JOURNAL OF MOLECULAR RECOGNITION, VOL. 9,585-594 (1996)

Multiple Affinity Domains for the Detection, Purification and Immobilization of Recombinant Proteins Joakim Nilsson, Magnus Larsson, Stefan SGhl, Per-Ake Nygren* and Mathias UhlCn Department of Biochemistry and Biotechnology, Kungliga Tekniska Hogskolan S-100 44 Stockholm, Sweden

Affinity systems based on specific molecular recognition are valuable tools for detection, purification and immobilization of recombinant proteins. Here, novel multipartite affinity fusion vectors were assembled and investigated to allow flexible binding and elution conditions. The rationale for the assembly of different combinations of affinity domains was to take advantage of the wide variety of molecular interactions of these domains for purification, solubilization, detection and immobilization. In total, seven different affinity tags representing five different types of taeligand interactions were studied: (i) monoclonal antibodies-peptides (T7- tag and FLAG peptide); (ii) streptavidin-peptide (Strep-tag); (iii) hexahistidyl-metal ions (His,-tag; (iv) bacterial receptors-serum proteins (staphyloccd protein A-Fc and streptococcal protein G-serum albumin); (v) streptavidin-biotin (in vivo biotinylated peptide). Selected tags were evaluated for the production and purification of Escherichia coli DNA polymerase I (Klenow fragment). On the basis of the results, a vector (pAfEtc) was assembled using a novel combination of atlinity domains: (1) an in vivo biotinylated peptide; (ii) a His, sequence, and (ui) a highly soluble serum albumin binding region. Using these three mnities, a wide variety of conditions can be employed for both the binding and the elution steps.

Keywords: T7 system; FLAG peptide; poly-histidine tag; IMAC; Strep-tag; staphylococcal protein A; streptococcal protein G; expression vectors; gene fusions; biotin-streptavidin

Introduction Since the introduction of recombinant DNA technology, a number of gene fusion systems have been developed to enable affinity purification of gene products (Flaschel and Friehs, 1993; Nygren et al., 1994). These systems include various extensions of the target protein, ranging from only one or a few amino acids to fusion of complete proteins which in some cases consist of several subunits. Each of these systems has intrinsic features making them suitable for certain purification situations, e.g. to increase the product solubility or to allow denaturing, or alternatively physiological conditions during chromatography. Gene fusion technology has also been employed for other purposes than to add an affinity tag to the target protein. There exist several examples when amino acid sequences representing linear epitopes for monoclonal antibodies can be added to simplify detection of an expressed gene product (Lutz-Freyermuth et al., 1990). Such ‘epitope tags’ can in fact be useful for affinity purification (Hoogenboom et al., 1991; Hopp er al., 1988; Lutz-Freyermuth et al., 1990). Also single amino acid additions have been employed, e.g. cysteine-tagging to enable thiol-directed immobilization of recombinant proteins (Ljungquist et al., 1989) and tyrosine- tagging to enable radioiodination (Kroll et al., 1993).

The concept of using tags for affinity purification has hitherto been the most widespread use of gene fusion technology. An optimal affinity tag would be one that includes several beneficial features to allow the use of a

* Author to whom correspondence should be addressed.

single expression vector for the production and purification of diverse target proteins. It is unlikely that a single fusion partner can exhibit all these desired properties and thus, an attractive alternative is to combine several functions into a multipartite fusion partner with the combined features of its parental parts. Thus a suitable molecular interaction can be chosen for each individual application. The different constituents of such a composite tail should not interfere with its neighbours, and should only passively be present until its special feature is employed. Very few attempts along this line have so far been investigated. A dual affinity fusion approach was utilized for recovery of labile mam- malian proteins expressed in Escherichia coli, where two different affinity tags were flanking the target protein which enabled recovery of full-length products by two subsequent Fni ty purification steps (Hammarberg et aL, 1989; Murby et al., 1991). A variation of the theme was utilized to characterize staphylococcal protein A deletion mutants which were expressed between a highly soluble affinity handle and a polyhistidine tail (Jansson et al., 1990). A multifunctional leader peptide, containing an epitope tag for detection, a hexahistidyl peptide for purification and a tyrosine residue for radioiodination, was recently also presented (Kroll er al., 1993).

In order to minimize the size of such multifunctional fusion partners, the desired properties should be combined preferably by small ‘building blocks’. In this paper we describe the design, construction and evaluation of two different . N-terminal multipartite tags that have been introduced into T7 RNA polymerase-regulated expression vectors.

CCC 0952-3499/96/060585-10 0 1996 by John Wiley & Sons, Ltd. Received 27 May 1995

Accepted (revised) 24 August I995

586 J. NILSSON ETAL.

Experimental

Bacterial strains and plasmids

E. coli strains RRIAM15 (Ruther, 1982) and BL21(DE- 3)pLysS (Novagen, Inc., Madison, WI) were used as hosts for cloning and for gene expression, respectively. Plasmids pET2la( +) (Novagen, Inc.) and pT7-ABPIIc (Graslund et al. 1996) were used as vectors for introducing DNA fragments. Both these vectors are under control of strong bacteriophage T7 transcription and translation signals (Studier et al., 1990). Plasmid pEZZT308 (Nygren et al., 1988) was used as source for the ZZ fragment and pRIT28- Klenow (Nilsson et al., 1994) was used as source for the Klenow fragment (encoding residues 324-928) of E. coli DNA polymerase I.

