Neurobiology of Disease

Glucosylsphingosine Promotes �-Synuclein Pathology inMutant GBA-Associated Parkinson’s Disease

X Yumiko V. Taguchi,1,2 Jun Liu,3 X Jiapeng Ruan,3 Joshua Pacheco,4 Xiaokui Zhang,4 Justin Abbasi,2,5 X Joan Keutzer,4

Pramod K. Mistry,3 and X Sreeganga S. Chandra2,5,6

1Department of Cell Biology, 2Program in Cellular Neuroscience, Neurodegeneration and Repair, 3Department of Internal Medicine, 5Department ofNeurology, and 6Department of Neuroscience, Yale University School of Medicine, New Haven, Connecticut 06519, and 4Sanofi Genzyme, Framingham,Massachusetts 01702

Glucocerebrosidase 1 (GBA) mutations responsible for Gaucher disease (GD) are the most common genetic risk factor for Parkinson’sdisease (PD). Although the genetic link between GD and PD is well established, the underlying molecular mechanism(s) are not wellunderstood. We propose that glucosylsphingosine, a sphingolipid accumulating in GD, mediates PD pathology in GBA-associated PD. Weshow that, whereas GD-related sphingolipids (glucosylceramide, glucosylsphingosine, sphingosine, sphingosine-1-phosphate) promote�-synuclein aggregation in vitro, glucosylsphingosine triggers the formation of oligomeric �-synuclein species capable of templating inhuman cells and neurons. Using newly generated GD/PD mouse lines of either sex [Gba mutant (N370S, L444P, KO) crossed to�-synuclein transgenics], we show that Gba mutations predispose to PD through a loss-of-function mechanism. We further demonstratethat glucosylsphingosine specifically accumulates in young GD/PD mouse brain. With age, brains exhibit glucosylceramide accumula-tions colocalized with �-synuclein pathology. These findings indicate that glucosylsphingosine promotes pathological aggregation of�-synuclein, increasing PD risk in GD patients and carriers.

Key words: �-synuclein; GBA; glucosylsphingosine

IntroductionParkinson’s disease (PD) is a progressive neurodegenerative dis-ease affecting �1% of the aging population (Nussbaum and Ellis,2003). A key component of PD pathogenesis is �-synuclein, a

presynaptic protein normally functioning to regulate synapticvesicle cycling (Chandra et al., 2003; Vargas et al., 2014). Pointmutations in the SNCA gene, encoding �-synuclein, cause auto-somal dominant PD (A30P, A53T, A53E, E46K, H50Q, andG51D) (Polymeropoulos et al., 1997; Kruger et al., 1998; Zarranzet al., 2004; Lesage et al., 2013; Proukakis et al., 2013). Duplica-tion and triplication of SNCA also cause PD (Singleton et al.,2003; Chartier-Harlin et al., 2004), highlighting the contributionof increased wild-type (WT) �-synuclein levels to disease risk.The importance of �-synuclein to PD was validated by the dis-covery that Lewy bodies, the pathological hallmarks of PD, con-

Received June 1, 2017; revised Aug. 17, 2017; accepted Aug. 17, 2017.Author contributions: Y.V.T., P.K.M., and S.S.C. designed research; Y.V.T., J.L., J.R., J.P., X.Z., J.A., and J.K. per-

formed research; Y.V.T., P.K.M., and S.S.C. wrote the paper.This work was supported by National Institute of Neurological Disorders and Stroke R01 NS064963, NS083846,

and Regenerative Medicine Research Fund Grant 14-SCA-YALE-38 to S.S.C., and Sanofi Genzyme Center of Excellencein Clinical Translational Research Grant and National Institute of Arthritis and Musculoskeletal and Skin Diseases R01AR 065932 to P.K.M. Y.V.T. was supported by the Cellular and Molecular Biology T32 GM007223 Training Grant andis presently a recipient of the National Institute of Neurological Disorders and Stroke T32 NS007224 Training Grantslot and the Lo Graduate Fellowship for Excellence in Stem Cell Research. We thank Dr. Arthur Horwich (YaleUniversity) and members of our laboratories for reading the manuscript and giving suggestions; Dr. Li Gan(Gladstone/University of California–San Francisco) for generously providing the neurogenin-2 knock-in iPSCline; and Dr. David Russell (University of Texas Southwestern Medical Center) for generously sending theGBA2 S62 antibody.

P.K.M. has received research grants, travel support, lecture, and consultancy fees from Sanofi Genzyme. The otherauthors declare no competing financial interests.

Correspondence should be addressed to either of the following: Dr. Pramod K. Mistry, Department of InternalMedicine, Yale University School of Medicine, New Haven, CT 06519. E-mail: pramod.mistry@yale.edu; andDr. Sreeganga S. Chandra, Program in Cellular Neuroscience, Neurodegeneration and Repair, Yale University, NewHaven, CT 06519. E-mail: sreeganga.chandra@yale.edu.

DOI:10.1523/JNEUROSCI.1525-17.2017Copyright © 2017 the authors 0270-6474/17/379617-15$15.00/0

Significance Statement

Parkinson’s disease (PD) is a prevalent neurodegenerative disorder in the aging population. Glucocerebrosidase 1 mutations, whichcause Gaucher disease, are the most common genetic risk factor for PD, underscoring the importance of delineating the mechanismsunderlying mutant GBA-associated PD. We show that lipids accumulating in Gaucher disease, especially glucosylsphingosine, play a keyrole in PD pathology in the brain. These data indicate that ASAH1 (acid ceramidase 1) and GBA2 (glucocerebrosidase 2) enzymes thatmediate glucosylsphingosine production and metabolism are attractive therapeutic targets for treating mutant GBA-associated PD.

The Journal of Neuroscience, October 4, 2017 • 37(40):9617–9631 • 9617

sist mainly of aggregated �-synuclein (Spillantini et al., 1997).While aggregated �-synuclein present in Lewy bodies is fibrillar,recent studies have suggested that soluble oligomers are moretoxic, largely contributing to PD-related neurodegeneration(Winner et al., 2011).

Mutations in GBA, encoding lysosomal glucocerebrosidase 1(GCase1), are the most common genetic risk factor for PD (Sid-ransky et al., 2009). Biallelic mutations in GBA cause Gaucherdisease (GD), a lysosomal storage disorder (Tsuji et al., 1987,1988). The most common GCase1 mutations are N370S andL444P, accounting for 70% of disease alleles (Charrow et al.,2000; Grabowski et al., 2014). Both GD patients and heterozy-gous carriers are at increased risk for PD, with higher risk inhomozygous individuals (�20-fold vs 5-fold, respectively) (Bul-tron et al., 2010; Alcalay et al., 2014). Hence, understanding themechanistic links between GCase1 mutations and PD is of im-portance. GD patients develop Lewy body pathology, underscor-ing the importance of �-synuclein aggregation in GD-associatedPD (Wong et al., 2004). However, it is unclear how GCase1 mu-tations contribute to PD pathology. Indeed, several contradictorymechanisms have been proposed. It has been suggested that mu-tant GCase1 physically interacts with and induces acceleration of�-synuclein aggregation in lysosomes (Yap et al., 2011), whereasanother study showed that GCase1 loss-of-function-induced lys-osomal dysfunction causes �-synuclein aggregation in lyso-somes, further perturbing its function (Mazzulli et al., 2011).

GCase1 catalyzes the conversion of glucosylceramide (Gl-cCer) to glucose and ceramide. The primary defect in GD is theaccumulation of GlcCer in lysosomes and is seen most promi-nently in macrophages. GlcCer is alternatively processed to glu-cosylsphingosine (GlcSph) via lysosomal acid ceramidase, whichcan readily exit the lysosome (see Fig. 1A) (Elleder, 2006; Hein etal., 2007; Ferraz et al., 2016). As GlcCer builds up, it spills overinto the cytosol (Hein et al., 2007). GlcCer and GlcSph are wellestablished as primary storage lipids in GD (Nilsson andSvennerholm, 1982). These cytosolic sphingolipids are hydro-lyzed by nonlysosomal GCase2 (GBA2; not deficient in GD)(Yildiz et al., 2006), to ceramide, sphingosine (Sph), andsphingosine-1-phosphate (S1P). Ceramide does not accumulatedue to hydrolysis by neutral ceramidase, resulting in secondaryaccumulation of Sph and S1P in GD. Together, lipids accumulat-ing peripherally in GD are GlcCer, GlcSph, Sph, and S1P (Mistryet al., 2014). There is also evidence that loss of GCase1 activityleads to lysosomal dysfunction (Bae et al., 2015). While this cas-cade has been demonstrated in peripheral organs, presently it isnot clear whether similar events occur in the brain.

Here, we propose that GlcCer and its metabolites are criticalplayers in mutant GBA-associated PD. We show that sphingolip-ids accumulating in GD accelerate �-synuclein aggregationin vitro, with potent effects of GlcSph and Sph in inducing patho-logic �-synuclein species capable of templating in human cellsand neurons. Using newly generated Gba mutant (N370S,L444P) and knock-out (KO) mouse models crossed with an�-synuclein transgenic PD mouse, we show that GCase1 defi-ciency promotes �-synuclein pathology. Importantly, we showthat GlcSph accumulates in the brain of young GD mice, consis-tent with GlcSph being the toxic lipid species in mutant GBA-associated PD through initiation of pathological �-synucleinaggregation.

Materials and MethodsProtein expression. Human WT �-synuclein, along with the point mutantsA30P and A53T, was purified as previously described (Chandra et al., 2003).

Liposome preparation. Liposomes were prepared using 75% phos-phatidylcholine (PC) and 25% experimental lipid. For circular dichro-ism experiments seen in Figure 1, liposomes were prepared to a totalconcentration of 138 �M, or 34.5 �M of experimental lipid. For circulardichroism experiments seen in Figure 6, liposomes were prepared to anexperimental concentration of 0.1, 1, and 10 �M of GlcSph with a con-stant 30 �M PC for all conditions and PC control.

Experimental lipids include GlcSph (Matreya 1306), S1P (SigmaS9666), PC (Avanti Polar Lipids 840051P), ceramide (Avanti Polar Lipids860052P), GM1 (Avanti Polar Lipids 860065P), bis(monoacylglycero)phosphate (BMP) (Avanti Polar Lipids 857136C), GlcCer (Avanti PolarLipids 131304P), and Sph (Avanti Polar Lipids 860537P). Lipid was sol-ubilized in 2:1 chloroform/methanol and dried in a glass tube using agaseous nitrogen stream. Dried lipids were hydrated in 0.1 M phosphatebuffer, pH 7.4 at 37°C for 1 h, then vortexed for 5 s to form a liposomesuspension. Liposomes were sonicated in a 2510 Branson ultrasoniccleaner bath for 30 min at 25°C, put through 2 freeze/thaw cycles, thenbath sonicated for another 60 min. Liposome size was limited to 100 nmusing a liposome extruder and used immediately. In the case of GM1(Avanti Polar Lipids, 860065P), liposomes were not prepared using PC,as GM1 is soluble in aqueous solutions.

