MOLECULAR TOOLS IN DIAGNOSIS AND CHARACTERIZATION OF

INFECTIOUS DISEASES

Tawheed Ahmad Shafi

Introduction

• Since the advent of the PCR, numerous applicationsin infectious diseases diagnostics have beendeveloped

• Several applications have been incorporated in theroutine diagonostic labs with a more user-friendly,cost-effective, and accurate profile.

• Realtime PCR allowed this transition of the scientifictechnology from basic research and reference centertesting into the mainstream clinical laboratories withthe ability to rapidly detect organisms such as groupB Streptococcus (GBS) and influenza virus

• Nucleic acid testing can be separated into amplified and

nonamplified methods.

• Nonamplified methods consist of DNA-labeled or RNA-labeled

probes that bind to the target nucleic acid and generate a signal

from the attached reporter molecule.

• Target amplification allows the use of multiple different types of

postamplification technologies to further characterize the

amplified targets of organism nucleic acids.

• A variety of nucleic acid methods are currently utilized for

detection/identification of organisms and their virulence

factors/resistance determinants.

History OF PCR

Great mind behind this PCR :Kary Banks Mullis Developed PCR in 1985 and was awarded nobel prize in

1993.

PCR machine otherwise called Thermocycler.

• 1983—Kary Mullis, a scientist working for the CetusCorporation was driving along US Route 101 in northernCalifornia when he came up with the idea for thepolymerase chain reaction.

• 1985—the polymerase chain reaction was introduced to thescientific community at a conference in October. Cetusrewarded Kary Mullis with a $10,000 bonus for hisinvention

• Later, during a corporate reorganization, Cetus sold thepatent for the PCR process to a pharmaceutical companyHoffmann-LaRoche for $300 million.

PCR a Revolution in Scienceamplify a single or few copies of a piece of DNA,generating millions or more copies of aparticular DNA sequence.

The method relies on, cycles of repeatedheating and cooling of the reaction for DNAmelting and enzymatic replication of the DNA.

Almost all PCR applications employ a heat-stable DNA polymerase, such as Taqpolymerase, an enzyme originally isolated fromthe bacterium Thermus aquaticus.

PCR Reagents• 1X Buffer

– 10mM Tris-HCl, 50mM KCl

• MgCl2– 1mM - 4mM (1.5mM)

• dNTPs– 200μM

• Primers– 100nM-1μM, 200nm (or less) for real time analysis

• DNA polymerase – Taq DNA polymerase is thermostable– 1-4 Units (1 unit)

• DNA– 10pg-1μg (20ng)

Typical PCR Temps/TimesSTEPS TEMPERATURE TIME

Initial denaturation 90o – 95o C 1 – 3 min

Denature 90o – 95o C 0.5 – 1 min

Primer annealing 45o – 65o C 0.5 – 1 min

Primer extension 70o – 75o C 0.5 – 2 min

Final extension 70o – 75o C 0.5 – 10 min

Stop reaction 4o C or 10 mM EDTA

hold

Variations of the PCR

• Colony PCR

• Nested PCR

• Multiplex PCR

• Hot Start PCR

• Inverse PCR

• Asymmetric PCR

• Long PCR

• Reverse Transcriptase PCR

• Real time PCR

• Touchdown PCR

Colony PCR: the screening of bacterial (E.Coli) or yeastclones for correct ligation or plasmid products.

Nested PCR: Involves two consecutive PCR reactions of 25 cycles. The first PCR uses primers external to the sequence of interest. The second PCR uses the product of the first PCR in conjunction with one or more nested primers to amplify the sequence within the region flanked by the initial set of primers.

Multiplex PCR: is a variant of PCR which enablssimultaneous amplification of many targets of interest in onereaction by using more than one pair of primers.

Hot start PCR: This is a technique that reduces non-specific amplification during the initial set up stages of the PCR. The technique may be performed manually by heating the reaction components to the melting temperature (e.g., 95°C) before adding the polymerase

Long PCR: Used to amplify DNA over the entire length up to 25kb ofgenomic DNA segments cloned.

Inverse PCR: Used to amplify DNA of unknown sequence that is adjacentto known DNA sequence.

