m.sc. nanoscience

7/28/2019 M.sc. Nanoscience

1/43

Studies on plant DNA isolation, PCR and sequencing of barcode

loci in tree species

A Project Report

SUBMITTED IN THE PARTIAL FULFILLMENT OF THE REQUREMENTS

FOR THE DEGREE

OF

Master of Science

In Nanosciences

Submitted by-

Nahid Akhtar

M.Sc. (H) Nanosciences

Roll No.: 0900142002

Integral University, Uttar Pradesh

Under the Guidance of

Dr. Sribash Roy

Plant molecular biology &Genetic Engineering Division

National Botanical Research Institute


2/43

Lucknow

2


3/43

ACKNOWLEDGEMENT

I take this privilege to express my thankfulness to all those people involved in this

endeavours.

I am bereft of words to find befitting and to show my deep sense of gratitude towards my

guide Dr. Sribash Roy. I shall remain ever indebted to him for his creative and expert

guidance, constant encouragement, incessant discussion, everlasting moral support,

constructive criticism, valuable suggestions, kindness and his trust on me. I learnt many

things from him during this course of study.

I am greatful to Prof.V.D.Gupta,Head of the department, Nanoscience, Integral University,

Lucknow for including me all those qualities, which make so meticulous, and for assisting

untiring at each and every stage during my project work.

My most sincere thanks are due to Mr.Abhinandan Mani Tripathi and Mr.Antariksh Tyagi for

their untiring help and suggestions throughout my studies by sacrificing their golden time

during the tenure of this project.

I wish to express my sincere gratitude to Dr.Samir Sawant , Dr.Hemant Yadav, Dr.S.N.Jena

gave their unstinted support in one way or the other.

I would also like to express my thanks to the members of our lab, Mr. Anukool srivastava,

Ms. Namrata Singh, Mr.Anuj Maurya Ms. Aastha Gupta ,Mr Ravi Shukla, Shipra and Parul

for their guidance, support cooperation, and suggestions throughout the work.

My vocabulary is not wide enough to reflect all my sense of regards and infinite gratitude to

my mother & my father for their love, affection, blessings, pivotal role in shaping my

academic career, guidance for the right path, tremendous moral boosting and sacrifice. I am

thankful to them for making me a self-reliant, positive and optimistic human being.

Nahid Akhtar

3


4/43

CERTIFICATE

It is certified that the dissertation report entitled Studies on plant DNA isolation, PCR

and sequencing of barcode loci in tree species which is being submitted by Nahid

Akthar, Department of Nanosciences, Integral University carried out by her under my

supervision and guidance.

Signature of Co-Supervisor

Ms. Tarana Afreen Chandel

4


5/43

Table of Contents-:Table of Contents-:

REFERENCES 35-40

5

CONTENT PAGE NO.

ABBREVIATIONS 4

INTRODUCTION 5-11

LITERATURE REVIEW 12-16

MATERIALS AND METHODS 17-28

RESULTS & DISCUSSION 29-34


6/43

ABBREVIATIONS

bp Base pair

BME - mercapto ethanol

dNTPs Deoxy Nucleotide Tri Phosphates

DNA Deoxyribonucleic acid

EDTA Ethylene Diamine Tetraacetic Acid

HCl Hydrochloric acid

hr Hour

kDa Kilo Dalton

min Minute

Nm Nanometer

NaCl Sodium chloride

PCR Polymerase chain reaction

rpm Rotation per minute

TBE Tris-Borate-EDTA

UV Ultra violet

ITS Internal transcribed spacer

matK Maturase kinase

rbcL Ribulose Biophosphate Caboxylase Sub-unit L

CO1 CytochromeCoxidase1

6


7/43

INTRODUCTION

7


8/43

1. INTRODUCTION:

The number of living species on earth is unknown. There are approximately 1.7 million

named species and possibly another 10 million (not counting bacteria and archea) DNA based

identification could be vitally important in flagging specimens that represent undescribed

taxa .Comprehensive analysis of populations will help in identifying cryptic species ,which

may be for more prevalent than commonly realized, even among large animals.DNA

sequencing of the same gene (or set of gene )across diverse phyla will help unravel the

process that underlie speciation and reveal the diversity of life to an extent that is not now

possible .DNA sequences analysis is enormously useful in studies of evolutionary history and

origin of species on earth. Extensive sampling of DNA sequences has helped establish the

diversity of life and allowed researches to analyse be revolutionary relationships with in

groups in details.DNA sequencing has also been applied to identify specimens and resolve

species boundaries in populations apparently similar organisms.DNA sequence analysis of

uniform target gene to enable species identification has been termed DNA barcoding,by

analogy with Uniform product code barcodes on manufacturing goods. DNA bar-coding is

the use of a short DNA sequence or sequences from a standardised locus (or loci) as a species

identification tool. This method of using short orthologous DNA sequences called DNA

barcodes have been proposed and initiated to facilitate biodiversity studies, identify juvenilesassociate sexes ,enhanced forensic analyses and germplasm conservation.

With so much of human interference into environment and changing climatic

conditions many plant and animal species are onto the verge of extinction or some had

already faced extinction. Climate change and increasingly dramatic shifts in land threaten to

exacerbate the existing bio-diversity crisis. Meeting the imperative of environmental

stewardship requires support for the scientific endeavours of documenting, predicting and

managing ecological change on a global scale. This will require not only a one off description

of organism diversity (a formidable challenge in itself), but also the ability to monitor

biological communities year after year. Today, this task is carried out mainly by taxonomist

applying their specialist skills because the vast majority of other players in the field of

conservation and sustainable development are unable to identify any but the most familiar

species.

The convention on biological diversity affirms that this so called taxonomistimpediment pose a serious threat to conservation and management of biological diversity.

8


9/43

The urgent need for a rapid, accurate and web-accessible taxonomic resource will require the

full utilization of information technology and molecular biology (UK Government., 20004;

EPBRS., 2004). To reduce the risk of loss of genetic variability, there is urgent need to

conserve tree germplasm for future studies. The conservation needs and strategies can be

streamlined by resolving unambiguously between true genetic and phenotypic variability.

This has become possible due to recent developments in plant genomics which allow retrieval

of true genetic variation by directly examining sequence variation in DNA. Tree DNA

isolation, amplification and sequencing of most diversified genes are useful in several

applications, example. characterizing true genetic variation in the materials, understanding

genetic and evolutionary relationships.

Fortunately, a DNA based identification system( i.e.DNA barcoding)operable by

non-specialist to complement parallel development in taxonomic informatics is within reach.

As a uniform, practical method for species identification ,it appears to have broad scientific

applications. It will be great utility on conservation biology for example including

biodiversity surveys.DNA barcodes have been proposed as a shortcut that would provide

species identifications and as away to accelerate the discovery of new species. DNA Barcode

are the short segments of a gene sequence that evolve fast enough to differentiate species, but

have flanking regions that are sufficient conserved to enable the barcode region to be serviced

as universal primer. DNA bar-coding has already proved useful for identification (and in

some cases delimitation) of animal species, but plants (in a broad sense including land plants,

algae and lichens) are only beginning to attract the attention, importance of the DNA based

plant identification tool can be realized, however, several important scientific and

methodological questions must first be addressed. DNA Barcoding promises fast, accurate

species identification by focusing analysis on a short standardized segment of the genome.

