1S 1S 2S 2S 4S .5S .25S .015S .25S 8S 2S 32S 16S 4S .12S

CBD# 781

1S 1S 2S 2S 1S 2S 8S .25S .03S .25S 8S 8S 32S 16S 4S .12S

CBD# 782

2S 1S 1S 2S 2S 4S 015S 1S .5S .25S . 8S 4S 32S 16S 4S .12S

CBD# 805

2S 2S 4S 1S 1S 1S .5S .25S .01S .5S 8S 4S 32S 16S 4S .12S

CBD# 806

1S 1S 1S 1S 4S 4S .5S .25S .01S .25S 8S 4S 32S 16S 4S .12S

CBD# 1S 1S 1S 4S 4S 8S .01S 1S .5S .25S 8S 4S 32S 16S 4S .12S

213

AMI AUG AMP FOX TIO AXO CEP CHL CIP GEN KAN NAL STR SMX TET COT 807 CBD# 808

2S .25S 2S 4S 4S 1S 1S 2S .5S .01S 1S 8S 4S 32S 16S .12S

CBD# 809

1S 1S 1S 2S .5S 2S .25S 4S .01S .25S 8S 4S 32S 16S 4S .12S

CBD# 810

1S 1S 2S 1S .5S 2S .25S 8S .01S .25S 8S 4S 32S 16S 4S .12S

CBD# 811

2S .5S 4S 1S 2S 2S .25S 2S .01S 1S 8S 4S 32S 16S 4S .12S

CBD# 813

1S .5S 4S 1S 1S 1S .25S 2S .01S .25S 8S 2S 32S 16S 4S .12S

CBD# 814

1S 4S 8S 1S 1S 4S .5S .25S .01S .25S 8S 4S 32S 16S 4S .12S

CBD# 815

.5S 1S 2S 16I 1S .25S 16I 8S .01S .25S 8S 4S 32S 16S 4S .12S

CBD# 816

1S 16I 32R 2S .5S .25S 2S 32R .01S 1S 8S 4S 64R 512R 16R .12S

CBD# 817

1S .5S S 1S 1S 1S .25S 8S .01S .25S 8S 4S 32 32S 4S .12S

CBD# 818

1S 1S 1S 1S .5S 4S .25S .01S .25S 8S 2S 32S 32S 4S .12S

CBD# 819

2S 1S 1S 2S 4S .5S .25S .01S .5S 8S 4S 32S 16S 4S .12S

CBD# 820

1S 1S 2S 1S 8S .5S .25S .01S .25S 8S 2S 32S 32S 4S .25S

CBD# 821

1S 1S 2S 2S 8S .5S .25S .01S .25S 8S 4S 32S 64S 4S .12S

CBD# 822

1S 1S 1S 1S .5S .25S 4S .01S .25S 8S 2S 32S 16S 4S .12S

CBD# 823

1S 8S 32R 2S .5S .25S 32R .01S .5S 8S 2S 64R 256R 16R .12S

CBD# 824

1S 8S 8S 1S .5S .25S 16I .01S .5S 8S 2S 32S 64S 8I .12S

CBD# 825

1S 4S 16I 2S .5S .25S 32R .5S .25S 8S 32R 32S 256R 16R .12S

CBD# 826

1S 1S 2S 1S .5S 8S .25S .01S .5S 8S 4S 32S 32S 4S .12S

CBD# 827

1S 1S 1S 2S 4S .5S .25S .01S .25S 8S 2S 32S 64S 4S .12S

CBD# 828

1S 1S 1S 1S 4S .5S .25S .01S .25S 8S 4S 32S 32S 4S .12S

CBD# 829

1S 1S 1S 1S .25S 2S .25S .01S .25S 8S 2S 32S 32S 4S .12S

214

AMI AUG AMP FOX TIO AXO CEP CHL CIP GEN KAN NAL STR SMX TET COT CBD# 830

2S 1S 1S 2S .5S .25S 8S .01S 1S 8S 4S 32S 32S 4S .12S

CBD# 831

1S 1S 1S 2S 4S .5S .25S .01S .25S 8S 4S 32S 32S 4S .12S

CBD# 832

1S 1S 1S 2S 8S .5S .25S .01S .25S 8S 4S 32S 32S 4S .12S

CBD# 833

1S 1S 1S 1S 4S .5S .25S .01S .25S 8S 2S 32S 32S 4S .12S

Table A3 Antibiotic susceptibil re s o 1 so s C 7 el. I- k A P- icillin, AUG-

Am

Cip xacin, COT-Trimethoprim/Sulfamethaxazole, FOX- Cefoxitin, GEN- Gentamicin, KAN- Kanamycin, NAL- Nalidixic

tho ole TR e yc n, T Te c T Ce fu ta = mediately

resis t. Gray cells indicate R or I. Cep was not tested for al cks this antibiotic. The

valu re in μg/ml.