Circular dichroism. Circular dichroism was performed on a Chirascanspectrophotometer (wavelength range: 190 –250�, step size: 1�, repeats:3). Samples were prepared by mixing 138 �M total lipid (or 34.5 �M

experimental lipid) to 13.8 �M �-synuclein protein (lipid/protein �10:1) and protein/lipid mixtures were incubated at 37°C, shaking at 1000rpm. Circular dichroism was measured on freshly prepared samples andsubsequently daily for 5 d. Spectra were analyzed for secondary structurecontent following data acquisition using the DichroWeb CONTINLLdatabase, reference set 7 (Provencher and Glockner, 1981; van Stokkumet al., 1990; Lobley et al., 2002; Whitmore and Wallace, 2004, 2008).

Electron microscopy. The 3 �l �-synuclein/lipid sample (prepared asdescribed for circular dichroism) was added to carbon-coated grids(Electron Microscopy Sciences CF400-Cu) for 2 min at room tempera-ture. Grids were washed once in 2% uranyl acetate, incubated in fresh 2%uranyl acetate for 1 min, blotted, and allowed to air dry. Imaging ofsamples was performed on an FEI Tecnai G2 Spirit TWIN (T12).

Atomic force microscopy (AFM). AFM was performed on a Bruker Di-mension Fastscan AFM using ScanAsyst Peak Force Tapping imagingmode. SCANASYST-AIR tips (Bruker Scientific) were used for imaging.The 4 �l of �-synuclein/lipid sample was added to freshly cleaved mica(Electron Microscopy Sciences 71856-01-10) and incubated at roomtemperature for 1 min. Mica was washed twice with 50 �l deionized waterto remove excess sample. Samples were then dried using nitrogen gas andimaged immediately after. Aggregate length was quantified using ImageJsoftware, with n � 2 images per condition.

Aggregation assay in HEK293T cells. HEK293T cells were transfectedwith human �-synuclein-GFP (AddGene 40822) for 48 h using Gene-PORTER transfection reagent (Genlantis) in a 6-well plate. Confluentcells were then trypsin-isolated, with a final volume of 3 ml/well cellsuspension, in preparation for protein addition. The 0.2 mg/ml fibril-lized or monomeric �-synuclein was put through 3 freeze/thaw cyclesand sonicated in a 2510 Branson ultrasonic cleaner bath for 10 min; 25 �lof sample was added to 100 �l OptiMEM (Invitrogen), whereas 5 �l ofGenePORTER reagent was added to 100 �l OptiMEM in a separate tube.Following 5 min incubation, the two mixtures were combined and al-lowed to incubate for 20 min at room temperature. The protein mixturewas then added together with 200 �l trypsin-isolated cell suspension of�-synuclein-GFP HEK cells into one well of a 24-well plate with aMatrigel-covered coverslip; 200 �l DMEM supplemented with 10% FBSwas added 30 min after plating and grown for an additional 48 h. Cellswere then fixed with 4% PFA, 4% sucrose solution for 40 min at 37°C forfluorescent imaging.

Quantitation of percentage of cells with aggregates was completedmanually through random visualization of �90 cells per biological rep-licate. Analysis was done blind to experimental condition.

Induced pluripotent stem cell (iPSC) differentiation into induced humanneurons. Induced human neurons were produced through the forcedexpression of transcription factor neurogenin-2 in iPSCs, as previously

9618 • J. Neurosci., October 4, 2017 • 37(40):9617–9631 Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology

described (Zhang et al., 2013). The Ngn2-iPSC line contains a single copyof a doxycycline-inducible mouse neurogenin2 cassette (which also con-tained a CAG promoter driving a third-gen Tet transactivator) into thesafe harbor AAVS1 locus of the parent WTC11 iPSC line. All inducedneurons were used at least 30 d following differentiation.

Aggregation assay in induced human neurons. iPSCs were plated at adensity of 100 cells/cm 2 in 12-well plates, differentiated as outlinedabove, and allowed to grow in culture for 30 d; 0.2 mg/ml fibrillized ormonomeric �-synuclein was put through 3 freeze/thaw cycles and soni-cated in a 2510 Branson ultrasonic cleaner bath for 10 min; 50 �l ofsample was added to 200 �l OptiMEM (Invitrogen), whereas 10 �l ofGenePORTER reagent was added to 200 �l OptiMEM in a separate tube.Following 5 min incubation, the two mixtures were combined and al-lowed to incubate for 20 min at room temperature. The protein mixturewas then added to the media over the induced neurons and allowed toincubate at 37°C for 7 d. Cells were then scraped and run on a Westernblot for analysis of intracellular �-synuclein levels.

Generation of mouse lines. Production of all GD lines is summarized inFigure 4. The insertion of a Neo cassette between exons 7 and 8 of Gbaresulted in a complete Gba KO, which was rescued in the skin using theK14-Cre as described by Mistry et al. (2010). Rescue in the skin preventedlethality, as Gba KO in the skin caused a disruption in the skin permea-bility barrier resulting in severe dehydration and early death. Gba mutantmice were generated by knocking in either Gba N370S (exon 9) or L444P(exon 10; L444P mice were a gift from Dr. Richard L. Proia) (Mizukamiet al., 2002). Viable “homozygous” mutants possess one copy of GbaN370S or L444P and one copy of Gba KO with rescue in the skin.

Mouse genotyping was performed as follows: N370S genotyping(1 band at 414 bp), primers: N370S-forward (CAGTCACAGCATCAT-TACG), N370S-reverse (TTACGTGGTAAAGGAGGC); L444P genotyping(1 band at 381 bp), primers: L444P-forward (GCCAGTGAGAGCACT-GACCC), L444P-reverse (GCCCCGTGTCACTGTAAGG); Neo/K14 geno-typing (2 bands at 337 bp (Neo) and 493 bp (K14)), primers: GBA-forward(CCCGCTGGGCAGAGGTGGTA), Neo-reverse (GTGCCAGCGGGGCTGCTAAA), K14-forward (TTCCTCAGGAGTGTCTTCGC), K14-reverse (GTCCATGTCCTTCCTGAAGC); Neo/WT genotyping (for differ-entiation of heterozygous vs homozygous Neo; 2 bands at 279 bp (WT) and313 bp (Neo)), primers: GBA-forward (CCCGCTGGGCAGAGGTGGTA),GBA-reverse (ACCAGAGTTATCTGGTGAGATC).

Our Gba mice were produced similarly to Gba mice generated in En-quist et al. (2007), with some key differences that are likely to contributeto the relative viability of our lines. The insertion sites of the floxed neodiffer (the insertion by Enquist et al., 2007 was between exons 8 and 9,whereas we inserted between exons 7 and 8), and in addition, there maybe variations in the effectiveness of our K14-Cre mouse line.

All heterozygous and homozygous Gba KO, N370S, and L444P micewere crossed with mice overexpressing the human �-synuclein A30Ptransgene, as previously described (Chandra et al., 2005). This cross wasperformed to overcome the issue of low penetrance of PD in GD patients,as GBA mutations only confer risk to, but do not cause, PD. All 14resulting genotypes are listed in Figure 4B. Mice of either sex were used inall experiments.

GCase1 and GCase2 activity assay. A modified form of a previouslyestablished GCase assay was used in this paper (Mistry et al., 2010), withthe following changes: decrease in buffer pH, disuse of sodium tauro-cholate detergent, and the use of CBE and NB-DNJ inhibitors to deter-mine baseline activity levels. All noted changes bettered assay accuracy.

One hemisphere of mouse brain was Dounce homogenized in 1 mlhomogenization buffer (0.5% Triton X, 4 mM 2-ME, 0.05 M citric acid,0.1 M K2HPO4, pH 5.1 with 1� SIGMAFAST Protease Inhibitor CocktailTablet, Sigma-Aldrich S8830-20TAB) on ice at 3000 rpm using 25strokes. Homogenates were then put through 3 freeze/thaw cycles andspun at 14,000 rpm for 20 min at 4°C; 2 �l of 5 �g/�l total protein fromthe supernatant and 2 �l of GCase inhibitor (final concentration 36 �M

CBE to inhibit GCase1 or 10 �M NB-DNJ to inhibit GCase2) was addedto 21 �l of GCase reaction buffer (4 mM 4-methylumbelliferyl-B-D-glucoside, 0.01% BSA, 0.05 M citric acid, 0.1 M K2HPO4, pH 5.1) for atotal reaction volume of 25 �l. Reactions were incubated on ice for 30min, then at 37°C for 60 min. Reaction was cooled to 4°C on ice and

200 �l of precooled stop solution (0.5 M glycine-NaOH, pH 10.6) wasadded. Measurements were taken with a standard plate reader (366 nmexcitation, 445 nm emission). Standard curves were created using 8 con-centrations of 4-methylumbelliferone standard ranging from 1 to 8 �M

prepared in 1% DMSO.GCase1 levels were determined by subtracting GCase2 and back-

ground GCase activity levels (as determined through use of inhibitors:conduritol epoxide, CBE for Gba1 and N-butyl-deoxynojirimycin, NB-DNJ for Gba2). Similarly, GCase2 levels were determined by subtractingGCase1 and background GCase activity levels (as determined throughuse of inhibitors). All inhibitors and baseline levels were prevalidatedthrough the evaluation of Gba KO and Gba2 KO mice as controls.

Characterization of mouse weight, behavior, and survival. Mouse weightwas recorded monthly on a cohort containing 163 mice. Survival of allmouse lines was recorded over a 24 month period. Mice with severedermatitis were censored, whereas mice suffering from end-stage motorphenotypes or those that were found dead were included in the analysis.Mouse behavior was characterized using the hanging grip test to assessmotor phenotype. Mice able to hang for the complete 2:00 min are con-sidered healthy, whereas those unable to hang for this amount of timeexhibit motor phenotypes.

Immunohistochemistry. Brains were postfixed in 4% PFA overnight,incubated in 30% sucrose, and frozen in OCT. Brains were sectioned into30 �m free-floating sections using a Leica cryostat. Sections were washedin PBS, permeabilized in 0.5% Triton X-100 in PBS, and blocked in 0.1%Triton X-100 and 2% goat serum in PBS for 30 – 60 min at room temper-ature. Sections were then incubated in primary antibody in blockingsolution overnight at 4°C, washed in PBS, and incubated in secondaryantibody in blocking solution for 1 h at room temperature.