DNA bar-coding involves sequencing a short stretch of DNA that will be universally presentin all species, ideally exhibits robust species-specific sequence variation. DNA bar-coding

involves sequencing a short stretch of DNA that will be universally present in all species,

ideally exhibits robust species-specific sequence variation. DNA bar coding is an exciting

new tool for taxonomic research.

DNA bar-coding has already proved useful for identification (and in some cases

delimitation) of animal species, but plants (in a broad sense including land plants, algae and

lichens) are only beginning to attract the attention, importance of the DNA based plant

9


10/43

identification tool can be realized, however, several important scientific and methodological

questions must first be addressed.

The preferred gene for animal bar-coding, cytochrome oxidase1 (CO1 or cox1) is

not suitable for plant bar-coding because low rates of substitution in this gene have caused a

lack of sequence variation among plant species. Plants also pose unique challenges to bar-

coding: prevalent hybridization, polyploidy and apomixis may undermine the utility of even

an ideal bar-code locus. Thus, a pre requisite to a universal plant bar-coding procedure is a

period of rigorous experimentation to determine how indeed, if DNA bar-coding at a floristic

scale can succeed.

A desirable locus for DNA barcoding should be standardized (so that large databasesof sequences for that locus can be developed), present in most of the taxa of interest and

sequencable without species-specific PCR primersshort enough to be easily sequenced with

current technology and provide a large variation between species yet a relatively small

amount of variation within a species.

Although several loci have been suggested, a common set of choices are:

For animals and many other eukaryotes, the mitochrondrial CO1 gene

Forland plants, the concatenation of the rbcL , matKchloroplast genes, ITS ,trnH and

psbA.

Consortium for the Barcode of Life (CBOL) is an international collaborative effort which

aims to develop a mechanism capable of generating a unique genetic barcode for every

species of life on earth .The science behind the Consortium's initiative has met with

considerable controversy, with responses ranging from enthusiastic endorsement to strident

rejection. More work needs to be done to determine to what extent barcoding can

complement existing taxonomic methods in cataloguing the planet'sbiodiversity. In pursuing

this mission CBOL promotes-

1- The rapid compilation of DNA barcode record in a public library of DNA sequence.

2- The development of new instrument and processes that will make bar-coding cheaper,

faster and portable.

10
http://en.wikipedia.org/wiki/PCR_primerhttp://en.wikipedia.org/wiki/PCR_primerhttp://en.wikipedia.org/wiki/Land_plantshttp://en.wikipedia.org/wiki/Land_plantshttp://en.wikipedia.org/wiki/RbcLhttp://en.wikipedia.org/w/index.php?title=MatK&action=edit&redlink=1http://en.wikipedia.org/wiki/DNA_barcodinghttp://en.wikipedia.org/wiki/Taxonomyhttp://en.wikipedia.org/wiki/Biodiversityhttp://en.wikipedia.org/wiki/Land_plantshttp://en.wikipedia.org/wiki/RbcLhttp://en.wikipedia.org/w/index.php?title=MatK&action=edit&redlink=1http://en.wikipedia.org/wiki/DNA_barcodinghttp://en.wikipedia.org/wiki/Taxonomyhttp://en.wikipedia.org/wiki/Biodiversityhttp://en.wikipedia.org/wiki/PCR_primer


11/43

3- The participation of taxonomist and taxonomic research organization in all regions and

countries.

4- The use of DNA bar-coding for the benefit of science and society.

Four barcoding primer selected for this work viz rbcl, trnH-psbA, matK and ITS in which

first three are taken from chloroplast genome and ITS were taken from Internal transcribed

spacer (ITS) region of nuclear region of genome. Like mitochondria cytochrome oxidase 1

gene (CO1) of animal kingdom there were no any single locus reported in plant which act

completely as barcode. Due to this region we were taken four loci for our study. Keeping

above problems in mind we have taken following objective-

I) DNA isolation of plants

II) PCR amplification with all four loci

III) Sequencing of these amplified product

IV) Phylogenetic analysis

Until now the biological specimens were identified using morphological keys but in most

cases an experienced professional taxonomist is needed. If a specimen is damaged or is in animmature stage of development, even specialist may be unable to make identification. Bar-

coding solves these problems because non-specialist can obtain bar-code from tiny amount of

tissues. This is not to say that traditional taxonomy has become less important but rather that

DNA bar-coding can serve a dual purpose as a new tool in the taxonomist tool box

supplementing his/her knowledge well as being an innovative device for non experts who

need to make a quick identification.

1.2 GENES USED FOR BAR-CODING:

In animals a portion of mitochondrial gene cox 1(CO1) is standardarised as potential bar-

code.In land plants this mitochondrial gene cox 1 will not succeed to low levels of variability

in the mitochondrial DNA of land plants. The closest equivalent source of a plant bar-coding

region is the Plastid Genome. This genome shares many of the desirable attributes of animal

11


12/43

mitochondrial DNA for bar-coding such as conserved gene order and high copy number in

each cell enabling easy retrieval DNA for PCR and Sequencing.

One problem with plastid DNA however, is its generally slow rate of evolution and challenge

has been to find a plastid region that is sufficiently variable for DNA bar-coding. A suitable

region should ideally show enough variation within it to discriminate among species, yet to

be conserved enough to be present and routinely retrievable across the >400 million years of

evolutionary divergence represented by extent land plant diversity. This is a non- trival

problem; finding a marker or perhaps set of marker for which primer binding sites are

conserved but which shows high levels of variability across all groups of land plants

represent a set of contradictory targets. If markers have highly conserved primer binding sites

they tend to also be internally more conservative, whereas for the most variable regions it is

difficult to identify sites for reasonably conserved primers.An additional desirable trait for

potential bar-coding region is to have a reading frame so that the presence of non- sense

substitutions could be used as a criterion to evaluate how good sequencing reactions/ editing

have been. For a non- coding region (introns or intergenic spacer) to represent a viable

altenative it is necessary for it to have-

1- Universal primers and standard PCR protocols.

2- Consistently higher variation than coding region.

3- A non- coding complicated pattern of molecular evolution.

Plastid genes used for barcoding are-

a) rbcL- Ribulose Biophosphate Caboxylase Sub-unit L

b) psbA- trnH spacer

c) matk- Maturation Kinase

a) rbc L - Ribulose Biophosphate Caboxylase Sub-unit L it is a protein encoding plastid

gene. It has been proposed as a potential barcode by several sets of researchers ( Chase et

al., 2005; Newmaster et al., 2006 ). This region has shown a fair degree of success in

discriminating species and is regarded as benchmark locus in phylogenetic investigation

12


13/43

by providing a reliable placement of taxon into a plant family and /or genus (W. John

Kress et al., 2007).

b) trnH- psbA spacer- is a non-coding intergenic spacer region found in plastid DNA (Kress

et al., 2005; Shaw et al., 2007). This region is one of the most variable non-coding

regions of the plastid genome in angiosperms in terms of having the highest percentage of

variable site (Shaw et al., 2007). This variation means that this inter-genic spacer can

offer high levels of species discrimination (Kress etal., 2005; Shaw et al., 2007).