Quantitative PCR: Product amplification w r t time, which is comparedwith a standard DNA.

Asymmetric PCR: preferentially amplifies one DNA strand in a double-stranded DNA template. It is used in sequencing and hybridization probingwhere amplification of only one of the two complementary strands isrequired.

Reverse Transcriptase PCR- First step of RT-PCR - "first strandreaction“-Synthesis of cDNA using oligo dT primers (37°C) 1 hr.“Secondstrand reaction“-Digestion of cDNA:RNA hybrid. Allows the detection ofeven rare or low copy mRNA sequences by amplifying its complementaryDNA.

Touchdown PCR (Step-down PCR):

a variant of PCR that aims to reduce nonspecific background by gradually lowering the annealing temperature as PCR cycling progresses.

The annealing temperature at the initial cycles is usually a few degrees (3-5 °C) above the Tm of the primers used,

while at the later cycles, it is a few degrees (3-5 °C) below the primer Tm.

The higher temperatures give greater specificity for primer binding, and

the lower temperatures permit more efficient amplification from the specific products formed during the initial cycles

Applications of PCR Methods

• Medical Diagnostics1) Diagnosis and characterisation of Infectious diseases:

- Detect presence of viral pathogens- Detect presence of pathogenic bacteria

2) Diagnosis and characterisation of genetic diseases3) Diagnosis and characterisation of Neoplasia

• Forensics1) Identify criminal suspects2) Paternity cases

Advances on PCR MethodsReal Time Assays

called “real-time PCR” because it allows to view the increase in the amount of DNA as it is amplified.

The Real Time assays are proving to better technologies Rapid Quantitative measurement Lower contamination rate Higher sensitivity Higher specificity Easy standardization

Real Time Reporters

• All real time PCR systems rely upon thedetection and quantization of fluorescentreporter, the signal of which increases in directproportion of the amount of PCR product in areaction.

REAL TIME PCR Cyber Green

• The simplest and economical reporter is thedouble strand DNA specific dye SYBR Green

• Called as Molecular Probe.

How SYBR Green works

• SYBR green binds to double stranded DNA and upon excitation emits light

• Thus as PCR product accumulates the fluoresce increases

Advantages

• Inexpensive

• Easy to Use

• Sensitive

Disadvantages

• SYBR green will bind to any double stranded DNA in a reaction, may result in an overestimation of the target concentration

Other Emerging Alternatives• Two most popular alternatives to SYBR green are

TaqMan and Molecular Beacons• Both technologies depend on hybridization probes

relying on fluorescence resonance energy transfer (FRET) and quantization

Molecular Beacons

• Molecular Beacons

• Uses FRET-Fluorescence ResonanceEnergy Transfer

• Uses two sequence specificOligonucleotide labelled withfluorescent dyes

• Molecular beacons are designed toadopt a hairpin structure while free insolution, brining the fluorescent dyeand quencher in close proximity. Whena molecular beacon hybridizes to atarget the fluorescent dye emits lightupon irradiation, and rebind to target inevery cycle for signal measurement.

Documentation of Amplification

• The light emitted from the dye in the excited state is received by a computer and shown on a graph display, such as this, showing PCR cycles on the X-axis and a logarithmic indication of intensity on the Y-axis.

Applications • Some of the common real-time PCR assays that are

available include the tests for group A/B streptococcus,methicillin-resistant Staphylococcus aureus (MRSA) andinfluenza virus.

• There are numerous laboratory-developed realtime PCRtests, including assays for poorly cultivatable or atypicalorganisms (Bordetella pertussis, Legionella pneumophila,Mycoplasma pneumoniae, Chlamydia pneumophila), andthe herpes viruses

• Recent development of assays for Zygomycetes,Aspergillus, Candida sp., Pneumocystis jiroveci, andCoccidiodes show promise for addressing some of thecommon problems of analysis for these pathogens

Loop Mediated Isothermal Amplification (LAMP)

• Loop mediated isothermal amplification is asimple, rapid, specific and cost effective nucleicacid amplification method.

• The amplification proceeds at a constanttemperature using strand displacement reaction.