Whole spinal columns were postfixed in Cal-Rite decalcifying/fixationsolution (Thermo Fisher Scientific 5501) for 2 d. Spinal cords were dis-sected out, incubated in 30% sucrose for 2 d, and frozen in OCT. Spinalcords were then sectioned into 7 �m sections onto X-tra slides (LeicaBiosystems 3800200) and dried for 10 min. Slides were then washed inPBS for 5 min to remove OCT, permeabilized in 0.5% Triton X-100 inPBS, and blocked in 0.1% Triton X-100 and 2% goat serum in PBS for30 – 60 min at room temperature. Slides were then incubated in primaryantibody in blocking solution overnight at 4°C, washed in PBS, andincubated in secondary antibody in blocking solution for 1 h at roomtemperature.

All samples were imaged using a Zeiss Laser Scanning Microscope 710.Primary antibodies include �-synuclein (BD Biosciences 610786, RRID:AB_398107 at 1:500), CD68 (Bio-Rad MCA1957, RRID:AB_322219 at1:500), glucosylceramide (Glycobiotech RAS0011 at 1:100), and phos-phorylated �-synuclein (Wako 015-25191, RRID:AB_2537218 at1:1000). Goat AlexaFlour secondary antibodies were used at 1:500 dilu-tion for all samples.

Nissl stain. Spinal cords for Nissl stain were treated and sectioned asoutlined above. After drying, slides were washed in PBS 2 times for 5 min,washed in water 1 time for 1 min, incubated in 0.1% cresyl violet/1%acetic acid for 20 min, washed in water 2 times for 5 min, then dipped in90%, 95%, and 100% ethanol. Slides were then cleaned in xylene 2 times,mounted using Permount (Fisher Scientific SP15–100), and allowed todry overnight. Slides were imaged using an AmScope B490B-M DigitalCompound Microscope.

Lipidomics. Lipidomics were completed as previously described (Mis-try et al., 2014). Briefly, brain tissue samples were analyzed using an API4000 triple-quadrupole mass spectrometer interfaced with an Agilent1200 HPLC.

Differential detergent extraction. Total brain homogenate was seriallyextracted using detergents as outlined by Zhang et al. (2012). Serial ex-traction resulted in a soluble fraction (S1) and an SDS-insoluble fraction(P3), which were then analyzed by Western blot for phosphorylated�-synuclein levels.

Dot blot on brain homogenate. A total of 5 �l of the soluble fraction (S1)from mouse brain serially extracted using detergents (see Differentialdetergent extraction) was blotted onto nitrocellulose membrane and al-lowed to dry for 1 h under vacuum. Membranes were blocked at roomtemperature for 1 h, incubated in primary anti-oligomer A11 antibody

Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology J. Neurosci., October 4, 2017 • 37(40):9617–9631 • 9619

(Invitrogen AHB0052, RRID:AB_2536236 at 1:1000) at room tempera-ture for 1 h, washed in TBST, incubated in secondary antibody for 1 h atroom temperature, and washed in TBST before imaging.

ELISA on aggregated �-synuclein. Concentration of total brain homog-enate was determined using a BCA assay, and samples were diluted to 750ng/ml for use in ELISA. Samples were assayed using the Human�-Synuclein PATHO ELISA kit (Analytikjena 847-0104[x]00108), spe-cific for aggregated �-synuclein.

Western blotting. Protein blots were run on 12% acrylamide gels andtransferred overnight onto PVDF transfer membrane. Membranes wereblocked for 1 h at room temperature in 5% w/v milk and 5% goat serumin TBST. Membranes were then incubated overnight at 4°C in blockingbuffer with primary antibody, washed in TBST, and incubated 1 h at roomtemperature in blocking buffer with secondary antibody. Primary antibodiesinclude �-synuclein (BD Biosciences 610786, RRID:AB_398107 at 1:1000),actin (MP Biomedicals 691001, RRID:AB_2336056 at 1:10,000), GCase1(Sigma G4171, RRID:AB_1078958 at 1:100), and GCase2 (S62 at 1:1000)(Yildiz et al., 2006), phosphorylated �-synuclein (Wako 015-25191, RRID:AB_2537218 at 1:1000), and acid ceramidase (Santa Cruz BiotechnologySC-292176, RRID:AB_10918357 at 1:100). LI-COR Goat IRDye secondaryantibodies were used at 1:6000 dilution for all samples.

Immunofluorescence. Induced human neurons were fixed using 4%PFA, 4% sucrose for 40 min at 37°C for fluorescent imaging. Cells werewashed in PBS, blocked in 3% goat serum and 0.3% Triton X-100 in PBS,and incubated in blocking buffer with primary antibody overnight at4°C. Cells were then washed in PBS and incubated in blocking buffer withsecondary antibody for 1 h at room temperature. Primary antibodiesinclude �-synuclein (BD Biosciences 610786, RRID:AB_398107 at1:500), CSP� (Enzo ADI-VAP-SV003-E, RRID:AB_10532399 at 1:1000),and MAP2 (EMD Millipore AB5543, RRID:AB_571049 at 1:5000). GoatAlexaFlour secondary antibodies were used at 1:500 dilution for allsamples.

Lysosomal fractionation. Lysosomal fractionation was performed usingthe Lysosome Enrichment Kit for Tissue and Cultured Cells (ThermoFisher Scientific 89839); N � 3 brains per condition.

Experimental design and statistical analysisFor all mouse experiments, both sexes were used.Circular dichroism experiments (see Figs. 1, 6F ). One-tailed t test used

to test significance relative to PC. Three replicates of each condition wererun. For Figure 1E, p values: GlcCer � 0.005, GlcSph � 0.016, Sph �0.024, S1P � 0.028, Cer � 0.353; for Figure 1F, p values: BMP � 0.003,GM1 � 6.778 � 10 �5; for Figure 1G, p values: GlcCer � 0.320, GlcSph �0.003, Sph � 0.002, S1P � 0.049, and Cer � 0.262; for Figure 1H, pvalues: GlcCer � 0.369, GlcSph � 0.012, Sph � 0.003, S1P � 8.0319 �10 �4, and Cer � 0.481. For Figure 6F, day 7 p values: GlcSph-0.1 �0.243, GlcSph-1 � 0.472, GlcSph-10 � 0.004.

Aggregation assay in HEK293T cells (see Fig. 3A). Two-tailed t test usedto test significance relative to PC; �241 cells per condition were assayed.p values: Cer � 1.000, GM1 � 0.423, GlcCer � 0.301, GlcSph � 0.014,Sph � 4.900 � 10 �4, S1P � 0.298.

Aggregation assay in human neurons (see Fig. 3B). Two-tailed t test wasused to test significance relative to PC. Two replicates of each conditionwere run. p values: Cer � 0.894, GM1 � 0.544, GlcCer � 0.910,GlcSph � 0.021, Sph � 5.500 � 10 �4, S1P � 0.867.

Gba protein levels in brain (see Fig. 4D). Two-tailed t test used to testsignificance. Two replicates of each conditions were run. p values versusWT: L444P/WT � 0.127, N370S/WT � 0.626, KO/WT � 0.230, L444P/KO � 0.002, N370S/KO � 0.003, KO/KO � 0.001. p values versusN370S/KO: L444P/KO � 0.010, KO/KO � 0.001.

Gba activity levels in brain (see Fig. 4 E, F ). Two-tailed t test used to testsignificance. For total Gba activity levels, 17 WT, 35 GBA Het, and 24GBA KO mice were assayed. p values versus WT: Het � 0.008, KO �3.658 � 10 �13; p values versus Het: KO � 2.577 � 10 �19. For age-relatedGba activity levels, 6 young WT, 9 old WT, 22 young GBA Het, 10 oldGBA Het, 13 young GBA KO, and 9 old GBA KO mice were assayed.Two-tailed t tests were used to test significance. p values versus corre-sponding young cohort: WT � 0.170, Het � 0.003, KO � 0.753.

Assessment of lumbar motor neurons in spinal cord (see Fig. 5B). Two-tailed t tests were used to test significance relative to WT. N and p values:WT/WT: N � 3; /WT: N � 2, p � 0.489; /KO: N � 5, p � 0.144; SNCA Tg:N � 2, p � 0.002; /WT SNCA Tg: N � 2, p � 0.009; /KO SNCA Tg: N � 3,p � 0.001.

Assessment of microglia recruitment in SNCATg mice (see Fig. 5D). Two-tailed t tests were used to test significance relative to WT. N and p values:WT/WT: N � 5; /WT: N � 2, p � 0.315; /KO: N � 1, no p value;SNCA Tg: N � 2, p � 0.005; /KO SNCA Tg: N � 3, p � 0.001.

Motor phenotype onset to death in GD/PD mice (see Fig. 5H ). Two-tailed t tests were used to test significance of GD/PD early death micerelative to WT mice; N � 10 for both groups. p value relative to PD �1.64 � 10 �4.

Lipidomics on mouse brain (see Fig. 6A–D). Two-tailed t tests were usedto test significance relative to WT. N for all analyses: WT/WT: 3, L444P/WT: 3, N370S/WT: 2, KO/WT: 2, L444P/KO: 2, N370S/KO: 6, KO/KO(GlcSph Only): 1. p value for GlcSph levels: L444P/WT � 0.234, N370S/WT � 0.313, KO/WT � 0.608, L444P/KO � 3.350 � 10 �4, N370S/KO � 0.002.

GlcSph-derived �-sheeted �-synuclein (see Fig. 6F ). Two-tailed t testswere used to test significance relative to WT; N � 3 for all samples. pvalue relative to PC: GlcSph-0.1 � 0.243, GlcSph-1 � 0.472, GlcSph-10 � 0.004.

Concentration of lysosomal fractions (see Fig. 6I ). Two-tailed t testswere used to test significance of Gba /KO relative to WT; N � 3 for bothgroups. p value relative to WT � 0.031.

GlcCer standard curve (see Fig. 6J ). Standard curve with samples con-taining 0, 0.2, 0.5, 1, and 2 �g GlcCer were plotted and yielded an R 2 �0.99.

GlcCer levels in brain by antibody (see Fig. 7 B, C). Two-tailed t testswere used to test significance relative to WT/WT. For Figure 7B, N and pvalues: anticipated death: N � 3; early death: N � 3, p � 0.013. For Figure7C, N and p values: WT/WT: N � 3; SNCA Tg: N � 3, p � 0.624; /WTSNCA Tg: N � 4, p � 0.783; /KO SNCA Tg: N � 3, p � 0.010.