These are many problems with alignment for this locus caused by high rates of insertion/

deletions; alignment of the trnH- psb A spacer across larger families of angiosperms is highly

ambiguous. It appears that even within closely related taxa, great length differences exist,

such that at greater taxonomic distance no shared sequence remains. Further more in some

groups of plants, the trnH -psbA spacer is exceedingly short (less than 300bp; Kress et al.,

2006) and in some groups of plans it is much longer. Despite of these problems trn H-psb A

spacer is considered as suitable for barcoding.

13


14/43

REVIEW OF LITERATURE

14


15/43

22.. Review of Literature

DNA barcoding the recently proposed DNA based project for specie identification ,has

attracted much attention and controversy. Proponents envision that a short fragment of DNA

can be used to diagnose taxa , increasing the speed ,objectivity and efficiency of specie

identification. Initial tests of genetic barcoding using mitochondrial markers on animal

reported near 100% accuracy , indicating that the method can be highly accurate under

certain condition.

DNA barcoding promises fast ,accurate species identifications by focusing analysis on a short

standardized segment of the genome (Herbert et al 2003).Several studies have now

established that sequence diversity in a approx.650 bp region near the 5 end of mitochondrial

cytochrome oxidase subunit I(cox I, also referred to as COI)gene provides strong species

level resolution for varied animal groups including birds(Herbert et al ,2004),fishes (Ward et

al ,2005),springtails(Hogg and Hebert,2005),spiders(Barrett and Hebert,2005 )and moths

(Hebert et al ,2003,Janzen et al 2005).These early results have provoked larger scale

barcoding efforts and global projects for fishes and birds have now been initiated

(Marshall,2005).These projects represent the first way in series of initiatives which will

demand the capability to assemble barcode rapidly and cost effectively .As one looks further

to the future the need for substantial analytical capacity looms. For e.g. an effort to barcode

the 1.7 millions described species (Hawksworth,1995) would require the assembly of some

20 million barcodes, given a target of about 10 barcodes per species. This total will rise 5 fold

if barcode coverage is desired for all 10 million eukaryote species(eg.Hammond,1992)

producing a sequence library of 65 billion base pairs ,Approximately twice current size of

genebank (april,2005).This task could be completed within decade by establishing 50 core

laboratories, each producing 200000 barcode record per year .When viewed from the

perspective of major genomic facilities, some of which generate more than 50 million

sequence a year, the production goals for barcode facilities may seem modest.

15


16/43

This technique of species identification have recently been proposed as

solutions to the crisis of taxonomy and received significant attention from scientific journals,

grant agencies , natural history museums, and mainstream media. Meieret al, tested two key

claims of molecular taxonomy using 1333 mitochondrial COI sequences for 449 species of

Dipterans and investigated whether sequences can be used for species identification (DNA

bar-coding) and find a relatively low success rate (


17/43

populations belonging to three species. Thus, for the first time, DNA barcodes have been

found to identify entities below the species level that may constitute separate conservation

units or even species units. Rach et al (2007) findings suggest that character-based DNA

barcoding can be a rapid and reliable means for (i) the assignment of unknown specimens to a

taxonomic group, (ii) the exploration of diagnosability of conservation units, and (iii)

complementing taxonomic identification systems. (Rach et al., 2007)

Cornman et al (2007) investigated the phylogeography of Iris missouriensis (Iridaceae),

which is widely distributed in western North America. R. Scott and Cornman et alutilized

transposon display and DNA sequencing to quantify nuclear and chloroplast genetic

structure. Their objectives were (i) to characterize the geographic structure of genetic

variation throughout the species range, (ii) to test whether both margins of the range show

reduced genetic diversity as predicted by north south expansion and contraction associated

with climate change, and (iii) to determine whether the subspecies Iris missouriensis ssp.

longipetala is genetically distinct. Cornman et al (2007) found that genetic diversity was

significantly lower in the northern part of the range but was not significantly different

between the central and southern regions, indicating greater stability of the southern margin

vs. the northern. Among-population differentiation was high (PT = 0.52). The largest

divisions in each marker set were concordant and separated the southern Rocky Mountainsand Basin and Range provinces from the remainder of the range. The boundaries of this

phylogeographic break do not coincide with gaps in present-day distributions or

phylogeographic breaks identified in other species, and may indicate a measure of

reproductive isolation. Consistent with current treatments, Cornman et al(2007) did not find

support for the taxonomic placement I. missourienis ssp. longipetala as a distinct species.

Although transposon display has been used to investigate relationships among crop

accessions and their wild relatives, to their knowledge, this is the first use of these markers

for population-level phylogeography of a nonmodel species and further demonstrates their

utility in species recalcitrant to amplified fragment length polymorphism protocols.

(Cornman et al., 2007)

The evolution rates of mtDNA in early metazoans hold important implications for

DNA bar-coding. Huan et al (2007) present a comprehensive analysis of intra- and inter

specific COI variabilities in Porifera and Cnidaria (separately as Anthozoa, Hydrozoa, and

Scyphozoa) using a data set of 619 sequences from 224 species. Huan et al (2007) found

variation within and between species to be much lower in Porifera and Anthozoa compared to

17


18/43

Medusozoa (Hydrozoa and Scyphozoa), which has divergences similar to typical metazoans.

Given that recent evidence has shown that fungi also exhibit limited COI divergence, slow-

evolving mtDNA is likely to be plesiomorphic for the Metazoa. Higher rates of evolution

could have originated independently in Medusozoa and Bilateria or been acquired in the

Cnidaria + Bilateria clade and lost in the Anthozoa. Low identification success and

substantial overlap between intra- and interspecific COI distances render the Anthozoa

unsuitable for DNA bar-coding. Caution is also advised for Porifera and Hydrozoa because of

relatively low identification success rates as even threshold divergence that maximizes the

bar-coding gap does not improve identification success. (Huang et al., 2008)

The cytochrome c oxidase 1 sequence, which has been found to be widely applicable

in animal bar-coding, is not appropriate for most species of plants because of a much slower

rate of cytochrome c oxidase 1 gene evolution in higher plants than in animals. Kress et al

(2005) therefore propose the nuclear internal transcribed spacer region and the plastid trnH-

psbA intergenic spacer as potentially usable DNA regions for applying bar-coding to

flowering plants. The internal transcribed spacer is the most commonly sequenced locus used

in plant phylogenetic investigations at the species level and shows high levels of inter specific

divergence. The trnH-psbA spacer, although short (450-bp), is the most variable plastid

region in angiosperms and it is easily amplified across a broad range of land plants.Comparison of the total plastid genomes of tobacco and deadly nightshade enhanced with

trials on widely divergent angiosperm taxa, including closely related species in seven plant

families and a group of species sampled from a local flora encompassing 50 plant families

(for a total of 99 species, 80 genera, and 53 families), suggest that the sequences in this pair

of loci have the potential to discriminate among the largest number of plant species for bar-

coding purpose. (Kress et al., 2005)

Newmaster et al (2007) determined the relative utility of six coding (Universal

Plastid Amplicon UPA, rpoB, rpoc1, accD, rbcL, matK) and one noncoding (trnH-psbA)

chloroplast loci for bar-coding in the genus Compsoneura using both single region and

multiregion approaches. Five of the regions we tested were predominantly invariant across

species (UPA, rpoB, rpoC1, accD, and rbcL). Two of the regions (matK and trnH-psbA) had

significant variation and show promise for bar-coding in nutmegs. Newmasteret al(2007)

demonstrate that a two-gene approach utilizing a moderately variable region (matK) and a

more variable region (trnH-psbA) provides resolution among all the Compsonuera species.