DNA construction

All recombinant DNA manipulations followed standard procedures (Sambrook et al., 1989). To construct a vector encoding the Affl tag, a gene fragment encoding a divalent synthetic immunoglobulin G (IgG) binding affinity handle ZZ (Nilsson et al., 1987) derived from staphylococcal protein A, was amplified from plasmid pEZZT308 using a standard polymerase chain reaction (PCR) protocol (Hult- man et al., 1989) and primers LAMA-5’-CCC TGA TCA

and LAMA-10, 5’-GG GGG ATC CAT GTA GTG AGC

3‘. The two primers introduced upstream restriction sites BcA and NcoI and downstream sites KpnI and BamHI. In addition, sequences for protein cleavage by hydroxylamine and His64Ala-subtilisin (Carter et al., 1989) were intro- duced downstream of the ZZ fragment by the LAMA-10 primer. The ZZ encoding fragment was cleaved with BcA and BamHI, and introduced into the BamHI site of pET2la( +) resulting in pT7-TZZc. Correct insertion was verified by solid-phase DNA sequencing (Hultman et al., 1989). A DNA fragment encoding the FLAG peptide (Hopp et al., 1988), six histidines and the straptavidin-peptide (Strep-tag) (Schmidt and Skerra, 1993) with Gly-Ser sequences after each affinity tag (FHS), was created by synthesizing two oligonucleotides with flanking ANcoI (5‘) and NcoI (3’) protrusions for cloning. The sequence of the coding strand was 5’-GCA TGG GAC TAC AAA GAC GACGATGACAAAGGTTCCCACCACCACCAC CAC CAC GGT TCC GCT TGG CGT CAC CCG CAG TTC GGT GGT T-3’ and 5’-GCA TGA ACC ACC GAA CTG CGG GTG ACG CCA AGC GGA ACC GTG GTG GTG GTG GTG GTG GGA ACC TTT GTC ATC GTC GTC TTT GTA GTC C-3’ for the complementary strand. Both oligonucleotides were 5‘-phosphorylated and mixed, heated to 95°C and cooled to room temperature. The DNA fragment was inserted into a unique NcoI site in pT7-TZZc. A positive clone was verified by plasmid sequencing using internal labelling with fluorescein- 15-dATP (Ansorge et al., 1992). The resulting vector pT7-TFHSZZc was cleaved with BgAI, present in each Z-gene, the vector parts purified and religated, to create a vector encoding a single Z-domain.

CCA TGG GCG CAA CAC GAT GAA GCC GTA G-3‘,

GAA GGT ACC ATT CGC GTC TAC TTT CGG CGC C-

The resulting vector was named pAfflc. Both pT7- WHSZZc and pAff lc encodes pentapartite affinity tags. The gene encoding the Klenow fragment of E. coli DNA polymerase I was isolated from pRIT28-Klenow by diges- tion with EcoRI and Hind11 and inserted into the multicloning linkers of both pT7-TFHSZZc and pAfflc, previously digested with the same enzymes. The plasmids, pT7-TFHSZZ-Klenow and pAff 1 -Klenow, encode fusion proteins consisting of the first 11 amino acids of the T7 gene 10 protein, the FLAG peptide, a His, peptide, the Strep-tag and two or one synthetic IgG-binding domain Z (Nilsson et al., 1987) derived from staphylococcal protein A, respec- tively, and the Klenow fragment of E. coli DNA polymerase I.

To create the second generation vector, two DNA fragments encoding an in vivo biotinylated peptide (Schatz, 1993) and a His, peptide with two glycine residues at the C- terminal side, respectively, were created by synthesizing four oligonucleotides with flanking ANheI (5’) and NheI (3’) protrusions; biotin-5’(coding), 5’-CT AGT AGC CTG CGC CAG ATC CTG GAC AGC CAG AAA AT(C/G) GAA TGG GGC AGC AAC GCT GGT GGT G-3‘; biotin-

(C/G)AT TTT CTG GCT GTC CAG GAT CTG GCG GAG GCT A-3‘, and His-5‘ (coding), 5’-CT AGT CAC CAC CAC CAC CAC CAC GGT GGT G-3’, and His-3’, 5’-CT AGC ACC ACC GTG GTG GTG GTG GTG GTG A-3‘. The His-5’ and His-3’ oligonucleotides were 5’-phosphory- lated, mixed, heated to 95°C and cooled to room temperature. Non-phosphorylated biotin-5‘ and biotin-3’ oligonucleotides were also mixed, heated to 95°C and cooled to room temperature. The two DNA fragments were inserted in a stepwise mallner into a unique NheI site in pT7-ABPIIc beginning with the biotin-5’/3’ fragment. After each step, correct insertion was verified by restriction fragment mapping and solid-phase DNA sequencing (Hult- man et al., 1989). The resulting vector pAff2c is adapted for fusion of target proteins to the tripartite affinity tag, Bio- His,-ABP, consisting of a 22 amino acids in vivo biotinylated peptide, a His, peptide and albumin binding protein (ABP), a part (residues 146-266) of the serum albumin-binding region from streptococcal protein G (Nyg- ren et al., 1988).

3‘, 5’-CT AGC ACC ACC AGC GTT GCT GCG CCA TTC

Gene expression

E. coli BL21(DE3)pLysS cells harbouring plasmid pT7- FHSZZ-Klenow, pAff 1 -Klenow and pAff2c, respectively, were grown overnight at 37°C in shake flasks containing 20 ml Tryptic Soy Broth (Difco) supplemented with 5 g/l yeast extract (Difco), 100 pg/ml ampicillin and 34 pg/ml chloroamphenicol (the latter included only when producing the Klenow fusion proteins). The overnight cultures were diluted 25-fold into shake-flasks of the same media and grown at 37°C. Expression of the recombinant fusion proteins were induced at mid-log phase (A,,, nm = 1) by the addition of isopropyl p-D-thiogalactoside (Pharmacia Bio- tech, Sweden) to a final concentration of 1 mM. Cells were harvested 4 h after induction, by centrifugation at approxi- mately 5000 g for 10 min. The pelleted cells were resus-

MULTIPARTITE AFFINITY FUSION PARTNERS 587

pended in one tenth of the culture volume 50 m~ Tris-HC1, pH 8.0 (Klenow fusion proteins) and in TSTE (50 m~ Tris- HC1, pH 7.5, 0.2 M NaCl, 0.05 per cent Tween 20, 1 m~ EDTA) for the Bio-His,-ABP protein-containing cells and stored at - 20°C. The cells were then thawed and sonicated. Cell debris and unsoluble material were pelleted by centrifugation at approximately 30 000 g for 20 min. Super- natants containing the Klenow fusion proteins and the Bio-His,-ABP affinity tag, respectively, were filtered (0.45 pm, Millipore) and samples for sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis were taken. The Klenow fusion protein-containing supernatants were stored as 40 x 2.5-ml batches at - 20°C. Purification of the Bio-His,-ABP protein was done directly after sonication.