Phosphorylated �-synuclein S129 levels by antibody (see Fig. 7 D, H ).One-tailed t tests were used to test significance relative to WT/WT. ForFigure 7D, N and p values: WT/WT: N � 3; SNCA Tg: N � 3, p � 0.010;/WT SNCA Tg: N � 4, p � 0.036; /KO SNCA Tg: N � 3, p � 0.010. ForFigure 7H (16 kDa), N and p values versus WT/WT: SNCA Tg: N � 3, p �4.120 � 10 �4; /KO SNCA Tg: N � 3, p � 0.008. For Figure 7H (37 kDa),N and p values versus WT/WT: SNCA Tg: N � 3, p � 0.090; /KO SNCA Tg:N � 3, p � 0.002.

Aggregated �-synuclein levels by ELISA (see Fig. 7J ). Two-tailed t testswere used to test significance relative to WT/WT. N and p values: WT/WT: N � 3; SNCA Tg: N � 3, p � 0.016; /KO SNCA Tg: N � 3, p � 0.014;p values versus SNCA Tg: /KO SNCA Tg � 0.034.

GBA2 activity levels in mouse brain (see Fig. 8A). Two-tailed t tests wereused to test significance relative to young cohort. N and p values: WT/WT: N � 8, 3-month, 9 1-year mice, p � 0.507; /WT: N � 26 3-month,9 1-year mice, p � 0.038; /KO: N � 16 3-month, 8 1-year mice, p � 0.398.

GBA2 protein levels in mouse brain (see Fig. 8C). Two-tailed t tests wereused to test significance relative to young cohort. Six mice per genotypewere used, with 3 young (age 3 months) and 3 old (age 1� year) mice. pvalues: WT/WT � 0.193, /WT � 0.021, /KO � 0.991.

ResultsSphingolipids accumulating in GD promote �-synucleinaggregation into distinct pathologic species in vitroTo determine whether the sphingolipids that accumulate pe-ripherally in GD, GlcCer, GlcSph, Sph, and S1P interact with�-synuclein and influence its aggregation, we used circular dichr-oism to track the secondary structure of �-synuclein in thepresence of respective lipids. To mimic a cellular setting, PC li-posomes containing one of the following lipids: GlcCer, GlcSph,Sph, S1P, ceramide, GM1 ganglioside, or BMP (a major compo-nent of lysosomal membranes) were prepared and incubatedwith purified human WT �-synuclein. PC alone serves as anegative control as it does not alter the conformations of

9620 • J. Neurosci., October 4, 2017 • 37(40):9617–9631 Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology

�-synuclein, whereas GM1 is a positive control for inducing an�-helical conformation (Martinez et al., 2007). Circular dichro-ism spectra were measured immediately after mixing and subse-quently daily for 5 d. On day 0, �-synuclein was unstructured inthe presence of all lipids, except GM1 and BMP, both of whichinduced an �-helical conformation upon mixing (Fig. 1B,C,F).Secondary structure was analyzed for the emergence of �-sheetstructure, indicative of transition from unstructured, mono-meric, �-synuclein to oligomers or fibrils. After 5 d of incubation,�-synuclein samples containing GD-associated sphingolipidswere mainly �-sheeted (Fig. 1B,D,E), whereas samples with PCand Cer remained unstructured and samples with GM1 ganglio-side and BMP remained �-helical (Fig. 1B,D,F). Of the GD sph-ingolipids, GlcCer was the slowest to induce �-sheet structureformation (Fig. 1E,G,H). Incubation with GlcCer has been pre-viously shown to accelerate �-synuclein aggregation, supportingour findings (Mazzulli et al., 2011). These results clearly showthat all sphingolipids that accumulate in GD can interact withWT �-synuclein to accelerate its aggregation into oligomericand/or fibrillary states. We obtained similar results with PD mu-tants of �-synuclein (A53T, A30P) (Fig. 1G,H).

To differentiate between oligomer and fibril formation in thecircular dichroism samples, we performed electron microscopyand AFM to visualize the �-synuclein aggregates formed in thepresence of our experimental lipids (day 5 samples). Using elec-tron microscopy, we found �-synuclein fibrils in samples con-taining GlcCer, Sph, and S1P, whereas unfibrillized protein was

present in other samples (Fig. 2A). The fibrils were typical ofthose seen when �-synuclein alone is aggregated in vitro (Fig. 2A)or purified from transgenic mice (Recasens et al., 2014; Peelaertset al., 2015). Interestingly, we did not see long fibrils in the pres-ence of GlcSph (Fig. 2A), even though GlcSph induced �-sheetstructure as measured by circular dichroism (Fig. 1B,D,E). Tofurther elucidate the type of �-synuclein aggregates formed in thepresence of GlcSph, we imaged these samples with AFM. Intrigu-ingly, we discovered oligomers in the GlcSph sample (Fig. 2B).We also confirmed the presence of long fibrils in the GlcCer andS1P samples using this method, and identified that Sph induces aheterogeneous mixture of oligomers and fibrils (Fig. 2B). Whenwe measured the length of the �-synuclein species, we can clearlydifferentiate the ones formed by GlcSph and Sph (Fig. 2C), whichhave a median length of 0.043 and 0.104 �m, respectively, fromthose formed by GlcCer and S1P, which have a median length of0.603 and 0.582 �m (Fig. 2D). These findings demonstrate adirect role of GlcCer, GlcSph, Sph, and S1P in promoting�-synuclein aggregation into different types of species, furthersuggesting that some of these sphingolipids may be more patho-logical than others within the nervous system.

�-Synuclein species produced by GlcSph and Sph havedistinctive aggregation propensity in mammalian cell cultureand human neuronsWe established an intracellular �-synuclein aggregation assay inHEK293T cells based on previous literature (Luk et al., 2009).

Figure 1. Sphingolipids accumulating in GD promote the acceleration of �-synuclein aggregation into different pathologic species. A, Spatial topography of GlcCer metabolism in GD withreference to subcellular compartmentalization of enzymes and sphingolipids. Red upward arrows indicate upstream and downstream sphingolipids that accumulate peripherally due to GBAdeficiency. Green zone represents lysosome. B, Summary of circular dichroism results obtained by incubating �-synuclein with the indicated lipids for 5 d. For all circular dichroism data, experimentallipids were added at 34.5 �M and �-synuclein added at 13.8 �M [(total lipid PC � experimental lipid liposome): protein � 10:1]. C, Circular dichroism spectra of WT �-synuclein at day 0. Unfoldedproteins have minima at 195 nm, whereas �-helical conformations have minima at 205 and 222 nm. D, Circular dichroism spectra of WT �-synuclein at day 5. Proteins with �-sheeted conformationshave minima at 217 nm. E, Time course of �-sheet conformation acquisition of WT �-synuclein in presence of GD sphingolipids. The percentage �-sheet conformation was calculated usingDichroWeb. p values relative to PC for GlcCer � 0.005, GlcSph � 0.016, Sph � 0.024, S1P � 0.028, and Cer � 0.353. F, Time course of �-helical conformation acquisition in the presence of GM1and BMP. p values relative to PC for BMP � 0.003, GM1 � 6.778 � 10 �5. G, Time course of �-sheet conformation acquisition of mutant A53T �-synuclein in presence of same sphingolipids. pvalues relative to PC for GlcCer � 0.320, GlcSph � 0.003, Sph � 0.002, S1P � 0.049, Cer � 0.262. F, Time course of �-sheet conformation acquisition of mutant A30P �-synuclein in presence ofsame sphingolipids. p values relative to PC for GlcCer � 0.369, GlcSph � 0.012, Sph � 0.003, S1P � 8.0319 � 10 �4, Cer � 0.481. E–H, Data are mean � SEM. n � 3 experiments per sample,*p � 0.05 versus PC (one-tailed Student’s t test). **p � 0.01 versus PC (one-tailed Student’s t test). ***p � 0.001 versus PC (one-tailed Student’s t test).

Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology J. Neurosci., October 4, 2017 • 37(40):9617–9631 • 9621

Briefly, we added preformed �-synuclein aggregates to the cul-ture media of HEK293T cells overexpressing �-synuclein-GFP,facilitated internalization, and monitored templating of endoge-nous �-synuclein-GFP into intracellular, GFP-positive aggre-gates (Fig. 3A). This assay was used to evaluate the relativepathogenicity of aggregated species formed following �-synuc-lein incubation with GD-associated sphingolipids. We found thatpreformed aggregated �-synuclein species formed with GlcSphand Sph produced significantly more internal, GFP-positive ag-gregates than with GlcCer and S1P, related lipids, and controls(Fig. 3A). Notably, the templating propensity of the preformedaggregated species correlated with the oligomeric �-synucleinstructures observed by AFM in the samples containing GlcSphand Sph (Fig. 2B–D). Although we cannot exclude the possibilitythat oligomeric �-synuclein species are taken up more efficiently,it would still suggest that size of �-synuclein species formed is adeterminant of its pathogenicity. These results show a specificeffect of GlcSph and Sph in inducing the formation of oligomeric�-synuclein species that are capable of pathologic templating.

To confirm these results in a neuronal model, we used humanneurons derived from iPSCs. Differentiation was induced throughneurogenin 2 expression, generating excitatory neurons, as de-scribed previously (Zhang et al., 2013). Consistent with previousreports, the human neurons show localization of �-synuclein atpresynaptic puncta and MAP2-positive dendrites. Similar toour experiments in HEK293T cells, we added exogenous pre-formed GD sphingolipid-induced �-synuclein species and as-sessed their effects on internal �-synuclein aggregation. ByWestern blotting, we could show that samples with GlcSphand Sph specifically promoted endogenous �-synuclein aggre-gation, whereas samples with GlcCer, S1P, and control lipidsresulted in only monomeric �-synuclein (Fig. 3B). The aggre-gation observed is unlikely to be remnants of exogenous�-synuclein species as we do not see any aggregates in GlcCerand S1P samples, even though they are likely to be stable.These results in neuronal cells replicate our findings inHEK293T culture, verifying that oligomeric �-synuclein spe-cies formed with GlcSph and Sph are more pathogenic in hu-

Figure 2. GlcSph and Sph promote oligomeric �-synuclein aggregates. A, Electron microscopy images of day 5 circular dichroism samples. Left panels, Images of monomeric and aggregated�-synuclein are shown for reference. Scale bar, 50 nm. B, AFM images of �-synuclein aggregated with Gaucher sphingolipids. Scale bar, 500 nm. Height of images � 50 nm. N � 3 independentexperiments. C, Frequency distribution of size of �-synuclein species formed by aggregation in vitro as analyzed by AFM. Control conditions are in the absence of lipids, but aggregated for longerdurations. The GD sphingolipids used are denoted. There are three images/condition. D, Median length of �-synuclein species formed.