Newmasteret al(2007) sampled including the recently evolved C. sprucei and C. mexicana.

18


19/43

Newmasteret al(2007) classification analyses based on nonmetric multidimensional scaling

ordination, suggest that the use of two regions results in a decreased range of intraspecific

variation relative to the distribution of interspecific divergence with 95% of the samples

correctly identified in a sequence identification analysis. (Newmasteret al, .2007)

MATERIALS

AND

METHODS

19


20/43

3. Material and Methods-:

3.1. Source of experimental materials

Green leaves were collected and identified in their flowering stage on the basis of in their leaf

morphology and floral structure from different location of Uttar Pradesh (Table-1). These

samples were stored either in silica gel or in -80c. These leaves were used for isolation, PCR

amplification and for sequencing.

3.2. Chemicals used

All the chemicals used in the present investigations were of analytical grade. Where as all the

chemicals of molecular biological grade were supplied by Bangalore Genie and Applied

Bioscience.

3.2.A. Buffer and Stock solution for DNA isolation-:1. Extraction Buffer 100 ml

CTAB (4%)

Tris (100mM)

EDTA (20 mM)

NaCl (1.4M)

20


21/43

2. M Tris buffer (pH 8.0) 100ml

Weighed 12.11 g Tris base and dissolved in 80 ml Milli -Q water. Adjusted the pH to 8.0 with

0.1 N HCl and made up volume to 100 ml. Autoclaved and stored at room temperature.

3. 0.5 M EDTA (pH 8.0) 100ml

Weighed 18.61g Na2EDTA and dissolved in 80 ml Milli-Q water. Adjusted the pH to 8.0

with 1N NaOH. Shaken vigorously on a magnetic stirrer for some time to ensure that all the

solutes have dissolved. Made up to the volume 100 ml. Autoclaved and stored at room

temperature.

4. 5 M NaCl 100 ml

Weighed 29.2 g of NaCl and dissolved in 80 ml distilled water. Made up the volume 100 ml.

Autoclaved and stored at room temperature.

5. CTAB extraction buffer (pH 8.0) 100 ml

Weighed CTAB powder 2.5 g, added 1M Tris buffer (10 ml), 5M NaCl (30 ml) and 0.5

M EDTA (5 ml). pH was adjusted to 8.0 with 0.1N HCl. Made up the volume 100 ml. Stored

at room temperature.

6. 70% Ethanol 100 ml

Mixed 70 ml absolute ethyl alcohol in 30 ml distilled water. Stored at 0C.

7. Isopropanol 100ml

Stored at -20C in dark colored bottle.

8. TE buffer 100ml

Added 1 M Tris (pH 8.0) (1 ml), 0.5 M EDTA (0.1 ml), and distilled water (98.90 ml).

Adjusted pH to 8.0. Autoclaved and stored at room temperature.

3.2. B. Solution for DNA purification

1. Polyvinylpyrolidone(PVP)

21


22/43

2. Chloroform: Isoamyl alcohol (24:1) 50 ml

Added 2 ml of Isoamyl alcohol into 48 ml of Chloroform. Stored it in a brown colored

bottle at RT.

Note: Mixing chloroform with other solvents may cause serious hazard. Do not mixes

chloroform with acetone and strong base.Isoamyl alcohol should be handled carefully.

Vapours are poisonous.

3. RNase 1 ml

Took 10 mg of RNase A and dissolved in 1 ml of distilled water. Dispensed into aliquots and

stored at -200C.

3.2.C Solutions for gel electrophoresis

1. DNA loading dye (6X) 10ml

Weighed bromophenol blue (0.25% w/v) (0.0025 g), xylene cyanol FF (0.25% w/v) (0.025g) and added 30% glycerol (3 ml) and double distilled water (8 ml). Made up the volume to

10 ml in distilled H2O and set pH 8.0 with 1 N NaOH. The dye is aliquoted into eppendorf

tubes and stored at 4C. We also used the Red Taq Polymerase which contains red dye which

do not required any more dye from outside.

2. Electrophoresis buffer (10X TBE) pH 8.0 1 litre

Weighed 108 g Tris base, 55 g boric acid and 9.5g EDTA, disodium salt. All the constituents

were dissolved in 750 ml double Milli -Q water. Adjusted pH to 8.0 with sodium hydroxide.

Filtered and adjusted final volume to 1 L. Autoclaved and kept at room temperature.

3. Ethidium bromide (10X) 10 ml

Weighed 10 mg Ethidium bromide (EtBr) and dissolved in 10ml Milli-Q water. Stored at RT.

Note:Ethidium bromide is highly carcinogenic. Use gloves

22


23/43

Genomic DNA isolation-:

For genomic DNA isolation CTAB method (Doyle and Doyle, 1987) with slight

modification was used for the present study. In this method cetyl trimethyl ammonium

bromide buffer (CTAB) is used in the extraction of DNA, which serves as a detergent to

lyase the wall of cells for release of DNA.

Principle-:

The efficiency of isolation of genomic DNA depends upon the lysis of cells to release cells

contents. In order to prepare a cell extract, Tris buffer is the actual buffering component. -

mercaptoethanol acts as reducing agent and reduces disulphides and thus disrupts the tertiary

structure of proteins and denatures them. EDTA chelates Mg++ ions that are essential for

overall structure of cell envelope and for DNase activity.

Cetyl trimethyl ammonium bromide (CTAB) forms insoluble CTAB-DNA complexwhen added in cell extract. DNA-CTAB complex get precipitated leaving other component in

supernatant. Sample in Solution is then neutralized with potassium acetate solution,

centrifuged to remove this insoluble cell debris. Isopropanol precipitates nucleic acids (both

DNA and RNA). RNAcontamination can be removed by RNase treatment. Ethanol

precipitates nucleic acids and proteins along with other components in solution

Protocol-:

1gm of fresh leaves was ground to fine powder in liquid nitrogen by using mortar and

pestle.

23


24/43

The powder was suspended in 12 ml of ice cold CTAB extraction buffer (2%, w/v

CTAB; 50 mM Tris-base, 20 mM EDTA, 1.4 NaCl and 0.1% v/v, ME) and

homogenized.