Purification of the Klenow fusion proteins

The same amount (5 ml) of Affl-Klenow samples was applied on four different columns containing 1 ml of Anti- FLAGTM M2 Affinity Gel (IBI Kodak), Chelating Sepharose Fast Flow (Pharmacia Biotech), streptavidin, immobilized (Boehringer Mannheim, Germany) and IgG Sepharose 6 Fast Flow (Pharmacia Biotech), respectively. The samples were loaded at room temperature except for streptavidin affinity purification which was performed at 4°C. The flow-throughs were collected and applied on the respective columns a second time. Samples from the second round of flow-throughs were taken for SDS-PAGE analysis. The immunoaffinity purification of the Aff 1-Klenow and the TFHSZZ-Klenow proteins on the M2 affinity column were performed essentially according to the suppliers recom- mendations. Eluted material in 0.1 M glycine-HC1, pH 3.0, was pooled and a 0.5-ml aliquot was desalted on a Napm-5 column (Pharmacia Biotech) against 50 m~ NH4Ac, pH 8.0. A sample for SDS-PAGE analysis was taken from the desalted material and lyophilized. Purification by Ni2+/IDA- affinity chromatography was performed essentially according to Novagen’s HiseBindB Buffer Kit protocol (Novagen, Inc.). Before loading the sample on the column, 0.5 ml of binding buffer was added to obtain a final concentration of 4 m~ imidazole, 0.4 M NaCl and 65 m~ Tris-HC1, pH 8. Eluted material in 1 M imidazole, 0.5 M NaCl and 20 mM Tris-HC1, pH 7.9, was pooled and desalted against 5 0 m ~ NH,Ac, pH 8.0 on two PD-10 columns (Pharmacia Biotech). A sample for SDS-PAGE analysis was taken from the desalted material and lyophilized. Purification by streptavidin affinity chromatography was performed essentially as previously described (Schmidt and Skerra, 1993). Avidin was added to a final concentration of 40 pg/ml before applying the sample on the column. The column was washed with 15 ml 50 m~ Tris-HC1, pH 7.5, and bound material eluted with 2 m~ diaminobiotin (Sigma) in the same buffer. After buffer change into 50 m~ NhAc, pH 8.0, a sample for SDS-PAGE analysis was taken from pooled eluted material and lyophilized. Purifica- tion by IgG-affinity was performed essentially as described by Nilsson and co-workers (1994). The column was washed with 20 ml TSTE (50 m~ Tris-HC1, pH 7.5, 0.2 M NaCl, 0.05 per cent Tween 20 , l m~ EDTA), 7 ml 10 m~ NH4Ac,

pH 7.5 and bound material eluted with 0.2 M HAc, pH 3.3. A sample for SDS-PAGE analysis was taken from pooled eluted material and lyophilized. In all steps of the different purification schemes the flow rate was approximately 0.5 d m i n .

Purification of the Bio-His,-ABP protein

The 50-ml sample was loaded on a small column containing 4ml human serum albumin (HSA)-Sepharose and puri- fication was performed as previously described (Nygren et al., 1988). Eluted material in 0.5 M HAc, pH 2.8 was pooled and a sample for SDS-PAGE analysis was taken and lyophilized. Buffer exchange of a 2.5-ml aliquot to HBS [lo m~ HEPES, pH 7.4, 150 m~ NaCl, 3.4 m~ EDTA, 0.05 per cent Surfactant P20 (Pharmacia Biosensor)] was performed on a PD-10 column (Pharmacia Biotech). The flow rate was approximately 1 d m i n during all steps of the purification.

Protein analysis

Protein concentrations were determined by absorbance measurements at 280 nm using the absorption coefficients 0.89 cm2/mg, 0.85 cm2/mg and 0.61 cm2/mg for the Affl- Klenow, TFHSZZ-Klenow fusion proteins and Bio-His,-ABP protein, respectively. The protein content of collected samples were analysed by SDS-PAGE on the Phastsystemm (Pharmacia Biotech) using 10-15 per cent and 8-25 per cent polyacrylamide gradient gels for the Aff 1 -Klenow fusion protein and Bio-His,-ABP protein, respectively. The gels were stained with Coomassie Brilliant Blue R-250. Before SDS-PAGE analysis, the proteins in the samples taken from the soluble material after sonication and from the flow-throughs, respectively, were precipitated by acetone. The protein amounts were also estimated from the Coomassie-stained gels for comparison to the amount calculated from the absorbance measurements.

BiacoreTM analysis

Bio-His,-ABP protein was analysed using biosensor tech- nology (BIAcoreTM instrument, Pharmacia Biosensor AB, Sweden) using a SA5 sensor chip coated with streptavidin (Phannacia Biosensor). All samples and buffers were injected at a flow rate of 5 pl/min. After conditioning of the surface with 100 m~ HC1, a 40 p,l sample pulse of the Bio- His,-ABP protein (2000 nM) was injected. Subsequently, pulses of 20 m~ HCl(5 pl), 2000 nM human polyclonal IgG (40 pl), 20 m~ HCl(5 ~ l ) , 2000 nM HSA (2 x 40 p1 with an intervening regeneration step) were injected. For control, a Bio-His,-ABP sample was injected over a clean sensor chip surface (CM5 chip, Pharmacia Biosensor) onto which no streptavidin had been coated. All samples were diluted in HBS driving buffer.