9622 • J. Neurosci., October 4, 2017 • 37(40):9617–9631 Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology

man neurons than �-synuclein species formed by otherexperimental lipids.

New long-lived mouse models for GD/PDTo test the role of altered sphingolipid metabolism in mutantGBA-associated PD, we generated new GD mouse lines. Previ-ously produced germline homozygous Gba KO mice as well ashomozygous N370S or L444P mice exhibited disruption of skinpermeability barrier that caused neonatal lethality (Xu et al.,2003). Therefore, we generated conditional Gba KO mice andGba mutant knock-in (N370S, L444P) mice, which are rescued byexpressing Gba only in skin (Fig. 4A–C), similar to mice gener-ated by Enquist et al. (2007). The knock-in mice were bred to GbaKO to generate Gba mutant alleles on a WT and KO background.Significantly, these mice do not die due to skin permeability is-sues, allowing us to study age-related phenotypes. The homozy-gous Gba KO (GbaKO/KO) and knock-in (GbaL444P/KO, GbaN370S/KO)mice are viable, fertile, and grossly normal with the expectedbody weight at 4 months (Fig. 4G). The Gba mutant mice reca-pitulate key pathophysiological features, including enzymatic de-ficiency of GCase1 (Fig. 4E) and the accumulation of GlcCerand GlcSph (see Figs. 6B, 7B, C,F ). Compared with WT mice,there was also a marked decrease of GCase1 protein levels inthe brains of mutant GD mice by quantitative Western blot-ting (Fig. 4D), further validating these lines. Interestingly, wefind that the Gba L444P/KO line resembles the Gba KO/KO,whereas the Gba N370S/KO brains have �50% GCase1 proteinlevels (Fig. 4D), a finding supported by previous literatureciting N370S as a trafficking mutation (Babajani et al., 2012).Measurement of GCase1 enzyme activity in brain homoge-nates of GD mice revealed that heterozygous Gba KO/WT,Gba L444P/WT, and Gba N370S/WT had an intermediate activitylevel, whereas homozygous Gba KO/KO, Gba L444P/KO, andGba N370S/KO all lacked GCase1 enzymatic activity (Fig. 4E).

The Gba mutant mice were crossed to a previously character-ized human �-synuclein A30P transgenic model of PD (SNCATg)to generate homozygous and heterozygous GD/PD mice (Fig.4B). SNCATg mice manifest clinical PD symptoms, includingresting tremor and progressive motor decline, and show age-dependent �-synuclein pathology, motor neuron loss, and mi-croglia activation (Fig. 5) (Chandra et al., 2005). Cohorts of

homozygous GbaL444P/KOSNCATg, GbaN370S/KOSNCATg, GbaKO/KO

SNCATg, and controls (14 genotypes, see Fig. 4B) were regularlyexamined for PD phenotypes, pathology, survival, and GD sph-ingolipid accumulation to determine how GD mutations affectedPD manifestation in our models.

GlcSph accumulates early in mutant GBA-associated PDTo evaluate the altered sphingolipid metabolism in the brains ofGD/PD mice, we quantified GD associated sphingolipid levels in thebrains of a young (3-month) GD/PD mouse cohort by mass spec-trometry. We found that GlcSph levels are significantly increased inhomozygous GbaL444P/KO, GbaN370S/KO, and GbaKO/KO mice at 3months of age (Fig. 6B). We do not observe any change in thesevalues in SNCATg PD mice, suggesting that �-synuclein transgenicexpression does not influence GlcSph levels. Notably, GlcCer, Sph,and S1P levels were not altered at 3 months (Fig. 6A,C,D), eventhough it has been established that these lipids eventually increase inthe plasma of GD patients (Dekker et al., 2011; Mistry et al., 2014).These results are consistent with a previous report indicating thatGlcCer does not accumulate in the brain at an early age in a neuro-pathic GD mouse model; GlcCer was shown to significantly increaseonly by 6 months of age (Dai et al., 2016), suggesting that accumu-lation of GlcCer lags behind that of GlcSph in the brain. However,given the high baseline levels of GlcCer relative to other sphingolip-ids assayed, it is possible that smaller, localized increases are notdetectable until levels increase significantly above endogenouslevels. To address this possibility, we completed a lysosomalfractionation of mouse brain and found no differences be-tween GlcCer levels in fractions from WT and GD mouse brainenriched for lysosomes (Fig. 6G–K ).

Next, we investigated the potency of the observed brainGlcSph concentrations in our in vitro aggregation assay. We de-termined that incubation with GlcSph at concentrations seen inhomozygous GD brains results in the formation of similar oligo-meric �-synuclein species (Fig. 6E). The effect of GlcSph on�-synuclein aggregation was also shown to be concentration de-pendent by circular dichroism (Fig. 6F). Together, these findingsstrongly suggest that GlcSph can potently enhance pathological�-synuclein aggregation in the brain.

Figure 3. Oligomeric GlcSph and Sph �-synuclein species promote �-synuclein seeding. A, Intracellular �-synuclein aggregation assay in HEK293T cells, in which �-synuclein speciesaggregated in the presence of various lipids were added to cell media with a bioporter. Arrow indicates aggregated �-synuclein-GFP. Quantification shown for percentage of HEK293T cells withintracellular aggregates when templated with GD-related sphingolipid preformed �-synuclein species. N � 3 experiments with �241 cells per condition were assayed. p values relative to PC:Cer � 1.000, GM1 � 0.423, GlcCer � 0.301, GlcSph � 0.014, Sph � 4.900 � 10 �4, S1P � 0.298. B, Intracellular �-synuclein aggregation assay as performed in human neurons. Quantificationof relative aggregation, higher molecular weight species normalized to monomeric �-synuclein. N � 2 experiments. p values relative to PC: Cer � 0.894, GM1 � 0.544, GlcCer � 0.910, GlcSph �0.021, Sph � 5.500 � 10 �4, S1P � 0.867. *p � 0.05 (two-tailed Student’s t test). ***p � 0.001 (two-tailed Student’s t test).

Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology J. Neurosci., October 4, 2017 • 37(40):9617–9631 • 9623

GD/PD mouse mortality correlates with level of sphingolipidaccumulation in brainSurvival of GD/PD mice was assessed over the course of 24months. Only mice suffering from end-stage motor phenotypesassociated with PD or those that were found dead were includedin this analysis. The ages at death of SNCATg, heterozygousGba/WTSNCATg, and homozygous Gba/KOSNCATg mice were col-lected and plotted as frequency distributions (Fig. 7A). A Gauss-ian curve was fitted to the SNCATg distribution, indicating valueswithin 1, 2, and 3 SDs of the mean age of death (16.2 months).This curve was overlaid onto the frequency distributions forheterozygous Gba/WTSNCATg and homozygous Gba/KOSNCATg

mice, allowing for visual comparison between genotypes (Fig. 7A).Although all values of the SNCATg line fall within 2 SDs of the

SNCATg mean, a small fraction of heterozygous Gba/WTSNCATg

and a larger fraction of homozygous Gba/KOSNCATg values fall

farther than 2 SDs to the left of the SNCATg mean (Fig. 7A). Thesedata show that a subset of the GD/PD mice exhibit prematuremorbidity relative to the anticipated age of death of SNCATg

mice, suggesting an acceleration of PD phenotypes and pathologydue to contributions from Gba mutation. This distribution mir-rors the patient population, in which GBA mutation confers arisk for PD onset in a dose-dependent manner. Our GD/PDmouse lines also capture the imperfect penetrance of the GBAphenotypes to PD manifestation in humans. As a means of inves-tigating the molecular differences between the early death andanticipated death groups, we immunostained brain sections fromage-matched homozygous Gba/KOSNCATg early death mice andhomozygous Gba/KOSNCATg anticipated death mice, using anantibody against GlcCer (Fig. 7B) (Doering et al., 2002; D’Angeloet al., 2007). We discovered an approximately fivefold increase inGlcCer levels in the early death group relative to the anticipated

Figure 4. Generation and characterization of GD/PD mice. A, Schematic depicting design of Gba KO and mutant mouse lines: gray represents WT; black represents KO; green represents mutant.Ai, Homozygous Gba KO mice were produced through insertion of a Neo cassette between exons 7 and 8. Gba KO was rescued in skin using Cre recombinase, preventing lethality in these lines. Aii,Viable Gba mutant mice (Gba N370S/KO and Gba L444P/KO) were generated with one copy of Gba N370S or L444P and one copy of Gba KO with a rescue in skin, as noted above, to create “homozygous”mutants. B, Summary of all 14 genotypes assessed. C, Positive PCR-based genotyping of all 7 GD mouse lines. D, Quantitative Western blotting of GCase1 protein levels in brains of GD/PD mice. N �2 experiments. p values versus WT: L444P/WT � 0.127, N370S/WT � 0.626, KO/WT � 0.230, L444P/KO � 0.002, N370S/KO � 0.003, KO/KO � 0.001. p values versus N370S/KO: L444P/KO �0.010, KO/KO � 0.001. E, GCase1 enzymatic activity. Heterozygous Gba L444P/WT, Gba N370S/WT, and Gba KO/WT were grouped as Gba /WT, whereas homozygous Gba L444P/KO, Gba N370S/KO, andGba KO/KO were grouped as Gba /KO. N � 17/genotype. p values versus WT: Het � 0.008, KO � 3.658 � 10 �13; p values versus Het: KO � 2.577 � 10 �19. F, Relative GCase1 activity in young(3-months) and old (12-months) brains. N � 6 per genotype. p values versus corresponding young cohort: WT � 0.170, Het � 0.003, KO � 0.753. G, GD mice are viable and exhibit normal weightsat 4 months of age. D–F, *p � 0.05 (two-tailed Student’s t test). **p � 0.01 (two-tailed Student’s t test). ***p � 0.001 (two-tailed Student’s t test).

9624 • J. Neurosci., October 4, 2017 • 37(40):9617–9631 Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology

death group (Fig. 7B), strongly correlating PD-related morbidityto increased GD sphingolipid levels in brain.

These results indicate that the accumulation of GD-relatedsphingolipids in the brain may be an important factor in prompt-ing the early death observed in homozygous Gba/KOSNCATg

mice. Interestingly, we noticed that only homozygous GbaL444P/KO

SNCATg and GbaKO/KOSNCATg, and not GbaN370S/KOSNCATg,contributed to the early death group. These findings suggest thatmorbidity may be inversely correlated to Gba protein level inbrain, as homozygous GbaN370S/KOSNCATg were previouslyfound to have �50% residual protein levels (Fig. 4D). This find-ing is consistent with clinical data that the N370S mutation has alower odds ratio for PD than L444P (Gan-Or et al., 2008).