• Amplification and detection of gene can becompleted in a single step, by incubating themixture of samples, primers DNA polymerase andsubstrates at a constant temperature of 630c.

LAMP in Clinical Diagnosis

• LAMP technology proving to be ideal in detection of DNA orRNA of the pathogenic organisms

• Proving to be highly efficient in diagnosis of Viral and Bacterialinfections

• LAMP is capable of detecting the presence of pathogenicagents earlier than PCR

• A one step single tube real time accelerated reversetranscription loop mediated isothermal amplification (RT-LAMP) assays for rapid detection of some recently emergedviral pathogen eg West Nile, Dengue, Japanese encephalitisH5N1- highly pathogenic avian influenza.

Advantages of LAMP

• LAMP does not require an expensivethermocycler

• Amplification specificity is extremely high asLAMP requires 4/6 oligonucleotide primers

• Detection limit : LAMP≥ PCR

• Detection time : LAMP< PCR

• Visualization of DNA products by LAMP:

(a) Eye – turbidity, colour change

(b) Real Time Turbidimeter

(C) Electrophoresis

PCR is susceptible to hemoglobin, Ig and

Heparin

LAMP resists contamination of above

mentioned materials

LAMP can amplify parasite DNA from fresh

infected blood

LAMP can be done by using rather crude DNA

extracted by simple methods

Hybridisation

• Nucleic acid hybridization as a technique involves using alabeled nucleic acid probe, to bind with the target nucleic acids

• A probe labeled with detectable tracer is the prerequisite fordetermining a specific DNA sequence or gene in a sample orgenomic DNA by nucleic acid hybridization.

• The target nucleic acids to be analyzed are usually denatured,and then mixed with the labeled probe in the hybridizationsystem.

• The probe will bind to thesegment of nucleic acid withcomplementary sequenceunder proper conditions.

• The hybridization can beidentified by the detection ofthe tracer labeling the probe.

• Thus the existence or theexpression of specific genecan be determined.

CTGATGGTCATGAGCTGTCCGATCGATCATACAGGCTAGCTAGTA

ACAGGCTAGCTAGTA

Hybridization

ACAGGCTAGCTAGTA

nucleic acid probe

DNA from source “X”

Preparation And Labeling Of Nucleic Acid

Probes may be• single-stranded or

• double-stranded molecules

working probe must be single-stranded molecules.

The probes used in hybridization include

• oligonucleotide(15-50 nucleotides)

• genomic DNA fragment

• cDNA fragment and

• RNA.

Preparation And Labeling Of Nucleic Acid

• Probe is usually labeled with a detectable tracer, which iseither isotopic or non-isotopic. The purifiedoligonucleotide is labeled in vitro by using a suitableenzyme to add the labeled nucleotide to the end of theoligonucleotide.

• The labels in common use include radioactive (32P and 35S)and nonradioactive (digoxigenin, biotin, fluorescein)substances which are used to label dNTP.

• After hybridization, the location and the quantity of thehybrid molecules can be determined.

Hybridization Of Nucleic Acids(Southern blot hybridization)

• In Southern blot hybridization, the target DNA is digestedwith restriction endonucleases

• Following electrophoresis, the sample DNA fragments aredenatured in strong alkali, such as NaOH.

• The denatured DNA fragments are transferred to anitrocellulose or nylon membrane and become immobilizedon the membrane.

• The immobilized single-stranded target DNA sequences areallowed to interact with labeled single-stranded probe DNA.

• The probe will bind only to complementary DNA sequencesin the target DNA to form a target-probe heteroduplex.

Southern blot hybridization detects target DNA fragments that

have been size-fractionated by gel electrophoresis

Widely applied in researches since its invention.

• Identification DNA from pathogenic

microorganism

• For analysis of gene expression

• Screening of recombinant plasmids

• Analysis of gene mutation

Typing

The process of differentiating strains based on theirphenotypic and genotypic differences is known as 'typing'.These typing methods are useful in:

hospital infection control epidemiological studies, and understanding the pathogenesis of infection.

In hospital settings they may be used to:determine whether a set of isolates obtained from onepatient represents a single infecting strain or multiplecontaminants.determine whether a series of isolates obtained over timerepresents relapse of an infection due to single strain orseparate episodes of disease due to different strains.