588 J. NILSSON ETAL..

Results

Rationale for the choice of affinity tags

Several criteria should be satisfied by the different con- stituents of an optimal multifunctional affinity tag designed for the purification of recombinant proteins produced in E. coli: (1) the tag should preferably be secretable allowing export of proteins prone to degradation by cytoplasmic proteases and/or require the periplasmic milieu for correct folding; (2) the tag itself should be monomeric in structure and must be stable to proteolysis; (3) cysteine residues should be avoided in the tag to eliminate the risk of multimerization or the formation of disulphide bonds with cysteines in the fused target protein; (4) a small size of the tag ensures a high product to tail production ratio; (5) if the target protein is to be recovered from intracellular inclusion bodies, renaturation protocols also have to be applicable for the fused tag; (6) no cleavage sites for selected chemicals or enzymes should be present within the tag sequence; and (7) the interaction between the affinity tail and its ligand should be specific and preferably efficiently reversed with gentle agents. The seven different affinity tags taken into con- sideration in this work (Table 1) have been demonstrated to have the potential to fulfil these requirements. Other frequently used affinity fusion partners, such as glutathione S-transferase (Ray et al., 1993), maltose-binding protein (Maina et al., 1988) or Pgalactosidase (Ullman, 1984) are less suitable as parts of a composite tag, due to factors such as large size, content of cysteines or complex structures.

Construction and assembly of a pentapartite affinity fusion partner

On the basis of these criteria, a multipartite fusion partner (Fig. 1) designed for the purification and detection of recombinant proteins produced intracellularly in E. coli was assembled from five functionally different domains: (1) the T7 tag derived from the phage T7 protein 10 (Studier et al., 1990); (2) the FLAG octapeptide which is recognized by two different monoclonal antibodies (mAbs), depending on

its position within a protein (Hopp el al., 1988, IBI Kodak); (3) a hexahistidyl, His,, tag for immobilized metal ion affinity chromatography (IMAC) (Hochuli et al., 1988); (4) the Strep-tag nonapeptide which binds to streptavidin (Schmidt and Skerra, 1993) and (5) the 7kDa IgG (Fc) binding domain 2 derived from staphylococcal protein A (Nilsson et al., 1987). These tags were chosen for their different properties regarding conditions for binding and elution from their respective affinity chromatography resins. Specific advantages associated with the 2 domain are the high solubility of this bacterial receptor-derived domain, which also efficiently adopts its native structure during renaturation following guanidine hydrochloride/urea-medi- ated solubilization of proteins precipitated into inclusion bodies (Murby et al., 1994; Nygren et al., 1994; Samuelsson et al., 1994) and the possibilities of gentle elution by competitive strategies (Nilsson et al., 1994).

For tight regulation of expression, the T7 system was used, allowing the production of proteins which could be toxic for the E. coli host (Studier et a1.,1990). A 92 bp gene fragment was synthesized encoding three of the domains, FLAG, His, and Strep-tag, and inserted into the expression vector pT7-TZZc, harbouring the sequences encoding for the T7 tag and the ZZ domain, resulting in pV-TFHSZZc, see DNA construction. In order to construct a vector encoding a smaller affinity tag more suitable for competitive elution (Nilsson et al., 1994), one of the Z encoding genes was deleted, resulting in pAfflc. This vector (pAfflc) thus encodes the 12.4-kDa pentapartite T7-FLAG-His6-Strep-Z (Affl) fusion partner under control of the T7 promoter/RNA polymerase system. Thus, the system allows the target protein to be purified using a single binding activity or by a combination of IMAC, streptavidin-, rnAb- or IgG (Fc)- mediated affinity chromatography. In addition, several means of detection and immobilization strategies can be utilized based on the different parts of the tail.

To evaluate the different purification strategies, a fusion construct between the Affl tag and the 68-kDa Klenow fragment of E. coli DNA polymerase I was assembled and produced in E. coli. Klenow polymerase has earlier been shown to be stable in E. coli and produced in large amounts and was therefore chosen as a model target protein (Nilsson et al., 1994). Aliquots of the soluble fraction of total cell

Table 1. Affinity fusion systems included in the study Affinity tag Ligand Size

(amino acids)

T7-tag mAb 11 FLAG mAb 8 His, IDNN i2+ 6 Strep-tag Streptavidin 9 2-domain IgG (Fc) 5a ABP HSA 121C Biotinylated peptide Streptavidin 21

Elution methods

Low pH Low pH/competition' Low pH/imidazole/EDTA Diaminobiotin/2-iminobiotin Low pH/competitionb Low pH/competitionb Heatd/SDS + uread

a Competitive elution can be performed with an excess of FLAG peptide. bCompetitive elution can be performed with an excess of an engineered bifunctional protein which can be selectively removed using a second affinity function (Nilsson eta/., 1994). This value refers to a divalent serum AB!? A minimal motif is 46 aa (Nilsson et

a/., 1994). Method can be destructive for target protein. The primary use of the tag is for

immobilization and detection purposes. However, for mild elution a monomeric avidin resin can be used, allowing elution by free biotin.

MULTIPARTITE AFFINITY FUSION PARTNERS 589

lysates were subsequently subjected to different protocols for affinity chromatography. A comparison of the results from the IgG affinity and IMAC purifications (Fig. 2) show that when these interactions are employed, a target protein of high purity can be recovered with more than 90 per cent yield (approximately 5 mglml gel).

In contrast, purification of the fusion protein using the Strep-taglstreptavidin system yielded only small amounts of product (approximately 100 p@nl gel) containing rela- tively large amounts of host proteins (data not shown). This can in part be attributed to the non-optimal positioning of the nonapeptide sequence, earlier described to be functional when fused at the extreme C-terminus (Schmidt and Skerra, 1993). Affinity purification of the Klenow fusion protein employing the FLAG peptide was performed using immobi- lized M2 mAb, described to recognize also internally positioned DYKDDDDK octapeptide sequences (IBI Kodak). However, only very little protein (less than 20 pg/ ml gel) could be eluted from the M2 column previously loaded with an aliquot of the lysate (data not shown). Interestingly, when a cell lystate contained a Klenow fusion

protein, comprising two copies of the Z domain was purified, higher yields (approximately 300 pg/ml gel) of a pure product could be recovered (data not shown). The results suggest that the protein A-derived portions of the tails contributed to the purification effect by binding to the mouse IgGl (Kappa light chain) M2 mAb. This illustrates a drawback of the Z domain system, namely in some cases unwanted promiscuous binding to immunoglobulins. On the basis of these results, the possible purification strategy using the presence of the T7 tag employing the anti-v protein 10 mouse monoclonal antibody was not evaluated since that mAb is of a subclass (IgG2b, Kappa) to which protein A has been reported to bind (Eliasson el al., 1988).