Aged GD/PD mice exhibit �-synuclein pathology in regionsof GlcCer accumulationUsing the early death homozygous Gba/KOSNCATg mice and WT,SNCATg, and Gba /WTSNCATg controls, we further investigated

relative levels of GlcCer and �-synuclein pathology in brain. Asnoted in our comparative studies of early and anticipated deathstaining, multiple brain regions showed increased GlcCer levelsin homozygous early death mice (Fig. 7C,F). Together with ourlipidomic analyses, these data support an age-dependent accu-mulation of GlcCer in the brain. Here we show representativeimages of GlcCer staining in the CA3 region in hippocampus.Quantitative immunofluorescence showed that homozygousGbaL444P/KOSNCATg and GbaKO/KOSNCATg mice have �10-foldGlcCer accumulation relative to WT levels (9.8 � 2.99 vs 1.2 �0.11; p � 0.0096).

We and others have shown that SNCATg PD mice exhibit�-synuclein pathology, which is associated with increased insol-ubility of the protein (Chandra et al., 2005; Gallardo et al., 2008).To monitor �-synuclein pathology, we coimmunostained theabove cohort of GD/PD brain sections with an antibody againstSer129 phosphorylated �-synuclein, a marker of �-synuclein pa-thology (Saito et al., 2003). As expected, SNCATg PD mice show

Figure 5. Characterization of GD/PD mice. A, Representative images of motor neurons in the ventral horn of L3 spinal cords. All PD lines showed loss of motor neurons in the lumbar spinal cord,consistent with previous literature (Chandra et al., 2005). B, Quantification of motor neuron loss in Gba WT/WT, heterozygous Gba /WT, and homozygous Gba /KO with and without SNCA Tg.Gba L444P/WT, Gba N370S/WT, and Gba KO/WT were grouped as Gba /WT, whereas Gba L444P/KO, Gba N370S/KO, and Gba KO/KO were grouped as Gba /KO. N and p values relative to WT/WT: WT/WT: N � 3;/WT: N � 2, p � 0.489; /KO: N � 5, p � 0.144; SNCA Tg: N � 2, p � 0.002; /WT SNCA Tg: N � 2, p � 0.009; /KO SNCA Tg: N � 3, p � 0.001. C, Representative images of microglial staining in T10spinal cords. All PD lines showed significant recruitment of microglia relative to WT. D, Quantification of microglia levels in Gba WT/WT, Gba /WT, Gba /KO, SNCA Tg, and Gba /KOSNCA Tg. N and p valuesrelative to WT/WT: WT/WT: N � 5; /WT: N � 2, p � 0.315; /KO: N � 1, no p value; SNCA Tg: N � 2, p � 0.005; /KO SNCA Tg: N � 3, p � 0.001. B, D, **p � 0.01, relative to Gba WT/WT (two-tailedStudent’s t test). Hanging grip test was used as an indicator of declining motor function in (E) Gba L444P, (F ) Gba N370S, and (G) Gba KO lines. All PD lines exhibit motor deficits by 10 months. Bothsexes were used; N is noted in parentheses after each genotype. H, Graph of months elapsed between onset of motor phenotype measured by the hanging grip test and death. GD/PD mice dyingearlier than 14 months (GD/PD Early Death) show accelerated decline in motor function relative to PD mice. p value relative to PD � 1.64 � 10 �4. **p � 0.001 (two-tailed Student’s t test).

Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology J. Neurosci., October 4, 2017 • 37(40):9617–9631 • 9625

Figure 6. GlcSph accumulates early in mouse brain: A, GlcCer; B, GlcSph; C, Sph; D, S1P levels in GD/PD brains. N�2– 6 per genotypes, except Gba KO/KO (N�1); age of mice�2–3 months. p value relativeto WT/WT for GlcSph levels: L444P/WT�0.234, N370S/WT�0.313, KO/WT�0.608, L444P/KO�3.350�10 �4, N370S/KO�0.002. *p�0.05. **p�0.01. ***p�0.001. E, AFM images of�-synucleinincubated with 0.1, 1, and 10�M GlcSph with PC control on day 0 and 7. Scale bars, 1�m. F, Percentage �-sheeted content of �-synuclein in the presence of 0.1, 1, and 10�M GlcSph on day 0 and day 7. N�3 for all samples. p value relative to PC: GlcSph-0.1�0.243, GlcSph-1�0.472, GlcSph-10�0.004. **p�0.01 (two-tailed Student’s t test). G, Subcellular fractionation showing lysosomes on the top fraction(F1) and mitochondria on the bottom fraction between 27% and 23% density interfaces (F2). Two smaller bands are seen between F1 and F2 (not taken). H, Western blot shows enrichment of lysosomes in F1.Cathepsin D, ATP6V1a, and LAMP1 were used as lysosomal markers; Cathepsin D and ATP6V1a can be seen in the homogenate, supernatant, and lysosomal fraction, but not in the mitochondrial fraction. LAMP1canbeseenpredominantly inthelysosomalfraction.I,Relativeproteinlevels inlysosomalfractionsweredeterminedbyBCA.GBAKOlysosomes(11.38mg/ml)werefoundtohavealmost3timesasmuchproteinas WT lysosomes (4.27 mg/ml), a likely indicator of expected lysosomal enlargement and dysfunction in the GBA KO mice. p value /KO relative to WT�0.031. *p�0.05 (two-tailed Student’s t test). J, Dot blotshowsrelativeGlcCer levelsusingaGlcCerantibody(Glycobiotech).BlottedGlcCer lipidshowsthatthedotblotmethodisrobustandquantitative,withastandardcurvewith R 2�0.99. K,GlcCer levels frombrainhomogenate, lysosomal fraction, and mitochondrial fraction were analyzed using the dot blot method in J. No difference between WT and GBA KO was found in any of the fractions, including total brainhomogenates confirming the lipidomic results in A. However, there was a clear enrichment of GlcCer in the mitochondrial fraction relative to the others.

9626 • J. Neurosci., October 4, 2017 • 37(40):9617–9631 Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology

Figure 7. GD/PD mice exhibit �-synuclein pathology and GlcCer accumulation. A, Histograms of age of death of SNCA Tg mice (N � 12), heterozygous Gba /WTSNCA Tg (N � 36), and homozygousGba /KOSNCA Tg (N � 18). Gaussian curve fitted to SNCA Tg histogram superimposed over all three histograms, showing differences in distributions; 1, 2, and 3 SDs from the mean shown through progressivelydarker shading under Gaussian curve. B, Quantification of GlcCer levels in the CA3 region of hippocampus in homozygous Gba /KOSNCA Tg brain of early death and anticipated death mice (N�3 mice per group).N and p valuesrelativetoanticipateddeath:anticipateddeath: N�3;earlydeath: N�3, p�0.013. C,QuantificationofGlcCer levels intheCA3regionofhippocampusinGD/PDmicecohorts.Valuesnormalizedto 1 for Gba WT/WT. N and p values relative to WT/WT: WT/WT: N�3; SNCA Tg: N�3, p�0.624; /WT SNCA Tg: N�4, p�0.783; /KO SNCA Tg: N�3, p�0.010. D, Relative Ser129 phosphorylated�-synucleinlevels in the CA3 region of the hippocampus in the same brains. N and p values relative to WT/WT: WT/WT: N�3; SNCA Tg: N�3, p�0.010; /WT SNCA Tg: N�4, p�0.036; /KO SNCA Tg: N�3, p�0.010.E, Correlation of GlcCer and Ser129 phosphorylation�-synuclein levels across the different genotypes. r 2 �0.827, Pearson’s product moment-correlation p�1.618�10 �5. N�3 or 4 per genotype; age ofmice � 8 –11 months. F, Representative brain sections stained with antibodies to GlcCer and Ser129 phosphorylated �-synuclein. Scale bar, 250 �m. G, Western blot of soluble fraction of mouse brainhomogenate following differential detergent extract in age-matched Gba WT/WT, SNCA Tg, and Gba /KOSNCA Tg exhibiting early death, probing for phosphorylated �-synuclein S129. H, Quantification of G,focusing on expected bands at 16 and 37 kDa. 16 kDa: N and p values versus WT/WT: SNCA Tg: N�3, p�4.120�10 �4; /KO SNCA Tg: N�3, p�0.008. 37 kDa: N and p values versus WT/WT: SNCA Tg: N�3, p�0.090; /KO SNCA Tg: N�3, p�0.002. I, Dot blot of soluble fraction of mouse brain homogenate following differential detergent extract in age-matched Gba WT/WT, SNCA Tg, and Gba /KOSNCA Tg exhibitingearly death, using anti-oligomer antibody A11. J, Quantification of ELISA assay probing for the presence of aggregated �-synuclein in total brain homogenate from age-matched Gba WT/WT, SNCA Tg, andGba /KOSNCA Tg exhibiting early death. N and p values relative to WT/WT: WT/WT: N � 3; SNCA Tg: N � 3, p � 0.016; /KO SNCA Tg: N � 3, p � 0.014; p values versus SNCA Tg: /KO SNCA Tg � 0.034. B, C,Two-tailed Student’s t test. D, H, J, One-tailed Student’s t test. *p � 0.05. **p � 0.01.

Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology J. Neurosci., October 4, 2017 • 37(40):9617–9631 • 9627

increased Ser129 phosphorylated �-synuclein levels in the brain,but homozygous GbaL444P/KOSNCATg and GbaKO/KOSNCATg

mice developing early phenotypes show even larger increases(Fig. 7 D, F ). To determine the relationship between GlcCer andSer129 phosphorylated �-synuclein levels, we measured andcompared relative intensities. As seen in Figure 7E, GlcCerand Ser129 phosphorylated �-synuclein levels are linearly corre-lated (r 2 � 0.82, Pearson’s product moment-correlation p �1.618 � 10�5). To confirm this finding, we determined the aver-age Mander’s coefficient M2 expressing overlap between the twochannels as 0.841, suggesting that GlcCer accumulation, andlikely the other GD sphingolipids, are triggers for �-synucleinSer129 phosphorylated pathology. We further confirmed thepresence �-synuclein pathology in homozygous, phenotypicGbaL444P/KOSNCATg and GbaKO/KOSNCATg mouse brain usingWestern blotting, showing the appearance of a soluble oligomeric�-synuclein species in GbaL444P/KOSNCATg and GbaKO/KO

-

SNCATg mice, which was not present in SNCATg mouse brain(Fig. 7G,H). These results were verified using dot blot with ananti-oligomer antibody and a commercial ELISA kit against oli-gomeric and aggregated �-synuclein (Fig. 7 I, J).