The mixture was kept at 65oC in water-bath for 3 hrs for lysis.

After incubation, the temperature of lysate was brought down to the room

temperature.

The lysate was extracted with 0.7 volume chloroform: isoamyl alcohol (24:1) and

gently mixed.

The mixture was centrifuged at 10,000 rpm for 10 min at room temp.

The aqueous layer was collected in a fresh polycarbonate tube and the supernatant

was discarded after centrifugation.

Then 0.7 volume of chilled isopropanol was added gently mixed and keep it at -20C

for overnight.

Then centrifuge at 8000 rpm for 10 min at 4C.

Supernatant was decanted by inverting the tube on paper towel to remove any residual

liquid.

The pellet was washed with 70% ethanol and dried at room temperature.

The nucleic acids containing genomic DNA were dissolved in 1ml TE buffer

containing DNase free RNase and incubate for 30 min at RT for RNA degradation.

The genomic DNA was extracted once with phenol: chloroform (1:1) and twice with

chloroform: isoamyl alcohol (24:1).

DNA was precipitated with 0.7 volume isopropanol, keep it at-20C for 1 hr.

Then centrifuge at 8,000 rpm for 10 min and supernatant was decanted by inverting

the tube, dried at room temp.

Dissolved in Milli- Q water and quantified on Nano drop spectrophotometer.

24


25/43

Quantification of genomic DNA-:

The genomic DNA dissolved in Milli-Q water was taken for quantification by UV

absorbance at 260 nm. To measure the concentration, Eppendorf Biophotometer was used.

Reference was set against sterile Milli -Q water and then after absorbance of the sample was

measured at 260 nm and 280 nm. The concentration in ng/ l was recorded on the screen

along with the optical density at 260 nm, 280 nm and ratio of OD 260/280. An O.D. of 1.0 at

260 nm is equivalent to 50 g/l of double stranded DNA. The ratio of OD 260/280 gave an

indication of the amount of RNA or protein contamination in the preparation. A value of 1.8

is optimum for best DNA preparation. A value of the ratio below 1.8 indicates the presence of

protein in the preparation and a value above 1.8 indicates that our sample has RNA

contamination.

Agarose gel electrophoresis of the genomic DNA-:

Agarose gel electrophoresis of the isolated genomic DNA was performed to know

about the quality and quantity of DNA. Larger molecules migrate slower because of greater

frictional drag and they form their way through the pores of the gel less efficiently than

smaller molecules. As the size of genomic DNA is quite big, a 0.8% gel was used to visualize

the genomic DNA. A 0.8% gel resolves DNA molecules in the range of 0.7-8.5 kb (Fig-1).

3.3. PCR amplification

Following primers were selected for PCR amplification and Sequencing

Gene or spacer region Primer sequence

psbA-trnH

psbA3'f 5GTTATGCATGAACGTAATGCTC3

TrnHf 5CGCGCATGGTGGATTCACAATCC 3

rbcL

1.1F 5ATGTCACCACAAACAG3

724.1R 5ATGTACCTGCAGTAGC3

matK

25


26/43

matK NBRI F1 5TCCCCATCCATCTGGAA3

matK 3.2r 5CTTCCTCTGTAAAGAATTC3

ITS

ITS5A(F) 5CCTTATCATTTAGAGGAAGGAG3

ITS4(R) 5TCCTCCGCTTATTGATATGC3

Genomic DNA isolated from the leaf sample was subjected to PCR amplification using the

forward and reverse primers of rbcL, matK, trnH- psbA and ITS. PCR amplification was

performed in 50 l volume in a thermocycler (Gene Amp 9700, Perkin Elmer, and USA).

PCR reaction was set up as following in a 0.2 ml PCR tube-:

:

PCRProgramme -:

Cycle for amplification of rbcL, matK, trnH-psbA & ITS

26

Template DNA (20-100ng) : 1 l

DNA Taq buffer (10X) : 5.0 l (1X)

dNTPs mixture (4mM) : 2.5 l (.2mM)

Primer F (10 pmol) : 2.0 l (10-20 pmol)

Primer R (10 pmol) : 2.0 l (10-20 pmol)

Taq DNA Polymerase (5U/l) : .5l(2.5U)

Milli-Q water : 37 l

Total : 50.0 l


27/43

Cycle Denaturation Annealing Polymerization

First cycle 94C 4 min - - - -

34 Cycle 94C 40

second

48-58 C 45

second

72C 1 min

Last cycle - - - - 72C 7 min

Annealing temperature was variable according to the melting temperature of the primers.

27


28/43

3.3.1 Agarose gel electrophoresis of the PCR Amplicons-:

The horizontal electrophoresis system was used to separate, identify and purify DNA

fragments using different concentration of agarose gel matrix and appropriate electrophoresis

buffer (Sam brook et al., 1989).

The edges of the gel-casting tray supplied with the electrophoresis assembly (Bangalore

Genei, India) were sealed with adhesive tape to form an enclosed chamber and the comb of

appropriate thickness was adjusted on sides of the chamber.

Desired amount of agarose (Sigma, USA) was dissolved in desired volume of 0.5x TBE

buffer (90 mM Tris base, 90 mM boric acid, 2 mM EDTA, pH 8.0) to get required

concentration of agarose gel matrix by heating in microwave oven, until the agarose was

completely dissolved.

The solution was allowed to cool at 50-55oC .

Ethidium bromide solution (0.5g/ml) was added and poured into casting tray and allowed to

solidify.

The comb and side tape were removed from the casting tray and gel was transferred to

electrophoretic chamber filled with sufficient amount 0.5x TBE buffer.

The DNA samples were mixed with gel loading dye (0.25% bromophenol blue in 4% w/v

sucrose) in 4:1 ratio and loaded in wells.

Electrophoresis was performed at desired constant voltage by connecting the chamber with

electric power supply instrument (Pharmacia EPS 500, Bio-Rad 200/2.0) to allow the DNA to

migrate from the cathode to anode. The gel was allowed to run for about 80% of its length.

The gels was examined on UV transilluminator (Fotodyne) and documented on gel

documentation system (Bio-Rad, USA).

Amplified DNA was then eluted by PCR clean up kit or by Gel Extraction.

28


29/43

3.3.2. PCR Clean up from Kit (Nucleospin extract II, MACHEREY-

NAGEL)

Adjust DNA binding condition. Volume of PCR reaction is 50 ml. Make it upto

100ml by adding distilled water.

Mix 1 volume of sample with 2 volumes of buffer NT (Binding Buffer).

Load the sample on the Qiagen quick spin column, placed in a 2ml collection tube

and centrifuge at 1000 rpm for 1 min discard flow through.

Wash silica membrane.

Add 600l Buffer NT3 (Wash Buffer), centrifuge at 11000 rpm for 1 min discard

flow through.

Give the blank spin at 13,000 rpm for 1 min.

Dry the column (silica membrane) at room temperature for 5-10 min.

For DNA elution, place the column in clean 1.5 ml eppendrof tube.

Add 25lof MQ. Keep at room temperature for 5 min. centrifuge at 10,000 rpm for 1

min.