ity sult f the 00 i late with MV- pan AM Ami acin, M Amp

oxicillin/Clavulanic Acid, AXO- Ceftriaxone, Tio- Ceftiofur, CEP- Cephalothin, CHL- Chloramphenicol, CIP-

roflo

Acid, SMX- Sulfame xaz , S - Str ptom i ET- tracy line, IO- ftio r. R= resis nt, I Inter

tan l the isolates as the new CMV-7 panel la

es a

Figure A4 Sequencing data of 1.0 Kb and 1.2 Kb Integron Fragments 438 1.0 Kb ACGCTTGTGGGTCGATGTTTGATGTTAT GCAGCAACGATGTTACGCAGC

C GTCGCCCT T TCATGAGGGTAGCGGTGACCATCAAAATTTCaGAAC T TAAGCGTCATTTGAGCGCCATCT

T ACGTTGC G CGGCTCCGCAGTGGATGGCGGCCTGAAGCCATACAG A T GTTACTGTGGCCGTAAAGCTTGA

A ACGCGGC CCTTATGGAGGCTTCGGCTTTCG AGAGCGAGAC T T GAAGTCACCCTTGTCGTGCATGC CATCCCG T C AGCGCGAGCTGCAATTTGGAGAC CGCAATG A T CTTCGAGCCAGCCATGATCGAC

ATTGATCTAGCTAT G T ATAGCGTTGCCTTGG CGGCAGC A A C TCCTGAACAGGATCTAT

TCGAGGCGCTGAGGGAAACC A C TCGCAGCCCGACTGGGCG GAGCGAA G C GTCCCGCATTTGGTACAGCGCA

ATAACCGGCAAAAT C GAAGGAT GCTGCCGACTGGGCAATAAAATACCTGCCCA G TTGAAGCTAAGCAATGCTTATC

TGGGACAAAAAGAA T C T AGATCACTTGGAAGAATTC TTTGTGAA G AGTCAGTTGGTAAATGATGTCTAT GTTCAAG CGCGGCGGtCTTAACTCCGGCGT

TAGA

438 1.2 Kb

GTAATGGAGCAGCAACGTATGTTACGA GCAGTCG C GCCATATTATGGAGCCTCATGC

TTTTATATAAAATG G A A A ATGGGGTTACTTACATGAAGTTTT CATTTTCG T A C CCGTGGTTTTTGCAAGTAGTTCAAAG

TTTCAGCAAGTTGA C T ATTGAAGTTTCTCTTTCTGCTCGG GTTTCCGTTCTTGATACT A GGAGAATATTGGGATTACAATG

GCAATCAGCGCTTC A A C TTAAAACAATAGCTTGCGCTAAATATATGATGC G A A AGTTAATCCCAATAGTACAGTCGAGA

TA G AAGCAGAT A T C CTGTAATAGAAAAGCAAGTAGGGCAGGCAATCACAC CGCAACTATGACTACAAGTGAT

C CGGCAAA T C A G G GTGGCCCCAAAGGCGTTACTGATTTTTTAAGA A CTCGTCTAGACCGTATTGA

GATTTAAATG A T GACAACTCCTA C ATAGCCAG C G T A T TTGGTTCCGCGCTATCTGA

AGATCA A T T TGAACAATCAAGTCACTGGGTTC T T GGCG A AACATTGCGGATCGCTCAG

GTGCTGGCGGATTT G C C AGTTGTGTGGAGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGCAGAGCGAAATGATGCGATTGTTAAATTATTGGTCATTCAATTTTTGACGTTT