Finally, we examined the two key enzymes that regulateGlcSph levels: acid ceramidase and Gba2. Quantitative Western

blotting showed that neither acid ceramidase nor Gba2 levelschange with Gba genotype (Fig. 8B,D). When we examined thesetwo enzymes in aged mice, we observed that, whereas acid cera-midase levels were unaltered, both Gba2 activity and protein lev-els decreased with age (Fig. 8A,C,E). Decreasing Gba2 is likely tocontribute to the further accumulation of GlcSph in an age-dependent manner in our mouse lines and is consistent withclinical data (Ferraz et al., 2016).

DiscussionAlthough it is firmly established that GBA mutations, even in theheterozygote carrier state, are a major genetic risk factor for PD,the molecular mechanism(s) underlying the association of GBAmutations and PD are poorly understood. Hitherto, the focus inthe field has been on GD mutant GCase1 itself and its interactionswith �-synuclein, focusing mainly on gain-of-function mecha-nisms, or lysosomal dysfunction to describe the nexus betweenGBA mutations and PD. These studies are hard to reconcile withthe subcellular localization of GCase1 (lysosomal) and �-synu-clein (presynaptic), and do not explain the striking incrementalrisk of PD associated with null or severe GBA alleles (i.e., 84G insG mutation, which leads to frame shift and premature proteintruncation) compared with mild mutations (N370S) (Gan-Or et

Figure 8. GBA2 and acid ceramidase levels in GD mice. A, Gba2 activity levels relative to Gba WT/WT. Heterozygous Gba L444P/WT, Gba N370S/WT, and Gba KO/WT were grouped as Gba /WT, whereashomozygous Gba L444P/KO, Gba N370S/KO, and Gba KO/KO were grouped as Gba /KO. Activity is shown for both young (3-month) and old (12-month) mice. N and p values relative to young cohort: WT/WT:N � 8 3-month, 9 1-year mice, p � 0.507; /WT: N � 26 3-month, 9 1-year mice, p � 0.038; /KO: N � 16 3-month, 8 1-year mice, p � 0.398. *p � 0.05 (two-tailed Student’s t test). B, Gba2 proteinlevels in Gba WT/WT, Gba L444P/WT, Gba N370S/WT, Gba KO/WT, Gba L444P/KO, Gba N370S/KO, and Gba KO/KO in mouse brain. N � 2 per genotype. Age � 3-month mice. C, Gba2 protein levels of Gba WT/WT,Gba /WT, and Gba /KO. Protein levels are shown for both young (3-month) and old (12-month) mice. N � 3 per genotype. p values relative to young cohort: WT/WT � 0.193, /WT � 0.021, /KO �0.991. *p � 0.05 (two-tailed Student’s t test). D, Acid ceramidase levels normalized to actin shown for all GD genotypes, determined via Western blot. N � 2 per genotype. Age � 3-month-oldmice. E, Acid ceramidase levels of Gba WT/WT, Gba /WT, and Gba /KO. Protein levels are shown for both young (3-month) and old (12-month) mice. N � 3 per genotype.

9628 • J. Neurosci., October 4, 2017 • 37(40):9617–9631 Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology

al., 2008). Although it is possible the two proteins interact when�-synuclein is degraded at lysosomes, all present evidence sug-gests that �-synuclein forms cytosolic or synaptic aggregates, notintralysosomal aggregates (Okazaki et al., 1961). Lysosomal dys-function is likely to be an important contributor in the link be-tween GD and PD, but not the sole factor. Only GD and GBAmutants consistently increase risk of PD across the multiplicity oflysosomal diseases. A unique feature of GD, compared with otherlysosomal disorders, is the accumulation of GlcCer and its bioac-tive metabolite GlcSph generated via activation of an alternativemetabolic pathway involving acid ceramidase. Therefore, thepremise of our studies is that GlcCer and GlcSph, accumulatingdue to a loss of GCase1 function, play a key role in mutant GBA-associated PD (Fig. 9). Accordingly, we have examined these sph-ingolipids that accumulate in GD as effectors of �-synucleintoxicity. Importantly, these sphingolipids are present in the cyto-sol where �-synuclein aggregates, making them feasible media-tors of �-synuclein pathology.

We determined that all four sphingolipids (GlcCer, GlcSph,Sph, S-1-P) promote the aggregation of WT �-synuclein into�-sheeted conformations in vitro (Fig. 1). Similar results wereobtained when these sphingolipids were added to mutant�-synuclein, with the exception of GlcCer, which did not pro-mote aggregation (Fig. 1G,H). These findings suggest thatGlcCer’s metabolites, rather than GlcCer alone, may play an in-tegral role in influencing pathological �-synuclein aggregation.AFM imaging and templating assays supported this notion, re-vealing that GlcSph and Sph induced the formation of oligomeric�-synuclein species capable of templating endogenous �-synu-clein into aggregates in mammalian culture and human neurons(Fig. 3). Together, our in vitro results implicate GlcCer down-stream metabolites as potential mediators of �-synuclein toxicityin GBA-associated PD.

Molecular characterization of homozygous GD/PD mice de-veloping early phenotypes further validated our in vitro findings.Lipidomic analysis of young homozygous GD/PD mice brainsrevealed that only GlcSph accumulates initially, highlighting theimportance of the oligomeric �-synuclein species formed by thissphingolipid in mediating toxicity. Furthermore, homozygous,phenotypic GD/PD mice show a clear correlation between

GlcCer and �-synuclein pathology and the appearance of a novel,soluble aggregated �-synuclein species in GD/PD brain relativeto controls (Fig. 7). The sum of these experiments implicatesGlcSph, which was found to produce toxic oligomeric �-synu-clein species in vitro and accumulated in homozygous GD/PDmouse brain, in mediating PD risk in GD patients. This conclu-sion is supported by previous literature, in which GlcSph wassuggested to mediate brain pathology in neuropathic forms ofGD, implicating a role in neurodegeneration (Nilsson andSvennerholm, 1982; Orvisky et al., 2002; Schueler et al., 2003).Notably, we and others have shown massive accumulation ofGlcSph in the plasma of GD patients with biallelic GBA muta-tions (Dekker et al., 2011; Murugesan et al., 2016), and recentstudies have also reported the accumulation of GlcSph in thesubstantia nigra of sporadic PD patients (Rocha et al., 2015a).GlcSph has also emerged as a promising biomarker for GD, high-lighting its specificity and abundance in GD patients (Dekker etal., 2011; Mirzaian et al., 2015). These clinical data underscore therelevance of our finding that GlcSph levels mediate the risk fordeveloping PD.

The detailed characterization and phenotyping of our long-lived homozygous GD/PD mice have allowed us to investigate themechanism by which GBA mutations confer risk for PD develop-ment. Our molecular characterization of GD/PD brain and sur-vival data support a loss-of-function mechanism in Gba-linkedPD. We showed that GlcCer accumulation and �-synuclein ag-gregation are correlated in brains of both GbaL444P/KOSNCATg

and GbaKO/KOSNCATg lines (Fig. 7), suggesting that GBA L444Pmutations result in a loss of function of GCase1. This isconsistent with the finding that GbaL444P/KO brains lack GCase1expression and enzymatic activity similar to GbaKO/KO (Fig.4D,E). In contrast, the GbaN370S/KOSNCATg did not phenocopyGbaKO/KOSNCATg and did not contribute to the mice in the ho-mozygous GD/PD early death group. This difference in survival islikely attributed to the N370S mutation being a trafficking mu-tant with 50% residual protein expression (Fig. 4D). This seemslikely, as in clinical studies of PD stratified by GBA mutation,N370S had the lowest odds ratio for risk (2.2) compared withL444P (odds ratio 5.3) and other severe mutations (odds ratio7.9) (Gan-Or et al., 2008). Some heterozygous GD/PD mice

Figure 9. Model of how GD-related sphingolipids impact �-synuclein pathology. Deletion or GD mutations in GBA leads to accumulation of GlcSph in the cytosol of neurons. GlcSph directly interacts with�-synuclein to promote its aggregation into distinct pathogenic oligomeric species. These pathogenic species further template intracellular �-synuclein aggregation and may have the capacity to spread toneighboring neurons. With age, GlcCer also accumulates; and there is a decrement of Gba2 and lysosomal enzymes, exacerbating �-synuclein pathology and proteostasis, leading to death of neurons.

Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology J. Neurosci., October 4, 2017 • 37(40):9617–9631 • 9629

(GbaL444P/WTSNCATg and GbaKO/WTSNCATg) also died early withmotor phenotypes, mirroring risk in patients. Previous literaturehas cited the intermediate risk of PD development in heterozy-gous GD patients as support for a gain-of-function mechanism.However, in brain homogenates of heterozygous GD mice, we seea clear age-dependent decrease in Gba enzyme activity (Fig. 4F),suggesting that this leads to haploinsufficiency in the brain withage. Our conclusions have been validated by recent mouse andclinical data. Chronic systemic use of GCase1 inhibitors wasshown to replicate PD phenotypes in mice, including develop-ment of �-synuclein pathology (Rocha et al., 2015b). Impor-tantly, heterozygote carriers of GBA mutations were shown tohave age-related decline in lysosomal GCase1 activity (Alcalay etal., 2014). Surprisingly, even in non–GBA-associated PD, re-duced GCase1 activity has been described in the substantia nigraof autopsy brains of PD patients (Gegg et al., 2012). Furthermore,GCase1 activity decreases with age in normal individuals (Rochaet al., 2015a).

Here, we propose a model where GlcSph accumulates beforeGlcCer in GBA-linked PD brains, and GlcSph accelerates theaggregation of �-synuclein into pathological species (Fig. 9).We show that these aggregated �-synuclein species are then ca-pable of self-templating into Lewy body-like pathology. This iscompounded by a decrease in lysosomal protein degradation ca-pacity with age (Bae et al., 2015) or by a decrease in lysosomalcatabolic activity, which in turn leads to increased �-synucleinlevels. These two contributions exacerbate aggregation of �-synuclein, leading to the eventual demise of the neuron (Fig. 9).

Our cumulative data point to ASAH1 (acid ceramidase) andGBA2 (glucocerebrosidase 2) as new therapeutic targets for thepreventative and acute treatment of mutant GBA-associatedPD. These novel targets have emerged as alternatives to CNS-penetrant recombinant GCase1 enzyme replacement therapy andinhibition of GlcCer synthase (substrate reduction therapy), bothof which potently reduce GlcCer and its metabolites and are cur-rently under investigation.