Criteria for evaluating typing systems

Typeability Capacity to produce clearly interpretable results

with most strains of the bacterial species

Reproducibility Capacity to repeatedly obtain the same typing

profile result with the same bacterial strain

Discriminatory

power

Ability to produce results that clearly allow

differentiation between unrelated strains of the

same bacterial species

Practicality

(ease of

performance &

interpretation)

Method should be versatile, relatively rapid,

inexpensive, technically simple and provide

readily interpretable results

Molecular Typing TechniquesRestriction analysis

Plasmid profiling

Restriction fragment length polymorphism (RFLP)

Ribotyping

Pulse Field Gel Electrophoresis (PFGE)

PCR amplification of particular genetic targetsAmplified fragment length polymorphism (AFLP)

Random Amplified Polymorphic DNA (RAPD)

Repetitive element PCR (Rep-PCR)

Variable number of tandem repeat (VNTR) analysis and

Multiple locus VNTR analysis (MLVA)

Sequencing-based methodsMultilocus sequence typing (MLST)

Single nucleotide polymorphism (SNPs)

Random Amplified Polymorphic DNA

(RAPD) PCR

• Shortly after Kary Mullis invented the Polymerase Chain Reaction

(PCR) it was realized that short primers would bind to several

locations in a genome and thus could produce multiple fragments

• Williams et al. (1990) developed Random Amplified Polymorphic

DNA (RAPD) a technique using very short 10 base primers to

generate random fragments from template DNAs

• RAPD fragments can be separated and used as genetic markers or a

kind of DNA fingerprint

• The primers can be designed without the experimenter having any

genetic information for the organism being tested.

• More than 2000 different RAPD primers can be available

commercially.

• Genomic DNA normally has complimentary sequences to RAPD

primers at many locations.

• If two of these locations are close to each other (<2000-3000bp),

and the sequences are in opposite orientation, the amplification will

be established. This amplified region is said as a RAPD locus

• Normally, a few (3-20) loci can be amplified by one single RAPD

primer.

Template DNA

RAPD

Primer binds to many locations on the template DNA

Only when primer binding sites are close and oriented in

opposite direction so the primers point toward each other will

amplification take place

Primers at the right

distance so amplification

will happen

100- 1500 bases

Primers point in the

same direction, so

amplification won’t

happen

Template DNA

Primers too far apart so

amplification will not

happen

> 2,000- 3000 bases

RAPD

Silver-stained polyacrylamide gel showing three distinct RAPD profiles generated by primer OPE15 for Haemophilus ducreyi isolates

Applications

• Has been largely carried out for variability analysis and

individual-specific genotyping, but is less popular due to

problems such as poor reproducibility, faint or fuzzy products,

and difficulty in scoring bands, which lead to inappropriate

inferences.

• RAPDs have been used for many purposes, ranging from studies

at the individual level (e.g. genetic identity) to studies involving

closely related species.

• RAPDs have also been applied in gene mapping studies to fill

gaps not covered by other markers

Limitations

• PCR based technique, therefore quality and concentration of

template DNA, concentrations of PCR components, and the

PCR cycling conditions may greatly influence the outcome.

• Thus, the RAPD technique is notoriously laboratory dependent

and needs carefully developed laboratory protocols to be

reproducible.

• Mismatches between the primer and the template may result in

the total absence of PCR product as well as in a merely

decreased amount of the product. Thus, the RAPD results can

be difficult to interpret.

Restriction Fragment Length

Polymorphism (RFLP)

• RFLP is a technique in which organisms may be

differentiated by analysis of patterns derived from

cleavage of their DNA.

• If two organisms differ in the distance between sites

of cleavage of particular Restriction Endonucleases,

the length of the fragments produced will differ when

the DNA is digested.

• The similarity of the patterns generated can be used to

differentiate species (and even strains) from one another.

• This technique is mainly based on the special class of

enzyme i.e. Restriction Endonucleases.