GGAAAAACAAAG TAGACA

CAACTATCAGAAG GCTGGCCGTGCATTT TACG TATTGATTTG TGGAGCATTGCTCAATGA

GC CCGCGC ATATGGCGT ATCCGG TAAC TTC TGCGGGTAT

CCT CT ACAAAAGCAAAGAGAACGG GG ATT TTTGACCCGGT

TTG AG TATGGAACAT TAGTGCTTA GTTCG GCC GTC

GTATCA CCCGTCTTACGA CA TTGGCC CACGCGCAG GCGAGATCATCA

CCGtACCGtCGtCTACGt

CC TAAAACAAAGTTATGT AC ATC AA TTCT TTA TA CAT

ACAAGA GT AAGGCACA AAT

CCGTTA CA GTA TTTGA CA GG AACTTGTG CC ATT CCTCGATGATGCGTGCTTTA CAT CT AGT CT TAG

CAA TTGGGGACAAAGAGAAAGGTA GC CGGTGATTTGAGGGATACTA TTT AA AA TTT TATAA TTAGAGTCT GGA GGAG AT GCC GG TGG

GGT CT GGAGTATTA AGC

AGGG A

GGAA CA

TGCC

AATG

CGCG

ACAT

GAGG

ATAG

GTAG TC

CGGC AT

CGCC

TAAC

TTAA

GCTC

GTTACGCCTTTCGGGTCGATGTTTGATCAGC GG

TTAT GG

TATA GT

TAT

ACA A

AATA TG

GCCTAAATAATT

GGTGA

AACCTACTAC

215

ATACATCACAGTCGCGCTGATAAGGCTAACAAGGCCATCAA AGTTG CGGCTTTCCGTCGCTTGTTTTGTGGTTTAACGCTACGCTACCACAAAACAATCAACTCAAAGCCGCAACTTATAGGCGGCGTTAGATGCATCTAAGCACATAATTGCTG

TATACT

TGTCTAACAATTCGTTTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTAGAAGCACTAAGCACATAATTGCTCACAA

TCCACATGCC 580 1.0 Kb TAGCCTTGCGGTCGATGTTTGATGTAATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCAAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTAGAAGCCACACAGTGATATTAGATTTGCCTGGTTACGGTGACCGTAAGGCTTGATAGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCAGAGCCAGCCACGATCGACATTGATCTGGGCTATCTTTGCTTGACAAAAAGCAAGAGAACATAGCGTTGCCTTGGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCCGGTTCCTGAACAGGATCTTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCCCGCGCAGATCAGTTGGAAGAtATTTGTTCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCA

ATAAACTCAAGCG 581 1.0 Kb AGGCTGTGAGCAATTATTGTGCTTAGATaGCATCTAACGCTTGTAGTTGAAGCCGCGCCGCGAAGCGGCGTCGGCTTGAAACGAATTGTTAGACATTATTTGCCGACTACCTTGGTGATCTCGCCTTTCACGTAGTGAACAAATATCTTCCAACTAGATCTGCGCGGGAGGCCAAGCGATCTTCTTCCTTGTCCAAGATAAGCCTGTCTAGCTTCAAGTATGACGGGCTGGATACTGGGCCGGCAGGCGCTCCATTGCCCAGTCGGCAGCGACATCCTTCGGCGCGATTTTGCCGGTTACTGCGCTGTACCAAATGCGGGACAACGTAAGCACTACATTTCGCTCATCGCCAGCCCAGTCGGGCGGCGAAGTTCCATAGCGTTAAGGTTTCATTTAAGCGCCTCAAATAGATCCTGTTCAGGAACCGGATCAAAGAGTTCCTCCGCCGCTGGACCTACCAAGGCAACGCTATGTTCTCTTGCTTTTGTCAGCAAGATAGCCAGATCAATGTCGATCGTGGCTGGGCTCGAAGATCCCTGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAGTTCGCGCTTAGCTGGATAACGCCACGGAATGATGTCGTCGTGCACAACAATGGTGACTTCTACAGCGCGGAGAATCTCGCTCTCTCCAGGGGAAGCCGAAGTTTCCAAAAGGTCGTTGATCAAAGCTCGCCGCGTTGTTTCATccAAGCCTTACGGTCACCGTAACCAGCAAATCAATATCACTGTGTGGCTTCAGGCCGCCATCCACTGCGGAGCCGTACAAATGTACGGCCAGCAACGTCGGTTCGAGATGGCGCTCGATGACGCCAACTACCTCTGATAGTTGAGTCGATACTTCGGCGATCACCGCTTCCCTC