Construction of a second-generation multipartite affinity fusion partner

The results from this first attempt to construct a multipartite affinity tail suggested that the overall concept could be improved with a different combination of tail moieties.

a

pAfflc 5.8 kbp Lac'uAmpr ori E. coli

a5 H i 8 6 Strep- tag G S H H H H H H G S A W R H P Q F G G S W A Q H

z 49 D E A V D - 5 6 d d - V D

Figure 1. First-generation multipartite affinity vector. (a) Schematic representation of the pAfflc E. cdiexpression vector for the intracellular production of target proteins fused to a multipartite affinity fusion partner. The expression is under control of the T7 promoter (PT7)/lac operator (lac01 sequence (see Experimental section) located upstream of the sequence encoding the multipartite affinity fusion partner consisting of the T7 tag, FLAG peptide, His, sequence, Strep-tag and Z domain moieties followed by a multiple cloning site (mcs) suitable for insertion of genes encoding desired target proteins. Also encoded by the vector is the lac repressor (Lacl) for tight repression prior to the induction with isopropyl pD-thio galactoside (IPTG), and plactamase for selection by ampicillin (Amp'). The vector also contains the phage f l intergenic region (ori f l ) enabling the preparation of single stranded DNA for DNA sequencing (b) Amino acid sequence of the encoded multipartite affinity fusion partner. For clarity, the sequence of the Z domain has been partly deleted. Boxed sequences represent recognition sites for hydroxylamine (HA) (Nygren et a/., 1994) and His64Ala subtilisin (H64A) (Carter et a/., 1989), respectively, which can be used to cleave the fusion protein to release the target protein.

590 J. NILSSON ETAL

a 1 2 3 M

- 94 - 67 - 43

= 30 - 20 - 14

1 2 3 M

- 94 - 67

- 43

- 30

= 20 = 14

Figure 2. Purification of the Affl-Klenow fusion protein. SDS-PAGE (reducing conditions) analyses of various samples from the purification of the Affl-Klenow fusion protein employing the (a) His, (IMAC) and (b) 2‘ domain (IgG affinity) moieties, respectively, for affinity chromatography. Lane 1, total soluble protein in lysate of cells harvested 4 h after induction; lane 2, protein content in the flow-through collected after passage of cell lysate sample through the affinity column; lane 3, proteins eluted from the affinity column; M, marker proteins (sizes in kDa).

Therefore a ‘second generation’ vector, pAff2c (Fig. 3), was constructed including a different set of functional parts: (1) a 21-residue in vivo biotinylated sequence (Schatz, 1993); (2) the His, sequence; and (3) a 13-kDa highly soluble serum albumin binding protein (ABP, for albumin binding protein), derived from streptococcal protein G (Nilsson et ab, 1994; Nygren et al., 1988). The ABP has earlier been extensively described as fusion partner for the affinity purification (Nygren et al., 1988; Sjolander et al, 1993; S&l et al., 1989) and detection (Samuelson et al., 1995) of recombinant proteins. In analogy with the Z domain, the ABP moiety has been shown to be proteolytically stable in E. coli (Larsson et al., 1995) and to fold independently during renaturation of recombinant proteins from inclusion bodies (Oberg et al., 1994).

The construction of this improved vector was performed by stepwise insertion of gene ‘cassettes’ corresponding to the biotinylated sequence and the His, tail into the NheI site of pT7-ABPIIc, in front of the gene encoding the serum albumin binding domain, preserving a unique copy of the restriction site used for the insertion (Fig. 3). This allows for subsequent insertion of additional sequences for specific applications. Also for this vector, the expression is under control of the T7 system. To evaluate the functionality of the two new parts of this composite tail, a 21-kDa Bio-His,- ABP protein was expressed and purified from the E. coli cytoplasm by HSA affinity chromatography. The results from the HSA affinity purification show that the Bio-His,- ABP protein can be recovered with high specificity from the E. coli cell lysate (Fig. 4).

To investigate if the proposed substrate sequence for the E. coli birA gene product was recognized and biotinylated, HSA affinity-purified Bio-His,-ABP protein was analysed using real-time biospecific interaction analysis. In Fig. 5 ,

the response curve is shown for injection of the sample to a streptavidin-coated biosensor chip surface. Since the Bio- His,-ABP protein was first purified using a different affinity function, the background otherwise expected from the presence of free biotin or the biotin-carrying host protein biotin carboxyl carrier protein (BCCP) (Fall and Vagelos, 1975), could be circumvented. To demonstrate that the obtained signal was specific for the BiO-HiS,-ABP protein, subsequent injections with IgG (control) or HSA solutions were performed. The reproducible increase in response observed after the two HSA pulses suggests that a signifcant amount of the Bio-His,-ABP protein is biotinylated in vivo and that it can be immobilized to the streptavidin-coated sensor chip surface in an orientation acceptable for HSA to subsequently interact. The results also demonstrate that the immobilized protein can be efficiently regenerated. From the relative responses obtained, the stoichiometric ratio between Bio-His,-ABP and the HSA was found to be close to 1:l.

Discussion One important value of producing a target protein linked to a multipartite affinity fusion partner lies in the freedom to choose the purification strategy that meets the particular requirements set by the target protein in question. Strategies for functional analysis of proteins derived from cDNA isolated from mammalian cells often involve production of incompletely folded protein domains often susceptible to degradation by host cell proteases (Kamtekar et al., 1993). A strategy to overcome these problems can be to produce the proteins as inclusion bodies which are considered to be poor substrates for proteolytic enzymes. The expression

