Bioengineering Red Fluorescent Tags from Thermosynechococcus   elongatus

0911T Characterization & Contamination

Mo Kaze

Actual Result

Expected Result

What’s the opposite of Eureka?

Identify the problem (What happened?)Hypothesizing explanations for unexpected result (Why did it happen?)Locate source (How did it happen?)Find the real 911T !

Identifying the problem

Pelleted proteins were the wrong color therefore, Protein expressed was NOT the correct

gene

So which one was it?

Hypothesizing possibilities

Exploring potential reasons for resultsSample information was labeled incorrectly,

entirely different gene was expressedSamples themselves were contaminated by

another plasmid and the blue clone was dominant

Contamination

Exploring possible sources of contaminationOur glycerol stock of E.coli cells (LMG-194-

PCB or DH5α) was contaminated with the blue (mutated) clone

Tools or other implements contaminated our cultures during the expression process and the blue clone was dominant

Procedures: preparing DNA for sequencing

Mini prepping DNA Grow 2 mL cultures from the blue pellet Centrifuge to collect the bacteria Add lysis buffer to E.coli Extract proteins, chromosomal DNA, cell walls Centrifuge to remove debris Bind and wash and elute plasmid DNAMiniprep product = pure plasmid DNA Make 2 separate samples for sequencing

One with pBAD forward DNA PCR primers One with CBD reverse DNA PCR primers

Procedures: Sequencing DNA

Off the samples go to UC Berkeley’s DNA sequencing facility where their powerful equipment can sequence DNA and have results back in less than 2 days time

http://mcb.berkeley.edu/barker/dnaseq/

Procedures: Interpreting DNA results

What we get back from UCB: Chromatograph

Procedures: Interpreting DNA results

oWhat we get back from UCB by email: oText file of raw sequence

ATTGAGCAGGCAGCCAAATGTGCAGATTGCTTACGTCAGGCTGCGGTGCAGTTAAGTGAGTTGCGCGATC

GCCAAGCCATTTTTGAGACCCTTGTGGCAAAGGGCCGTGAACTATTGGCCTGCGATCGTGTCATTGTCTA

TGCCTTTGATGACAACTATGTGGGAACAGTCGTAGCCGAGTCGGTGGCAGAGGGTTGGCCACAAGCTCGA

GATCAGGTAATTGAGGATCCCTGTTTCCGCGAACACTGGGTAGAGGCCTACCGCCAGGGCCGCATTCAAG

CCACGACGGATATTTTCAAGGCAGGGCTAACGGAGTGTCACCTGAATCAACTCCGGCCCCTCAAGGTTCG

GGCAAATCTTGTCGTGCCGATGGTGATCGACGACCAACTTTTTGGTCTCCTGATTGCCCACCAGTGCAGT

GAACCACGCCAGTGGCAGGAGATCGAGATTGACCAATTCAGTGAACTGGCGAGCACCGGCAGCCTTGTCC

TGGAGCGTCTCCATTTCCTTGAGCAG

Procedures: Interpreting DNA results

Using a free tool provided by UCSD we upload sequences and compare them

We have the entire genesequences uploaded to thedatabase already so we can compare our sequenceto the known, publishedgene sequences from T.elongatus

Procedures: comparing sequences

Sequenced "911T" aligned with Published 911

Procedures: comparing sequences

Sequenced "911T" aligned with Published 569

Sequence comparison results

This was the first explicit confirmation of what we suspected

“0911T” was NOT what we had expressed

0911T was actually 0569TM another one of our T.elongatus genes

Tracking down the source

Using lab books to determine possible dates where mislabeling could have occurred

Locating properly labeled glycerol stocks prior to the suspected date and then sequencing plasmid DNA

Moving forward

Ensuring the correct gene is being used Double checking DNA sequence data Segregating samples Using consistent, sterile technique Start expression process to verify expected result:

Yellow!

Thank you Spiller Lab!

Many thanks to: Monica, Alex, Kristen, Rosa, Valerie, Stefanie, Ling, and Dr. Susan Spiller