216

ATGATGTTTAACTTTGTTTTAGGGCGACTGCCCTGCTGCGTAACATACGTTGCTGCTCCATAACATCAAACATAACCCGGCAAGTGAA 582 1.0 Kb ATTATGTGCTTAGTGCATCTAACGCTTGATGTTAAtGCCGCGCCGCGAAGCGG

GTCGGCTTGAACGAATGTGTTAGACATTTATTATGCCGACTACCTTGAGTGA

GGGTGATGTTTGATGTTATGGAGCAGCAACGTATGTTACGCAGCAGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCC

CATACTCGCCATATACACAATAGATGAACAAATATCTTCCAACTGATCTGCGCGGGAGGCCAAGCGATCTTCTTCTTGTCCAGAATAAGCCTGTCTAGCTTCAAGTATGACGGGCTGATACTGGGCCGGCAGGCGCTCCATTGCCCAGTCGGCAGCGACATCCTTCGGCGCGATTTTGCCGGTTACTGCGCTGTACCAAATGCGGGACAACGTAAGCACTACATTTCGCTCATCGCCAGCCCAGTCGGGCGGCGAGTTCTCATAGCGTTAAGGTTTCATTTAGCGCCTCAAATAGATCCTGTTCAGGAACCGGATCAAAGAGTTCCTCCGCCGCTGGACCTACCAAGGCAACGCTATGTTCTCTTGCTTTTGTCAGCAAGATAGCCAGATCAATGTCGATCGTGGCTGGCTCGAAGATACCTGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAGTTCGCGCTTAGCTGGATAACGCCACGGAATGATGTCGTCGTGCACAACAATGGTGACTTCTACAGCGCGGAGAATCTCGCTCTCTCCAGGGGAAGCCGAAGTTTCCAAAAGGTCGTTGATCAAAGCTCGCCGCGGTTTGTTTCATCAAGCCTTACGGTCACCGTAACCCAGCAAATCTTAATATCACTGTGTGGCTTCTAGGCCGCCATCCACTGCGGAGCCGTTACCCACATGTACGGCCAGCAACGTCGGTTCGAGATGGCGCTCGATGACGCCAACTACCTCTGATAGTTGAGTCGATACTTCGGCGATCACCGCTTCCCTCATGCATGTTTAACTTTGTTTTAGGGCGACTGCCCTGCTGCGTAACATCGTTGCTGCTCCATTACATCAAACATC 583 1.0 Kb GCCTTGCTGGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCCCGCGCAGATCAGTTGGAAGATATTTGTTCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAATGTCTAACAATTCGTTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAACTACAAGCGTTAGATGCACTAAGCACATAATGCTGCACAGCCTANACT

217

597 1.0 Kb GGCTTGTGAGCAATTATGTGCTTAGATGCATCTAACGCTTGAGTTAAGCCGCG

CGCGAAGCGGCGTCGGCTTGAACGAATTGTTAGACATTATTTGCCGACTAC

GATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCG

CCTTGGTGATCTCGCCTTTCACGTAGTGAACAAATTCTTCCAACTGATCTGCGCGGGAGGCCAAGCGATCTTCTTCTTGTCCAAGATAAGCCTGTCTAGCTTCAAGTATGACGGGCTGATACTGGGCCGGCAGGCGCTCCATTGCCCAGTCGGCAGCGACATCCTTCGGCGCGATTTTGCCGGTTACTGCGCTGTACCAAATGCGGGACAACGTAAGCACTACATTTCGCTCATCGCCAGCCCAGTCGGGCGGCGAGTTCCATAGCGTTAAGGTTTCATTTAGCGCCTCAAATAGATCCTGTTTCAGGAACCGGATCAAAGAGTTCCTCCGCCGCTGGACCTACCAAGGCAACGCTATGTTCTCTTGCTTTTGGTCAGCAAGATAGCCCAGATCAATGTCGATCGTGGCTGGCTCGAAGATACCTGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAGTTCGCGCTTAGCTGGATAACGCCACGGAATGATGTCGTCGTGCACAACAATGGTGACTTCTACAGCGCGGAGAATCTCGCTCTCTCCAGGGGAAGCCGAAGTTTCCAAAAGGTCGTTGATCAAAGCTCGCCGCGTTGTTTTATCAAGCCTTACGGTCACCGTAACCAGCAAATCAATATCACTGTGTGGCTTCTAGGCCGCCATCCACTGCGGAGCCGTACAAATGTACGGCCAGCAACGTCGGTTTGAGATGGCGCTCGATGACGCCAACTACCTCTGATAGTTGAGTCGATACTTCGGCGATCACCGCTTCCCTCATGATGTTTAACTTTGTTTTCAGGGCGACTGCCCTGCTGCGTAACATACGTTGCTGCTCCATAACATCAAACATCAACCCAACAGGC 598 1.0 Kb TCAGCCTGTGGGTTACCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCCCGCGCAGATCAGTTGGAAGATATTTGTTCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAATGTCTAACAATTCGTTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAACTTCAAGCGTTAGAGCATTAAGCACATAATGCTCACAGCCAAATA