• The variability of restriction sites have their origin in the

DNA rearrangements, point mutations within the restriction

enzyme recognition site sequences, insertions or deletions

within the fragments, and unequal crossing over

A restriction fragment length polymorphism (RFLP)

The DNA molecule on the left has a polymorphic restriction

site (marked with the asterisk) that is not present in the molecule

on the right. The RFLP is revealed after treatment with the

restriction enzyme because one of the molecules is cut into four

fragments whereas the other is cut into three fragments.

Two methods for scoring an RFLP :

(A)RFLPs can be scored by Southern hybridization.

The DNA is digested with the appropriate restriction enzyme and

separated in an agarose gel. The smear of restriction fragments is

transferred to a nylon membrane and probed with a piece of

DNA that spans the polymorphic restriction site. If the site is

absent then a single restriction fragment is detected (lane 2); if

the site is present then two fragments are detected (lane 3).

(B) The RFLP can also be typed by PCR, using primers that anneal

either side of the polymorphic restriction site. After the PCR, the

products are treated with the appropriate restriction enzyme and

then analyzed by agarose gel electrophoresis. If the site is absent

then one band is seen on the agarose gel; if the site is present then

two bands are seen.

Applications:

• RFLPs can be applied in diversity and phylogenetic

studies ranging from individuals within populations or

species, to closely related species.

• RFLPs have been widely used in gene mapping studies

because of their high genomic abundance due to the ample

availability of different restriction enzymes and random

distribution throughout the genome

• RFLP markers were used for the first time in the

construction of genetic maps

Pulsed field gel electrophoresis (PFGE)

Conventional gel electrophoresis techniques:

separates DNA fragments from 100 to 200 bp to 50 kilobase pairs (kb)

only

DNA(>50kb) cant be separated by this method.

In 1982, Schwartz introduced the concept that DNA molecules larger

than 50 kb can be separated by using two alternating electric fields.

In conventional gels, the current is applied in a single direction (from top

to bottom).

But in PFGE, the direction of the current is altered at a regular interval.

Pulsed-field gel electrophoresis is based on the digestion ofbacterial DNA with restriction endonucleases that recognizefew sites along the chromosome, generating large DNAfragments (30-800 Kb)

The basis for PFGE separation is the size-dependent time-associated reorientation of DNA migration achieved byperiodic switching of the electric field in different directions.

The DNA fragments will form a distinctive pattern of bandsin the gel, which can be analyzed visually and electronically.

Bacterial isolates with identical or very similar band patternsare more likely to be related genetically than bacterial isolateswith more divergent band patterns.

Example of PFGE typing results (Staphylococcus aureus). Numbers and letters indicate

sample and strain assignment, respectively. Samples 1 through 8 originate from herd I,

samples 9 through 20 from herd II, and samples 21, 22, and 23 from herds III, IV, and

V, respectively.

Advantages of PFGE

PFGE has proved to be an efficient method forgenome size estimation

In PFGE DNA fragments obtained by usingendonucleases produce a discrete pattern ofbands useful for the fingerprinting and physicalmapping of the chromosome.

The PFGE technique is useful to establish thedegree of relatedness among different strains ofthe same species.

Applications of PFGE

• PFGE is used for epidemiological studies of pathogenic organisms.

• PFGE is often employed to track pathogens, such as Salmonella, Shigella,

Escherichia coli (including O157), Campylobacter, and Listeria species

• PFGE has remarkable discriminatory power and reproducibility. It is

currently considered the strain typing method of choice for many

commonly encountered pathogens.

• PFGE has proven extremely powerful in the analysis of large DNA

molecules from a variety of sources including intact chromosomal DNAs

from fungi, parasitic protozoa and specifically fragmented genomes of

bacteria and mammal.

LIMITATIONS OF PFGE

• Time consuming (2-4 days)

• Requires a trained and skilled technician.

• Pattern results vary slightly between technicians.

• Don’t really know if bands of same size are same

pieces of DNA.

• Not applicable for all organisms.

• The choice of restriction enzyme may be important to

optimize the results

Conclusion

• The future of the molecular diagnostics of infectious

diseases will undoubtedly be focused on a marked

increase in the amount of information detected with

remarkably simplified, rapid platforms that will need

complex software analysis to resolve the data for use in

clinical decision-making.

THANK YOU