MULTIPARTITE FUSION PARTNERS 591

based on the T7 system employed here (Studier et al., 1990), most often results in the precipitation of a large fraction of the total yield for such truncated proteins (M. Larsson et al., 1996). However, for most studies it is desired to finally obtain the proteins in solution employing a renaturation protocol. The use of a fusion partner that allows affinity purification under denaturing conditions (Hochuli et al., 1988), followed by facilitated renaturation employing a second, highly soluble moiety (Samuelsson et al., 1994) present in the same extension, represents two

important features possible to obtain by the use of the Bio- His,-ABP fusion partner. This new combination of affinity domains has important advantages for affinity applications: (1) the biotinylated tag could be used for detection using well established streptavidin conjugates and for robust immobilization of the fusion protein employing streptavidin immobilized to solid phases such as microtitre wells, paramagnetic beads or biosensor surfaces; (2) the ABP domain used here would be ‘inert’ in that it would not cross- react with immunoglobulins in immunological assays

Amp‘

b 1 B i o M A S S L R Q I L D S Q H I E

atg gct agt agc ctg cgc cag atc c tg gac agc cag aaa atc gaa

16 H i 8 6 W R S N A G G A S H H H H H H

tgg cgc agc aac gct ggt ggt gct agt cac cac cac cac cac cac

A B P 31 G G A S L A E - 1 1 5 a a - A L P G T IF

L ggt ggt gct agc t t a gct gaa gca t t a cct ggt acc t t c

.- . Nile1

3c -7 159 H64A D P N I L E A L F Q G PI

gct cac tac atg gat ccg aat t t g gaa gct ctg t t c cag ggt ccg -1

174 N S S S V D K L A A A L E K--ff

aat tcg agc tcc gtc gac aag c t t gcg gcc gca ctc gag cac cac KcORI Sac1 Sir11 NlndIII Not1 XhOI

HAS6 1E --------- H H H H T E R cac cac cac cac tag

Figure 3. Second-generation vector. (a) Schematic representation of the pAff2c vector for the E. coli production of target proteins fused to the multipartite Bio-His,-ABP fusion partner. Also for this vector the expression is under control of the T7 promoter (P,/lac operator (lac01 sequence (see Experimental section) located upstream of the sequence encoding the multipartite affinity fusion partner. A gene encoding a desired target protein can be inserted in the multiple cloning site (mcs) cassette. Note that the absence of a termination codon in the target gene and the presence of a termination codon after the second hexahistidyl sequence can result in the C-terminal extension of the product by a second His, sequence. (b) Amino acid sequence of the Bio-His,-ABP affinity fusion partner. The lysine residue (K13) in the Bio moiety that is biotinylated in vivo is indicated (black square). For clarity, the sequence of the ABP domain has been partly deleted. Boxed sequences represent recognition sites for His64Ala subtilisin (H64A) (Carter et a/., 1989) and coxsackie virus protease 3C (Graslund eta/., 1996), respectively, which can be used to cleave the fusion protein to release the target protein.

592 J. NlLSSON ET A L

M I 94 = 67 =

43 - 30 - 20 - 14-

Figure 4. Purification of a Bio-His,-ABP protein. SDS-PAGE (reduced conditions) analysis of the 21-kDa gene product Bio- His,-ABP encoded by the pAff2c vector without any insert. M, marker proteins (sizes in kDa); lane 1, HSA affinity chromato- graphy purified proteins from the soluble fraction of a cell lysate.

involving target protein-specific antibodies; and (3) the HSA normally used as ligand for the purification of ABP fusions is a non-expensive robust monomeric protein which reduces the risk of leakage from the affinity resin as compared to resins containing immunoglobulins which are composed of disulphide-linked heavy and light chain subunits.

Although the protocols for mild elution of captured proteins associated with the Strep-tag (2-immunobiotin/ diaminobiotin) and FLAG systems (Ca2' depletion or competition) are not available with our Bio-His,-ABP fusion partner, three other strategies for mild elution of the protein from the affinity columns are possible. First,

28000

24000

imidazole or EDTA can be used for elution from the IMAC column. Second, competitive elution from HSA columns can be performed employing a bifunctional fusion contain- ing the ABP tail fused to a second affinity domain allowing selective removal of the competitor protein (Nilsson et aZ., 1994). Third, the use of immobilized monomeric avidin allows the capture of biotinylated proteins for later elution by biotin displacement (SoftLink resin, Promega, Inc.). For some applications it is desirable to cleave off the affinity fusion partner from the target protein after purification. The pAff2c vector described here contains a sequence encoding a seven residue substrate which is efficiently and speci- fically recognized by a recombinant coxsackievirus protease (3C), which can be produced in bacteria at high levels (GrZLslund et al., 1996). This allows for mild and convenient on-column cleavage of the fusion protein to release the target protein. Alternatively, the subtilisin variant His64Ala (Carter et aZ., 1989) can be utilized, for which a recognition site also is present. Chemical cleavage can also be performed by CNBr at a methionine residue present adjacent to the His64Ala recognition sequence. This methionine was made unique in the multipartite affinity fusion partner by mutating a methionine present in the original biotinylated sequence described by Schatz (1993) to an isoleucine (Metl4Ile).

Compared to the non-specific chemical introduction of biotin on lysine residues within a target protein, the approach utilizing an in vivo biotinylated extension results in a uniform and directed immobilization which is ideal for different solid-phase format assays. The possibility to purify the fusion protein according to a second activity prior to immobilization eliminates the potential problems with

HSA HSA [ - - - - - - - - - - I I _ _ _ _ _ - _ _ - - I

r 4

12OOO 1

0 1000 2000 3Ooo 4Ooo 5000 6Ooo 7000

Is1

Figure 5. Functional analysis of the Bio-His,-ABP protein using biosensor technology (BIA- CoreTM). Sensorgram showing the results from a functional analysis of the streptavidin binding and (HSA) binding of the Bio and ABP moieties, respectively, of the Bio-His,-ABP protein. A 2000-n~ sample of the protein was injected over a SA5 sensor chip (Pharmacia Biosensor) containing immobilized streptavidin. The increase in response shows a binding of the Bio-His,- ABP protein to the streptavidin surface. Following an injection with a negative control protein [human polyclonal IgG (hlgG), 2000 n ~ ] , the functionality of the ABP moiety of the protein was analysed by repeated injections of 2000-n~ pulses of HSA with an intervening regeneration of the previously captured Bio-His,-ABP protein. The bars indicate time spans for analysis of uptake and dissociation (under buffer flow) of the different samples. Arrows indicate injections of low pH pulses for polishing and regeneration of the surface. RU, resonance units.