218

746 1.0 Kb

TTtGaGCTGTGAGCAATTATGTGCTTAGTGCATCTAACGCAGGAGTTAAGCCG

46 1.2 Kb

CTACGACCTTTTGCGGTCAGATGTTGTGATGTAATGGAGACAGACAACGAT

ATAAGGCTAACAAGCCATCAAGTTGACGGCTTTTCCGTCGCTTGTTTTGTGGTTTAACGCTACGCT

TCCGCGCGTAGCGCGGTCGGCTTGAACGAATTGTTAGACATCATTTACCAACTGACTTGATaGATCTCGCCTTTCACAAAGCGAATAAATTCTTCCAAGTGATCTGCGCGTGAGGCCAAGTGATCTTCTTTTTGTCCCAGATAAGCTTGCTTAGCTTCAAGTAAGACGGGCTGATACTGGGCAGGTAGGCGTTTTATTGCCCAGTCGGCAGCGACATCCTTCGGCGCGATTTTGCCGGTTATTGCGCTGTACCAAATGCGGGACAACGTAAGCACTACATTTCGCTCATCGCCGGCCCAGTCGGGCTGCGAGTTCCATAGCTTCAAGGTTTCCCTCAGCGCCTCGAATAGATCCTGTTCAGGAACCGGGTCAAAGAATTCCTCCGCTGCCGGACCTACCAAGGCAACGCTATGTTCTCTTGCTTTTGTAAGCAGGATAGCTAGATCAATGTCGATCATGGCTGGCTCGAAGATACCCGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAGCTCGCGCTTAGCCCGGATAACGCCACGGGATGATGTCGTCATGCACGACAAGGGTGACTTCTATAGCGCGGAGCGTCTCGCTCTCGCCAGGGAAAGCCGAAGCCTCCATAAGGTCATTGAGCAAaTGCTCgGCCGCGTCGTTTCtATCAAGCTTTACGGCCACAGTAACCAACAAATCttAATATCGCTGTATGGCTTCAGGCCGCCATCCACTGCGGAGCCGTACAAATGCACGGCCAGCAACGTTGATTCCAGATGGCGCTCAATGACGCTTAGCACCTCTGATAGTTGGTTCGAAATTTCGATGGTCACCGCTACCCTCATGATGTCTAACTTTGTTTTAGGGCGACTGCCCTGCTGCGTGACATCGTTGCTGCTCCATGTACATCTGTACATCTGACCCCACGGCTGATGCGGTCNGTAGGTNN 7 TGTTACGACAGCCAGGGACAGTCCGCCCCTAAAACAAAGTTAGACCATTATTATGGAGCCCTCATGACTTTTATATAAAATGTGTGACAATCAAAATTGTATGGGGTTACTTACATAGAAGcTTgTTTATTGGCATATTCGCTTCTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACAAGACGTTAAGGCAATTGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATgTGGGATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAGCAAGGAAAAGTTAATCCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCAAGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAaATATCATCCTAAGTGCTGTAGGTGGCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATTGAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATAGATTTTTATTTGGTTCCGCGCTATCTGAAATGAACCAGATAAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTAATTTACATACGTTCAGTATTGCCGGCGGGATGGAACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATTACAGCAGTTGTGTGGAGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGCAGAGCGAAATGATGCGATTGTTATATTATTGGTCATTCAATTTTTGACGTTTATACATCACAGTCGCGCTGG