DNA is been collected in the tube.

3.4 Sequencing PCR and Clean up-:

Samples are prepared for sequencing after clean up 200- 300ng DNA is required for

sequencing. Template was lyophilized.

PCR Reaction- Total reaction volume- 5l

Template (100-200ng) : 2 l

Buffer : 1.75

Primer (10pmol/ l) : 2l

29


30/43

Big Dye Reaction Mixture : .5l

Milli-Q water : 5.75

Total : 10

3.4. Sample Sequencing and Analysis:

Samples are prepared for sequencing after clean up. 200- 300ng DNA is required for

sequencing.

Sequencing PCR set up reaction- Total reaction volume- 10l

Master Mix-:

Template (100-200ng) 1 l

Dilution buffer 1.75l

Primer (10pmol/ l) 0 .5 l

Ready Reaction Mix (2.5x) 0 .5 l

Milli-Q water 6.25

Total 10 l

PCR Programme set up :

Step 1:

Rapid thermal ramp to 96Cfor 1 min.

Initial denaturation at 96C for 10sec

Step2:

Repeat the following for 25 cycle:

Rapid thermal ramp to 96C

Denaturation at 96C for 10 sec

Rapid thermal ramp to 50C

Primer annealing at 50C for 5 secs.

Rapid thermal ramp to 60C.

30


31/43

Extension for 5mins.

Step:3

Rapid thermal ramp 4C and hold until ready to purify.

Protocol for purification of Sequencing PCR Product: Ethanol/EDTA Plate

Precipitation method:

Add 12 l of Sol-I having 125mM EDTA to pcr reaction product and mixed.

Add 52 l of Sol-II containing 200 l of 3M sodium acetate (4.8pH) and 5 ml

absolute ethanol mixed it by inversion.

Incubate at RT for 15 min.

Spin at a speed 3,850 rpm for 30 min at RTC.

Decant the supernatant and add 100 l 70% ethanol. Spin at 3,850 rpm for 30 min at

RT.

Dry the pellet by centrifuging it in invert condition and then kept it at 37C for 10

minutes.

Denaturation with HI-Dye

1Add 10 l Hi-Dye formamide in each tube then kept in PCR at 98 C

And keep it on ice

Kept it for sequencing in ABI- capillary sequencer. Sequencing was performedbidirectionally.

After 1hr sequence is obtained.

31


32/43

RESULTS AND DISCUSSION

.

32


33/43

.

Results and Discussion-:

Genomic DNA Isolation:

Genomic DNA of tree species: Genomic DNA was isolated from leaves of tree

species collected from different parts of UP following CTAB method as described in

materials and methods. Quantity of genomic DNA was measured using nanodrop

spectrophotometer and quality was checked on ethidium bromide stained 0.8% agarose gel

electrophoresis. Quality of genomic DNA was quiet good as revealed in Fig. 1.

Figure 1: Ethidium stained agarose gel showing gDNA from tree samples

33


34/43

The quality and the yield of gDNA varied depending on tree species. Some tree

species have high phenolic substances which hindered isolation of good quality DNA.

Quality of DNA also depends on age of the leaf materials used for DNA extraction. In

general we observed that fresh and young leaves yielded good quality DNA as compared to

preserved and old leaves. Genomic DNA could not be isolated following standard CTAB

method because of very high content of phenolic substances. We need to modify the protocol

to isolate gDNA from these species.

PCR amplification of genomic DNA with selected barcode loci

Four different barcode loci viz. ITS, matK, rbcL and trnH-psbA were tested in

different tree species to check the PCR amplification efficiency. The PCR success rate of

different loci are given in table 1. The highest PCR success was observed with rbcL (97%)

followed by ITS (92%), trnH-psbA ( 85%) and matK (66%). Other studies have also reported

that rbcL is a good barcode locus as far as PCR amplification rate is concerned. Similarly ourresults also support the finding of others that matK is the least successful barcode locus as far

as PCR amplification is concerned. Quality of PCR amplification of trees genomic DNA was

quiet good. A representative agarose gel of PCR product with rbcL, ITS and trnH-psba and

matK primers are shown in Fig 2, 3, 4 and 5 respectively

Figure 2: Agarose gel electrophoresis of PCR products using rbcL primers

34


35/43

Figure 3: Agarose gel electrophoresis of PCR products using ITS primers

Figure 4: Agarose gel electrophoresis of PCR products using trh-psbA primers

Figure 5: Agarose gel electrophoresis of PCR products using matK primers

PCR clean up and Sequencing of PCR products-:

The samples which showed positive PCR reactions were cleaned up using commerciallyavailable kits. This step removes the unused dNTPS and other chemicals. The cleaned up

PCR product was again quantified using nanodrop spectrophotometer and checked on

agarose gel. The quality and quantity of the cleaned up products were very good. This

ensures that the sequencing of the PCR products will be off good quality.

After cleaned up, 20 -30 ng of template DNA was used for sequencing reaction

following manufacturers protocol as described in materials and methods. The representative

eltrophorogram of sequences is shown in Fig 7. The sequencing success rate of different loci

35


36/43

is predicted in Table 1. Sequencing success ranged from 85% for rbcL to 50% for matK

(Table 1). The alignment of sequences was straight forward except in case of trnH-psbA,due

to high variation in sequence length. The mean sequence lengths of ITS (ITS1+5.8S+ITS2),

matK, rbcL and trnH-psbA were 602.2, 488.1, 479.0 and 410.0bp, respectively (Table 1).

This lower success rate of PCR using matKmay be due to the instability and the uniqueness

of the primer 3'-end in matKsequences of as reported in other cases.

Figure 7: The representative electropherogram of sequences

Table 1: Results for four loci tested in species of the representatives species-:

36

Locus

# species Mean

sequence

length

%PCR

success

%

sequencing

success

Mean

interspecific

distances

(k2p)

Mean

intraspecific

distances(k2p)

ITS 60 602.2 92 71 0.0100.001 0.0020.001

matK 60 478.1 66 50 0.0030.001 0.0010.001

Rbcl 60 469.0 97 85 0.0010.0004 0.00010.0002

trnH-

psbA

60 410 85 72 0.0070.002 0.00070.001


37/43

In most of the recent plant barcoding studies, the coding regions ofmatKand rbcL and the

non-coding plastid intergenic spacer of trnH-psbA have been suggested as prime candidates

for barcoding. Following the first suggestion by Kress et al. (2005) several subsequent

reports projected trnH-psbA as a strong candidate for plant barcoding. However, Consortium

for the Barcoding of Life (CBOL) disregarded trnH-psbA as it does not consistently provide

bidirectional unambiguous sequences reads Erstwhile studies have focused predominantly on

plastid regions for barcoding. Chase et al. (2005) and Kress et al. (2005) recovered highest

mean percentage sequence divergence (2.81 and 5.7% respectively) for nrITS region for plant

barcoding. However, the use of ITS region as barcode locus has often been considered

unfavourable because of the presence of paralogues in several plant taxa. Yet, in other

studies, ITS has been used successfully as barcode locus. More recently, ITS2 has been

projected as an important plant barcode locus.