MULTIPARTITE AFFINITY FUSION PARTNERS 593

coimmobilization of free biotin or other biotin-canying proteins. The fraction of the Bio-His,-ABP protein that is biotinylated under the cultivation conditions used in this study has however not yet been determined, but addition of d-biotin has earlier been shown to improve the yield of biotinylated gene products (Weiss et al., 1994). In addition, the ABP portion of the tail can be used for directed immobilization as shown by St&l and co-workers (1989) in the purification of target protein-specific antibodies from an immune serum. In this work the ABP fusion was covalently coupled to HSA by glutaraldehyde after binding, a proce- dure which leads to unwanted cross-links also within the immobilized protein. An alternative would be to use the exceptionally strong streptavidin-biotin interaction made possible through the biotinylated part of the Bio-His,ABP fusion partner described here. A similar approach to obtain biotinylation was taken by Weiss and co-workers (1994) who were able to purify a recombinant tumour necrosis factor (TNF) using recombinant Fab fragments of an anti- TNF antibody produced as secreted proteins in E. coli as a fusion to a 101-amino acid tag derived from the native E. coli BCCP of acetyl-CoA carboxylase.

The cassette approach used for the construction of the Bio-His,-ABP fusion partner is applicable also for the combination or addition of other gene fragments such as the E-tag (Pharmacia Biotech, Sweden), ribonuclease S-peptide (Kim and Raines, 1993) or the c-rnyc tag used by several laboratories for recombinant antibody purification and analysis (Hoogenboom et al., 1991). Looking ahead, several new peptide sequences suitable as constituents in multi- partite fusion partners can potentially be selected using technology based on combinatorial chemistry (Clackson and Wells, 1994). Taken together, the results show that multipartite fusion partners can be assembled in a functional manner to allow a multitude of purification, detection and immobilization stradgies.

Acknowledgements

The authors are grateful to Peter Nilsson and Torbjorn Graslund for skilful technical assistance. This work was financed by support from the Protein Engineering Program of The National Board for Technical Development (NUTEK) and Pierre Fabre M6dicament.

References

Ansorge, W., Voss, H., Wiemann, S., Schwager, C., Sproat, 6.. Zimmermann, J., Stegemann, J., Erfle, H., Hewitt, N. and Rupp, T. (1992). High-throughput automated DNA sequenc- ing facility with fluorescent labels at the European Molecular Biology Laboratory. Electrophoresis 13,616-619.

Carter, P., Nilsson, B., Burnier, J. I?, Burdick, D. and Wells, J. A. (1989). Engineering subtilisin BPN’ for site-specific proteoly- sis. Proteins: Struct. Funct. Anal. 6,240-248.

Clackson, T. and Wells, J. A. (1994). In vitro selection from protein and peptide libraries. Trends. Biotechnol. 12, 173-184.

Eliasson, M., Olsson, A., Palmcrantz, E., Wiberg, K., Inganas, M., Guss, B., Lindberg, M. and Uhlen, M. (1988). Chimeric IgG- binding receptors engineered from staphylococcal protein A and streptococcal protein G. J. Biol. Chem. 263, 4323-4327.

Fall, R. R. and Vagelos, P. R. (1975). Biotin carboxyl carrier protein from Escherichia coli. Methods Enzymol. 35,17-25.

Flaschel, E. and Friehs, K. (1993). Improvement of downstream processing of recombinant proteins by means of genetic engineering methods. In Biotechnology Advances, ed. by M. Moo-Young and 6. R. Glick, pp. 31-78. Pergamon Press Ltd, Oxford.

Graslund, T., Nilsson, J., Lindberg, A. M., Uhlen, M. and Nygren, P.-A. (1996). Production of a thermostable DNA polymerase by site specific cleavage of a heat-eluted affinity fusion protein. Prot. Exp. fur. In-Press.

Hammarberg, B., Nygren, P.-A., Holmgren, E., Elmblad, A., Tally, M., Hellmann, U., Moks, T. and Uhlen, M. (1989). Dual affinity fusion approach and its use to express recombinant insulin-like growth factor II. Proc. Narl. Acad. Sci. USA 86,

Hochuli, E., Bannwarth, W., Dobeli, H., Gentz, R. and Stuber, D. (1988). Genetic approach to facilitate purification of recom- binant proteins with a novel metal chelage adsorbent. Bioflechnology6, 1321-1325.

Hoogenboom, H. R., Griffiths, A. D., Johnson, K. S., Chiswell, D. J., Hudson, P. and Winter, G. (1991). Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucl. Acids Res. 19,4133-4137.

Hopp, T. P., Prickett, K. S., Price, V. L., Libby, R. T., March, C. J., Cerretti, D. P., Urdal, D. L. and Conlon, P. J. (1988). A short polypeptide marker useful for recombinant protein identi-

4367-4371.

fication and purification. Bioflechnol. 6, 1204-1210. Hultman, T., StAhl, S., Hornes, E. and Uhlen, M. (1989). Direct

solid phase sequencing of genomic and plasmid DNA using magnetic beads as solid support. Nucl. Acids Res. 17,

Jansson, B., Palmcrantz, C., Uhlen, M. and Nilsson, B. (1990). A dual-affinity gene fusion system to express small recombi- nant proteins in a soluble form: expression and characterization of protein A deletion mutants. Protein Engng. 2,555-561.

Kamtekar, S., Schiffer, J. M., Xiong, H., Babik, J. M. and Hecht, M. H. (1993). Protein design by binary patterning of polar and nonpolar amino acids. Science 262, 1680-1685.

Kim, J.4. and Raines, R. T. (1993). Ribonuclease S-peptide as a carrier in fusion proteins. Protein Science 2,348-356.

Kroll, D. J., Abdel-Malek Abdel-Hafiz, H., Marcell, T., Simpson, S., Chen, C. Y., Gutierrez-Hartmann, A., Lustbader, J. W. and Hoeffler, J. P. (1993). A multifunctional prokaryotic protein expression system: overproduction, affinity purification, and selective detection. DNA Cell. Biol. 12, 441-453.