219

ACCACAAAACAATCAACTCCAAAGCCGCAACTTATAGGCGGCGTTAGATGCACTAAGCACATAATTGCTGCACATGCCTA

ACGCGAGATCACTTGGAAGTATTTATTCGCTTTGTGAAAGGCGAGATCATCAAGTCA

ATGATGTCTAACAATTCGTTCAAGCCGACCGCGCTACGtCGCGGCGCTTAACTCCGGCGTTAGATGCATCTAAGCACATAATGCTgCACAGCCTANA

GCAGAGCGAAATGATGCGATTGTTATAAATTGGTCATTCAATTTTTGACGTTC

T 777 1.0 Kb AAAAAAGCCCAAGACGCGTCATGCCGTGGGTCGATGTTTGATGTAATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGACATCATGAGGGTAGCGGTGACCATCGAAATTTCGAACCAACTATCAGAGGTGCTAAGCGTCATTGAGCGCCATCTGGAATCAACGTTGCTGGCCGTGCATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCATACAGCGATATTAGATTTGTTGGTTACTGTGGCCGTAAAGCTTGATGAAACGACGCGGCGAGCATTGCTCAATGACCTTATGGAGGCTTCGGCTTTCCCTGGCGAGAGCGAAGACGCTCCGCGCTATAGAAGTCACCCTTGTCGTGCATGACGACATCATCCCGTGGCGTTATCCGGCTAAGCGCGAGCTGCAATTTGGAgAATGGCAGCGCAATGACATTCTTGCGGGTATCTTCGAGCCAGCCATGATCGACATTGATCTAGCTATCCTGCTTACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCGGCAGCCGGAGGAATTCTTTGACCCGGTTCCTGAACAGGATCTATTCGAGGCGCTGAGGGAAACCTTGAAGCTATGGAACTCGCAGCCCGACTGGGCCGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAATAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATAAAACGCCTACCCTGCCCTAGTATCTAGCCCGTCTTACTTGAAGCTAAGCAAGCTTATCTGGGACAAAAAGAAGATCACTTGGCCTCCGTTGGTAAG 777 1. 2 Kb NTAGCCTGTGGGTCGATGTTTGATGTAATGGAGCAGCAACGTATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGCCATATTATGGAGCCTCATGCTTTTATATAAAATGTGTGACAATCAAAATGATGGGGTTACTTACATGAAGTTTTTATTGGCATCTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACAAGACGTTAAGGCAATTGAAGTGTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGGATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATAACTATATGATGCTGAGCAAGGAAAAGTTAATCCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCAAGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCCTAAGTGCTGTAGGTGGCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATTGAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATCAAATTTTTATTTGGTTCCGCGCTATCTGAAATGAACCAGATACAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTAATTTACTACGTTCAGTATTGCCGGCGGGATGGAACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATTACAGCAGTTGTGTGGAGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCACATG

220

TATACATCACAGTCGCGCTGATAAGGACTAACAAGGCCATCAAGTTGACGGCTTTTCCGTCGCTTGTTTTGTGGTTTATACGCTACGCTACCACAACACCATCGA

CTCCGAAGCCGCGAACTTATGGCGGCGTTAGATGCATCTAAGCACATAATGCCTATA

ATTCGTTCAAGCCGACCGCGCTACGCGCGGCGGCTTAACTCCGGCGTTAGAGCACATAATGCGTCA

ACTCACAAG 816 1.0 Kb GCCTTGCGGTCGATGTTTGATGTAATaGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGACATCATGAGGGTAGCGGTGACCATCGAAATTTCGAACCAACTATCAGAGGTGCTAAGCGTCATTGAGCGCCATCTGGAATCAACGTTGCTGGCCGTGCATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCATACAGCGATATTGATTTGTTGGTTACTGGTGGCCGTAAAGCTTGATGAAACGACGCGGCGAGCATTGCTCAATGACCTTATGGAGGCTTCGGCTTTCCCTGGCGAGAGCGAGACGCTCCGCGCTATAGAAGTCACCCTTGTCGTGCATGACGACATCATCCCGTGGCGTTATCCGGCTAAGCGCGAGCTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCGGGTATCTTCGAGCCAGCCATGATCGACATTGATCTAGCTATCCTGCTTACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCGGCAGCGGAGGAATTCTTTGACCCGGTTCCTGAACAGGATCTATTTCGAGGCGCTGAGGGAAACCTTGAAGCTATGGAACTCGCAGCCCGACTGGGCCGGCGATGAGCGAAATGTAGtGCTTACGTTGTCCCGCATTTGGTACAGCGCAATAACCGGCAAAATTCGCGGCCGGAAGGAATGTCGCTGCCGACTGGGCAATAAAACGCCTACCTGCCCAGTATCAGCCCGTCTTACTTGAAGCTAAGCAAGCTTATCTGGGACAAAAAGAAGATCACTTGGCCTCACGCGCAGATCACTTGGAAGAATTTATTCGCTTTGTGAAAGGCGAGATCATCAAGTCAGTTGGTAAATGATGTCTAACATGCACTAA 816 1.2 Kb TTACGCTTTTCGGGTCGATGTTTGATGTTATaGGAGCAGCAACGATGTTACGCAGCAGGGACAGTCGCCCTAAAACAAAGTTAGCCATATTATGGAGCCTCATGCTTTTATATAAAATGTGTGACAATCAAAATTATGGGGTTACTTACATGAAGTTTTTATTGGCATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACAAGACGTTAAGGCAATTGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGGATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAGCAAGGAAAAGTTAATCCCAATAGTACAGTCGAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCAAGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCCTAAGTGCTGTAGGTGGCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATTGAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAACTCCTAAGGCAATAGCCAGTACTTTGAATaGAAATTTTTATTTGGTTCCGCGCTATCTGAAATGAACCAGATCAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTAATTTACTACGTTCAGTATTGCCGGCGGGATGGAACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATTACAGCAGTTGTGTGGAGTGAG

221

CATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGCAGAGCGAAATGATGCGATTGTTATTTTATTGGTCATTCAATTTTTGACGTTTATACATCACAGTCGCGCTGATAAGGCTAACAAGGCCATCAAGTTGACGGCTTTTCCGTCGCTTGTTTTGTGGTTTAACGCTACGCTACCACAACACAATCAAC