In the present study, we attempted to extract good quality gDNA from diverse group

of tree species. Following gDNA isolation, PCR and sequencing success rate were evaluated

using different barcode loci. The sequences were corrected and aligned. However, detailed

analysis for barcoding purposes remains to be worked out.

37


38/43

REFERENCES-:

Adams ,K.L and Palmer, J.D. 2003 .Mol.Phylogenet. Evol. 29: 380-395.

Ahuja, P.S. (2003). In Medicinal Plants in India: Report and Directory, Institute of Economic

and Market Research, New Delhi.

Ali, M. and Ansari, S. M. (1998). Studies of some herbal drugs used as hair tonic. Hamdard

Medicus. 41(2):107-108.

Amarger, V. and Mercier, L. (1995). Biochimie. 72:931-936.

Anon. (1982). Markets for Selected Medicinal Plants and their Derivatives. International

Trade Centre UNCTAD/GATT, Geneva, Switzerland.

Anon. (1987). Rare and Endangered Plants of China. Shanghai Educational Press, Shanghai,

China (in Chinese).

Anon. (1993). Medicinal Plants of Nepal. Bulletin of the Department of Medicinal Plants No.3. His Majestys Government of Nepal, Ministry of Forests and Soil Conservation,

Department of Medicinal Plants,Thapathali,Kathmandu, Nepal

Anon. (1997b). IUCN Analyses of the proposals to amend the CITES Appendices. Prepared

by the IUCN Species Survival Commission and the TRAFFIC Network for the tenth meeting

of the Conference of the Parties to CITES. IUCN The World Conservation Union, Gland,

Switzerland.

Anonymous, (1966). The Wealth of India: Raw Material, CSIR, New Delhi, vol. VII.

Anonymous, (1996). Medicinal Plants Source Book of India, Natraj Publishers, Dehradun.

Avise, J.C. and Hamrick, J.L. (1996). Conservation genetics, case histories from nature.

Chapman and Hall, New York, USA, pp 1-9.

Barth, S., Melchinger, A. E. and Lubberstedt, T. (2002). Mol. Ecol. 11:495-505.

38


39/43

Barton, K.A., Binns, A.N., Matzke, A.Z.M. and Chilton, M.D. (1983). Regeneration of intact

tobacco plants containing ful lenth copies of genetically engineered T-DNA, and transmission

of T-DNA to R1 progeny. Cell. 32:1033-1043.

Bennet, S.S.R. and Gaur, R.D. (1983). A few highly exploited species needing special

attention of conservationists. In: SK Jain and RR Rao (Eds.) An Assessment of Threatened

Plants of India. BSI. Howrah. pp. 283-286.

Bhakuni, D.S., Maheswari, M.L., Dhawan, B.N. and Mehrotra, B.N. (1969). Indian J Chem.

9:250.

Buldewo, S. and Jaufeerally-Fakim, Y.F. (2002). Isolation of clean and PCR-amplifiable

DNA from Anthurium andreanum. Plant Molecular Biology Reporter, March 2002.

20(1):71a-71g.

Chase, M.W., Salamin ,N., Wilkinson ,M., Dunwell, J. M. And Kesanakurti.,R.P.2005.

Land plants and DNA barcode: short- term and long- term goals. Philostrans., Ser B .360:

1889- 1895.

Chase, W. Mark., Cowan, S. Robyn., Hollingsworth, M. Peter., Berg den ,van Cassio.,

Madrinan, Santiago., Peterson Gitte., Seberg ,Ole., Jorgsensen Tina., Cameron, M. Kenneth.,Carine, Mark., Pedersen, Niklas., Hedderson J.A., Conrad ,Ferozah., Salazar ,A. Gerardo.,

Richardson E.James., Hollingsworth, L. Michelle., Barraclough ,G., Kelly ,Laura., and

Wilkinson ,Mike .2007. A proposal for a standardized protocol to barcode all land plants.

Taxon 56(2):295-299

Cho, Y., Qiu, Y.L., Kuhlman, P., and Palmer, J.D., 1998. Proc. Natl. Acad. Sci. USA 95,

14244- 14294.

CAMP, Workshop Proceedings, WWF India, Z00/CBSG, UP Forest Department, 1997.

Chauhan, R.S. (2004). Ecophysiology, agro-technology and trade of an endangered medicinal

herb Nardostachys jatamansi DC, D Phil thesis, HNB Garhwal University, Srinagar Garhwal,

Dhar, U. (2002). Conservation implication of plant endemism in high altitude Himalayan.

Curr. Sci. 82:141-148.

39


40/43

Dhar, U., Manjkhola, S., Joshi, M., Bhatt, A., Bisht, A.K. and Joshi, M. (2002). Current

status and future strategy for develpoment of medicinal plants sector in Uttaranchal, India.

Current Science. 83(8):956-964.

Dhar, U., Rawal, R.S. and Upreti, J. (2000). Biol. Conserv. 95:5765..

Doyle, J.J., Doyle, J.L. (1987). A rapid DNA isolation procedure for small quantities of fresh

leaf tissue. Phytochemical Bulletin 19:1115.

Deguilloux, M.F., Pemonge, M.H., and Petit, R.J., 2002. Proc. R. Soc. London Ser. B269,

1039-1046.

Fang, G., Hammer, S. and Grumet, R. (1992). A quick and inexpensive method for removing

polysaccharides from plant genomic DNA. Biotechniques. 13(1):52-54.

Francisco-Ortega, J., Santos-Guerra, A., Kim, S.C. and Crowford, D.J. (2000). Plant genetic

diversity in the Canary Island: A conservation perpective. Am.J. Bot. 87:909.

Hamrick, J.L. (1983). The distribution of genetic variation within and among natural plant

populations. In: Schonewald-Cox CM, Chambers SM, McBryde B, Thomas WL (Eds)

Genetics and Conservation. Benzamin/ Cummings, Menlo Park, CA, USA, pp.335 348.

Heslop-Harrison, J. (1974). Genetic resource conservation: the end and the means. Journal of

the Royal Society of Arts. February 1974: 157-69.

Hebert, P.D.N., Cywinska A., Ball ,SL., and de Waard, J.R., 2003. Proc.R. Soc. London Ser.

B 270, 313-321.

Hebert ,P.D.N., Ratnasingham, S., and de Warrd, J.R.2003. Proc. R.Soc. London Ser. B 270,

Suppl. 1, S 96-S99

Hebert, P.D.N., Stoeckle, M Y., Zemlak, T.S., and Francis, C.M. 2004.Plos Biol. 2, e312.

Hebert ,P.D.N., Penton ,E.H., Burns, J.M., Jansen, D.H .,and Hallwachs, W. 2004. Proc Natl.

Acad. Sci. USA 101, 14812-14817.

Hofreiter, M., Poinar, H.N., Spaulding, W.G., Bauer, K., Martin, P.S., Possnert, G., and

Paabo, S. 2000. Mol.Ecol. 9, 1975-1984.