Larsson, M., Brundell, E., Nordfors, L., Hoog, C., Uhlen, M. and StAhl, S. (1996). A general bacterial expression system for functional analysis of cDNA-encoded proteins. Prof. Exp. Pur. 7,447-457.

Ljungquist, C., Jansson, 6.. Moks, T. and Uhlen, M. (1989). Thiol- directed immobilization of recombinant IgG-binding receptors. Eur. J. Biochem. 186,557-561.

Lutz-Freyermuth, C., Query, C. C. and Keene, J. D. (1990). Quantitative determination that one of two potential RNA- binding domains of the A protein component of the U i small nuclear ribonucleoprotein complex binds with high affinity to stem-loop II of U l RNA. froc. Natl. Acad. Sci. USA 87,6393-6397.

Maina, C. V., Riggs, P. D., Grandea 111, A. G., Slatko, 6. E., Moran, L. S., Tagliamonte, J. A., McReynolds, L. A. and di Guan, C. (1988). An Escherichia coli vector to express and purify foreign proteins by fusion to and separation from maltose- binding protein. Gene 74,365373.

Murby, M., Cedergren, L., Nilsson, J., Nygren, P.-A, Hammar- berg, B., Nilsson, B., Enfors, S.-0. and Uhlen, M. (1991). Stabilization of recombinant proteins from proteolytic deg- radation in. Escherichia coli using a dual affinity fusion strategy. Biotechnol. Appl. Biochem. 14,336-346.

4937-4946.

594 J. NILSSON ET AL.

radation in Escherichia coli using a dual affinity fusion strategy. Biotechnol. Appl. Biochem. 14,336-346.

Murby, M., Nguyen, T. N., Binz, H., UhlBn, M. and StAhl, S. (1994). Production and recovery of recombinant proteins of low solubility. In Separations for biotechnology 3, ed. by D. L. Pyle, pp. 336-344. Bookcraft Ltd., Bath, UK.

Nilsson, B., Moks, T., Jansson, B., Abrahmsh, L., Elmblad, A., Holmgren, E., Henrichson, C., Jones, T. A. and UhlBn, M. (1987). A synthetic IgG-binding domain based on staphylo- coccal protein A. Protein Engng. 1,107-113.

Nilsson, J., Nilsson, I?, Williams, Y., Pettersson, L., Uhln, M. and Nygren, P.-A. (1994). Competitive elution of protein A fusion proteins allows specific recovery under mild conditions. Eur. J. Biochem. 224,103-108.

Nygren, P.-A., Eliasson, M., Palmcrantz, E., Abrahmsen, L. and Uhln, M. (1988). Analysis and use of the serum albumin binding domains of streptococcal protein G. J. Mol. Recog- nit. 1, 69-74.

Nygren, I?-A., StBhl, S. and Uhlen, M. (1994). Engineering proteins to facilitate bioprocessing. Trends Biotechnol. 12, 184-188.

Oberg, U., Rundstrom, G., Gronlund, H., UhlBn, M. and Nygren, R-A. (1994). lntracellular production and renaturation from inclusion bodies of a SCFV fragment fused to a serum albumin binding affinity tail. In Proceedings of the 6th European Congress on Biotechnology, ed. by L. Alberghina, L. Frontali and P. Sensi, pp. 179-182. Elsevier Science B.V., Amsterdam, The Netherlands.

Ray, M. V. L., van Duyne, P., Bertelsen, A. H., Jackson-Matthews, D. E., Sturmer, A. M., Merkler, D. J., Consalvo, A. P., Young, S. D., Gilligan, J. P. and Shields, P. P. (1993). Production of recombinant salmon calcitonin by in vitro amidation of an Escherichia coli produced precursor peptide. Bioflechnol. 11,64-70.

Ruther, U. (1982). pUR 250 allows rapid chemical sequencing of both DNA strands of its inserts. Nucl. Acids Res. 10, 5765-5772.

Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular

cloning: a laboratory manual, 2nd edn., Cold Spring Harbor Laboratory, New York.

Samuelsson, E., Moks, T., Nilsson, B. and UhBln, M. (1994). Enhanced in vitro refolding of insulin-like growth factor I using a solubilizing fusion partner. Biochemistry 33, 4207-421 1.

Samuelson, P., Hansson, M., Ahlborg, N., Andreoni, C., Gotz, F., Bachi, T., Nguyen, T. N., Binz, H., UhlBn, M. and StAhl, S. (1995). Cell surface display of recombinant proteins on Staphylococcus carnosus. J. Bacteriol. 177, 1470-1 476.

Schatz, P. J. (1993). Use of peptide libraries to map the substrate specificity of a peptide-modifying enzyme: a 13 residue consensus peptide specifies biotinylation in Escherichia coli. Bioflechnol. 1 1,1138-1 1 43.

Schmidt, T. G. M. and Skerra, A. (1993). The random peptide library-assisted engineering of a C-terminal affinity peptide, useful for the detection and purification of a functional lg Fv fragment. Protein Engng. 6, 109-122.

Sjolander, A., StAhl, S. and Perlmann, P. (1993). Bacterial expression based on protein A and protein G designed for the production of immunogens: application to Plasmodium falciparum malaria antigens. lmmunomethods 2,79-92.

StAhl, S., Sjolander, A., Nygren, P.-A., Berzins, K., Perlmann, P. and Uhlen, M. (1989). A dual expression system for the generation, analysis and purification of antibodies to a repeated sequence of the Plasmodium falciparum malaria antigen Pfl55BESA. J. Immunol. Meth. 124,43-52.

Studier, F. W., Rosenberg, A. H., Dunn, J. J. and Dubendorff, J. W. (1990). Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185,60-89.

Ullman, A. (1984). One-step purification of hybrid proteins which have p-galactosidase activity. Gene 29, 27-31.

Weiss, E., Chatellier, J. and Orfanoudakis, G. (1994). In vivo biotinylated recombinant antibodies: construction, charac- terization, and application of a bifunctional Fab-BCCP fusion protein produced in Escherichia coli. Prof. Expr. Purif. 5, 509-517.