CCAAAGCCGCAACTTATAGGCGGCGTTAGATGCATCTAAGCACATAATTGCCCTANA

AATTTAGATGGTCACCGCTACCCTCATGTGTCTAACTTTGTTTTAGGGCGACTGCCCTGCTGCGTAACATCGTTGCTGCT

ATCAACCCAAGGCT

TTGCACATG 823 1.0 Kb ATATAAGGCTGTGAAGCAATAATGTGCTTAGTGCATCTAAACGCCGGAGTTAAGCCGCCGCGCGTAGCGCGGTCGGCTTGAACAAATTGTTAGACATCATTTACCAACTGACTTGATGATCTCGCCTTTCACAAAGCGAATAAATACTTCCAAGTGATCTGCGCGTGAGGCCAAGTGATCTTCTTTTTGTCCCAGATAAGCTTGCTTAGCTTCAAGTAAGACGGGCTGATACTGGGCATGTAGGCGTTTTATTGGCCCAGTCGGCAGCGACATCCTTCGGCGCGATTTTGCCGGTTATTGCGCTGTACCAAATGCGGGACAACGTAAGCACTACATTTCGCTCATCGCCGGCCCAGTCGGGCTGCGAGTTCCATAGCTTCAAGGTTTCCCTCAGCGCCTCGAAATAGATTCTGTTCAGGAACCGGGTCAAAGAATTCCTCCGCTGCCGGACCTACCAAGGCAACGCTATGTTCTCTTGCTTTTGTAAGCAGGATAGCTAGATCAATGTCGATCATGGCTGGCTCGAAGATACCCGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAGCTCGCGCTTAGCCGGATAACGCCACGGGATGATGTYGTCATGCACGACAAGGGTGACTTCTATAGCGCGGAGCGTCTCGCTCTCGCCAGGGAAAGCCGAAGCCTCCATAAGGTCATTGAGCAATGCTCGCCGCGTCGTTTCATCAAGCTTTACGGCCACAGTAACCAACAAATCAtATATCGCTGTATGGCTTCAGGCCGCCATCCACTGCGGAGCCGTACAAATGCACGGCCAGCAACGTTGATTCCAGATGGCGCTCAATGACGCTTAGCACCTCTGATAGTTGGTTCGAACCATTACATCAAAC 823 1. 2 Kb TTAGCCTGTCGGGTCGATGTTTGATGTAATGGAGCAGCAACGTATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGCCATATTATGGAGCCTCATGCTTTTATATAAAATGTGTGACAATCAAAATTATGGGGTTACTTACATGAAGTTTTTATTGGCATTTTCGCTTTTAATACCATCCGTGGTTTTTGCAAGTAGTTCAAAGTTTCAGCAAGTTGAACAAGACGTTAAGGCAATTGAAGTTTCTCTTTCTGCTCGTATAGGTGTTTCCGTTCTTGATACTCAAAATGGAGAATATTGGGATTACAATGGCAATCAGCGCTTCCCGTTAACAAGTACTTTTAAAACAATAGCTTGCGCTAAATTACTATATGATGCTGAGCAAGGAAAAGTTAATCCCAATAGTACAGTCAAGATTAAGAAAGCAGATCTTGTGACCTATTCCCCTGTAATAGAAAAGCAAGTAGGGCAGGCAATCACACTCGATGATGCGTGCTTCGCAACTATGACTACAAGTGATAATACTGCGGCAAATATCATCCTAAGTGCTGTAGGTGGCCCCAAAGGCGTTACTGATTTTTTAAGACAAATTGGGGACAAAGAGACTCGTCTAGACCGTATTGAGCCTGATTTAAATGAAGGTAAGCTCGGTGATTTGAGGGATACGACAAccTCCTAAGGCAATAGCCAGTACTTTGAATAAATTTTTATTTGGTTCCGCGCTATCTtGAAATGAACCAGAACAAAATTAGAGTCTTGGATGGTGAACAATCAAGTCACTGGTA

222

ATTTAAAAACGTTCTAGTATTGCCGGCGGGATGGAACATTGCGGATCGCTCAGGTGCTGGCGGATTTGGTGCTCGGAGTATTACAGCAGTTGTGTGGAGTGAGCATCAAGCCCCAATTATTGTGAGCATCTATCTAGCTCAAACACAGGCTTCAATGGCAGAGCGAAATGATGCGATTGTTAATTTATTGGTCATTCAATTTTTGACGTTTATACATCACAGTCGCGCTGATAAGGCTAACAAGGCCATCAAGTTGACGGCTTTTCCGTCGCTTGTTTTGTGGTTTAACGCTACGCTACCACAAAACAATCAACT

CAAAGCCGCAACTTATAGGCGGCGTTAGATGCATCTAAGCACATAAT

BD 436- 1.6 Kb

C C TGGTGCTTAAATGCATCTAACGCCGTGTAGTTAAGCCGCCGCGCGTAGCGCGGTCGGCTTGAACGAATTGTTAGACATCATTTACCAACTGACTTGATGATCTCGCCTTTCACAAAGCGAATAAATTCTTCCAAGTGATCTGCGCGTGAGGCCAAGTGATCTTCTTTTTGTCCCAGATAAGCTTGCTTAGCTTCAAGTAAGACGGGCTGATACTGGGCAGGTAGGCGTTTTATTGTCCCAGTCGGCAGCGACATCCTTCGGGCGCGATTTTGCCGGTTATTGCGCTGTACCAAATGCGGGACAACGTAAGCACTACATTTCGCTCATCGCCGGCCCAAGTTCCGGGCTGCGTATGTTCCATAGCTTCAAGGTTTCCCTCAGCGCCTCAAATAGATCCTGTTTCAGGAACCGGGGTCAAAGAATTCCTCCCGCTGCCGGACCTACCAAAGGCAACGCTATGTCCTCTTGCTTTGTTAAGCAAGGATACCTAANATCAATGTTTCAATCATGGGCTGGCTCCAAA

223

About the Author

The author received her bachelor’s Degree in Biology from Mrs. Ankita Venkata

Narsimha College, Visakhapatnam, India in 1995. She received Masters Degree in

Human Genetics, Andhra University in 1997. She enrolled in PhD. Program in Biology

epartment in the University of South Florida in Spring 2000. d

224