40


41/43

Jackson, R.B., Moore, L.A., Hoffman, W.A., Pockman, W.T., and Linder, C.R.1999.Proc.

Natl. Acad. Sci. USA 96, 11387-11392.

Jain, S.K., Sastry, A.R.K. (1984). The Indian Plant Red Data Book-I Botanical, Survey of

India, Department of Environment, New Delhi, India.

Jayaram, K. and Prasad, M.N.V. (2008). Genetic diversity in Oroxylum indicum (L.) Vent.

(Bignoniaceae), a vulnerable medicinal plant by random amplified polymorphic DNA

marker.African. Journal of Biotechnology 7(3):254-262.

Jenkins, D.W. and Ayensu, E.S. (1975). One-tenth of our plant species may not survive.

Smithsonian 5(10):92 96.

Kim Young-Dong., and Jansen K. Robert .1998 .Chloroplast DNA restriction site variation

and phylogeny of the Berberidaceae. American journal of Botany 85(12): 1766-1778

Kress W.J., Wudrack K.J., Zimmer E.A., Weigt b. A and Jansen D.H. 2005. Use of DNA

barcode to identify flowering plants. Proc. Natl. Acad. Sci. U.S.A. 102: 8369-8374

Karki, M.B. (2002). Organic Conservation & Certification: A strategy for Improved Value-

Addition and Marketing of Medicinal Plants Products in the Himalayas; Paper presented at

the Regional Workshop at Wise Practices and Experimental Learning in the Conservation and

Management of Himalayan Medicinal Plant; December 15-20, 2002; Kathmandu, Nepal.

Katterman, F.R.H. and Shattuck, V.I. (1983). An effective method of DNA isolation from the

mature leaves of Gossypium species that contain large amounts of phenolics, terpeniodes and

tannins. Preparative Biochemistry 13:347-359.

Keb Llanes, M., Gonzalez, G., Chi-manzanero, B. and Infante, D. (2002). A rapid and simple

method for small scale DNA extraction in Agavaceae and other tropical plants. Plant

Molecular Biology Reporter 20(3):299a-299e.

Khanuja, S.P.S., Shasany, A.K., Darokar, M.P. and Kumar, S. (1999). Rapid isolation of

DNA from dry and fresh samples of plants producing large amounts of secondary metabolites

and essential oil. Plant Molecular Biology Reporter 17(1):74.

Melville, R. (1970a). Plant conservation and the Red Book. Biological Conservation 2:185-8.

41


42/43

Murashige, T. (1974). Plant propagation through tissue culture, Ann. Rev. Plant Physiol. 25:

135-65..

Nautiyal, B.P., Chauhan, R.S., Vinay Prakash, Purohit, H. and Nautiyal, M.C. (2003).

Population studies for the evaluation of germplasm and threat status of the alpine medicinal

herb Nardostachys, Jatamansi. Plant Genet. Resour Newsl. 136:34-39.

Nei M, Li, W.H. (1979). Mathematical model for studying genetic variation in terms of

restriction endonucleases. Proc Natl Acad Sci, 76:5269-5273

Newmaster S.G., Fazeska, Ragupathy S (2006) Botany 85 DNA barcoding in land plants:

evaluation of rbcL in a miltugene tiered approach. Can J Bot 84: 335-441.

Pionar, H.N., Hofreiter, M., Spaulding, W.G., Martin, P.S., Stankiewicz, B.A., Bland, H.,

Evershed, R.P., Possnert, G. and Paabo.S. (1998) Sci. 281, 402-406.

Padmalatha, K., Prasad, M.N.V. (2007). Inter and intra population genetic variation in

Raulvolfia serpentine Benth.ex.Kurz- an endangered medicinal plant.Med. Arom. Plant Sci.

Biotechnol. 1:118-123.

Polunin, O. and Stainton. A. (1984). Flowers of the Himalaya, 580 pp. Oxford University

Press, Delhi.

Porebski, S., Bailey, L.G. and Baum, B.R. (1997). Modification of a CTAB DNA extraction

protocol for plant containing high polysaccharide and polyphenol components. Plant Mol.

Biol. Reptr. 15:8-15.

Scotland R., Hughes C., Bailey D. and Wortley A. (2003) Syst. Biodiv. 1,139-143

Samant, S. S., Dhar, U. and Palni, L. M. S. (1998). Medicinal Plants of Indian Himalaya

Diversity, Distribution and Potential Values, Gyanodaya Prakashan, Nainital, 1998.

Schluter, C. and Punja, Z. K. (2002). Genetic diversity among natural and cultivated feild

populations and seed lots of American ginseng (Panax quinquefolius L.) in Canada.

International J Plant Sci. 163 (3):427-439.

Scott, K.D. and Playford, J. (1996). DNA extraction technique for PCR in rain forest plant

species. Biotechniques 20(6):974-978.

42


43/43

Sharma, A.D., Gill., P.K. and Singh, P. (2002). DNA isolation from dry and fresh samples of

polysaccharide-rich plants. Plant Molecular Biology Reporter, December 2002, vol. 20, no. 4,

p. 415a-415f.

Shasany, A. K., Darokar, M.P., Saikia, D., Rajkumar, S., Sundersan, V. and Khanuja, S.P.S.

(2003). Genetic diversity and species relationship in Asparagus spp. using RAPD analysis. J

Medicinal and Aromatic Plant Sciences. 25 (3):698-704.

Seberg, O., Humphries, C.J., Knapp, S., Stevenson, D.W., Peterson, G., Scharff, N. and

Andersen, N.M. (2003) Trend Plant Sci.7: 642-644.

Shaw J., Lickely E.B., Schilling E.E., and Small R.L. (2007). Comparison of whole

chloroplast genome sequences to choose non coding regions for phylogenetic studies in

angiosperms. The tortoise and the hare III. Amer.J. Bot. 94:275-288

Singh, M., Bandana, and Ahuja, P.S. (1999). Isolation and PCR amplification of genomic

DNA from market samples of dry tea. Plant Mol Biol Rep. 17:171-178.

Starling, R. (1985). Saving endangered species. Agric.Rep. 5.6.

Tandon, V. (1996). Med Plant Conser. Newl. 2:12-13

Wachira, F.N., Waugh, R., Hackett, C.A. & Powell, W. (1995). Detection of genetic diversity

in tea (Camellia sinensis) using RAPD markers. Genome. 38: 201-210.

Warude, D., Chavan, P., Kalpana, J. and Patwardhan, B. (2003). Plant Mol. Biol. Rep. 21: 1.

Weishing, K., Nybom, H., Wolf, K. and Meyer, W. (1995). DNA isolation and

purification.In: DNA fingerprinting in plants and fungi. pp 44-59.

Welsh, J. and McClelland, M. (1990). Fingerprinting genomes using PCR with arbitrary

primers. Nucl. Acids Res. 18: 7213-7218.

Welsh, J. and McClelland, M. (1991). Genomic fingerprints produced by PCR with

consensus tRNA gene primers. Nucleic Acids Res 19: 861-866.

m.sc. nanoscience

Documents