ReferencesAlcalay RN, Dinur T, Quinn T, Sakanaka K, Levy O, Waters C, Fahn S,

Dorovski T, Chung WK, Pauciulo M, Nichols W, Rana HQ, Balwani M,Bier L, Elstein D, Zimran A (2014) Comparison of Parkinson risk inAshkenazi Jewish patients with Gaucher disease and GBA heterozygotes.JAMA Neurol 71:752–757. CrossRef Medline

Babajani G, Tropak MB, Mahuran DJ, Kermode AR (2012) Pharmacologi-cal chaperones facilitate the post-ER transport of recombinant N370Smutant �-glucocerebrosidase in plant cells: evidence that N370S is a fold-ing mutant. Mol Genet Metab 106:323–329. CrossRef Medline

Bae EJ, Yang NY, Lee C, Lee HJ, Kim S, Sardi SP, Lee SJ (2015) Loss ofglucocerebrosidase 1 activity causes lysosomal dysfunction and �-syn-uclein aggregation. Exp Mol Med 47:e153. CrossRef Medline

Bultron G, Kacena K, Pearson D, Boxer M, Yang R, Sathe S, Pastores G, MistryPK (2010) The risk of Parkinson’s disease in type 1 Gaucher disease.J Inherit Metab Dis 33:167–173. CrossRef Medline

Chandra S, Chen X, Rizo J, Jahn R, Sudhof TC (2003) A broken �-helix infolded �-synuclein. J Biol Chem 278:15313–15318. CrossRef Medline

Chandra S, Gallardo G, Fernandez-Chacon R, Schluter OM, Sudhof TC(2005) �-Synuclein cooperates with CSP� in preventing neurodegenera-tion. Cell 123:383–396. CrossRef Medline

Charrow J, Andersson HC, Kaplan P, Kolodny EH, Mistry P, Pastores G,Rosenbloom BE, Scott CR, Wappner RS, Weinreb NJ, Zimran A (2000)The Gaucher registry: demographics and disease characteristics of 1698patients with Gaucher disease. Arch Intern Med 160:2835–2843. CrossRefMedline

Chartier-Harlin MC, Kachergus J, Roumier C, Mouroux V, Douay X, LincolnS, Levecque C, Larvor L, Andrieux J, Hulihan M, Waucquier N, DefebvreL, Amouyel P, Farrer M, Destee A (2004) �-Synuclein locus duplication

as a cause of familial Parkinson’s disease. Lancet 364:1167–1169. CrossRefMedline

Dai M, Liou B, Swope B, Wang X, Zhang W, Inskeep V, Grabowski GA, SunY, Pan D (2016) Progression of behavioral and CNS deficits in a viablemurine model of chronic neuronopathic Gaucher disease. PLoS One 11:e0162367. CrossRef Medline

D’Angelo G, Polishchuk E, Di Tullio G, Santoro M, Di Campli A, Godi A,West G, Bielawski J, Chuang CC, van der Spoel AC, Platt FM, Hannun YA,Polishchuk R, Mattjus P, De Matteis MA (2007) Glycosphingolipid syn-thesis requires FAPP2 transfer of glucosylceramide. Nature 449:62– 67.CrossRef Medline

Dekker N, van Dussen L, Hollak CE, Overkleeft H, Scheij S, Ghauharali K, vanBreemen MJ, Ferraz MJ, Groener JE, Maas M, Wijburg FA, Speijer D,Tylki-Szymanska A, Mistry PK, Boot RG, Aerts JM (2011) Elevatedplasma glucosylsphingosine in Gaucher disease: relation to phenotype,storage cell markers, and therapeutic response. Blood 118:e118 – e127.CrossRef Medline

Doering T, Brade H, Sandhoff K (2002) Sphingolipid metabolism duringepidermal barrier development in mice. J Lipid Res 43:1727–1733.CrossRef Medline

Elleder M (2006) Glucosylceramide transfer from lysosomes—the missinglink in molecular pathology of glucosylceramidase deficiency: a hypoth-esis based on existing data. J Inherit Metab Dis 29:707–715. CrossRefMedline

Enquist IB, Lo Bianco C, Ooka A, Nilsson E, Månsson JE, Ehinger M, RichterJ, Brady RO, Kirik D, Karlsson S (2007) Murine models of acute neu-ronopathic Gaucher disease. Proc Natl Acad Sci U S A 104:17483–17488.CrossRef Medline

Ferraz MJ, Marques AR, Appelman MD, Verhoek M, Strijland A, Mirzaian M,Scheij S, Ouairy CM, Lahav D, Wisse P, Overkleeft HS, Boot RG, Aerts JM(2016) Lysosomal glycosphingolipid catabolism by acid ceramidase: for-mation of glycosphingoid bases during deficiency of glycosidases. FEBSLett 590:716 –725. CrossRef Medline

Gallardo G, Schluter OM, Sudhof TC (2008) A molecular pathway of neu-rodegeneration linking [alpha]-synuclein to ApoE and A[beta] peptides.Nat Neurosci 11:301–308. CrossRef Medline

Gan-Or Z, Giladi N, Rozovski U, Shifrin C, Rosner S, Gurevich T, Bar-ShiraA, Orr-Urtreger A (2008) Genotype-phenotype correlations betweenGBA mutations and Parkinson disease risk and onset. Neurology 70:2277–2283. CrossRef Medline

Gegg ME, Burke D, Heales SJ, Cooper JM, Hardy J, Wood NW, Schapira AH(2012) Glucocerebrosidase deficiency in substantia nigra of Parkinsondisease brains. Ann Neurol 72:455– 463. CrossRef Medline

Grabowski GA, Petsko GA, Kolodny EH (2014) Gaucher disease. In: Theonline metabolic and molecular bases of inherited disease (Beaudet AL,Vogelstein B, Kinzler KW, Antonarakis SE, Ballabio A, Gibson KM,Mitchell G, eds). New York: McGraw-Hill.

Hein LK, Meikle PJ, Hopwood JJ, Fuller M (2007) Secondary sphingolipidaccumulation in a macrophage model of Gaucher disease. Mol GenetMetab 92:336 –345. CrossRef Medline

Kruger R, Kuhn W, Muller T, Woitalla D, Graeber M, Kosel S, Przuntek H,Epplen JT, Schols L, Riess O (1998) Ala30Pro mutation in the gene en-coding �-synuclein in Parkinson’s disease. Nat Genet 18:106 –108.CrossRef Medline

Lesage S, Anheim M, Letournel F, Bousset L, Honore A, Rozas N, Pieri L,Madiona K, Durr A, Melki R, Verny C, Brice A (2013) G51D �-synucleinmutation causes a novel Parkinsonian-pyramidal syndrome. Ann Neurol73:459 – 471. CrossRef Medline

Lobley A, Whitmore L, Wallace BA (2002) DICHROWEB: an interactivewebsite for the analysis of protein secondary structure from circular di-chroism spectra. Bioinformatics 18:211–212. CrossRef Medline

Luk KC, Song C, O’Brien P, Stieber A, Branch JR, Brunden KR, TrojanowskiJQ, Lee VM (2009) Exogenous �-synuclein fibrils seed the formation ofLewy body-like intracellular inclusions in cultured cells. Proc Natl AcadSci U S A 106:20051–20056. CrossRef Medline

Martinez Z, Zhu M, Han S, Fink AL (2007) GM1 specifically interacts withalpha-synuclein and inhibits fibrillation. Biochemistry 46:1868 –1877.CrossRef Medline

Mazzulli JR, Xu YH, Sun Y, Knight AL, McLean PJ, Caldwell GA, Sidransky E,Grabowski GA, Krainc D (2011) Gaucher disease glucocerebrosidaseand �-synuclein form a bidirectional pathogenic loop in synucleinopa-thies. Cell 146:37–52. CrossRef Medline

9630 • J. Neurosci., October 4, 2017 • 37(40):9617–9631 Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology

Mirzaian M, Wisse P, Ferraz MJ, Gold H, Donker-Koopman WE, Verhoek M,Overkleeft HS, Boot RG, Kramer G, Dekker N, Aerts JM (2015) Massspectrometric quantification of glucosylsphingosine in plasma and urineof type 1 Gaucher patients using an isotope standard. Blood Cells Mol Dis54:307–314. CrossRef Medline

Mistry PK, Liu J, Yang M, Nottoli T, McGrath J, Jain D, Zhang K, Keutzer J,Chuang WL, Chuang WL, Mehal WZ, Zhao H, Lin A, Mane S, Liu X, PengYZ, Li JH, Agrawal M, Zhu LL, Blair HC, et al. (2010) Glucocerebrosi-dase gene-deficient mouse recapitulates Gaucher disease displaying cellu-lar and molecular dysregulation beyond the macrophage. Proc Natl AcadSci U S A 107:19473–19478. CrossRef Medline

Mistry PK, Liu J, Sun L, Chuang WL, Yuen T, Yang R, Lu P, Zhang K, Li J,Keutzer J, Stachnik A, Mennone A, Boyer JL, Jain D, Brady RO, New MI,Zaidi M (2014) Glucocerebrosidase 2 gene deletion rescues type 1 Gau-cher disease. Proc Natl Acad Sci U S A 111:4934 – 4939. CrossRef Medline

Mizukami H, Mi Y, Wada R, Kono M, Yamashita T, Liu Y, Werth N, SandhoffR, Sandhoff K, Proia RL (2002) Systemic inflammation in gluco-cerebrosidase-deficient mice with minimal glucosylceramide storage.J Clin Invest 109:1215–1221. CrossRef Medline

Murugesan V, Chuang WL, Liu J, Lischuk A, Kacena K, Lin H, Pastores GM,Yang R, Keutzer J, Zhang K, Mistry PK (2016) Glucosylsphingosine is akey biomarker of Gaucher disease. Am J Hematol 91:1082–1089. CrossRefMedline

Nilsson O, Svennerholm L (1982) Accumulation of glucosylceramide andglucosylsphingosine (psychosine) in cerebrum and cerebellum in infan-tile and juvenile Gaucher disease. J Neurochem 39:709 –718. CrossRefMedline

Nussbaum RL, Ellis CE (2003) Alzheimer’s disease and Parkinson’s disease.N Engl J Med 348:1356 –1364. CrossRef Medline

Okazaki H, Lipkin LE, Aronson SM (1961) Diffuse intracytoplasmic gangli-onic inclusions (Lewy type) associated with progressive dementia andquadriparesis in flexion. J Neuropathol Exp Neurol 20:237–244. CrossRefMedline

Orvisky E, Park JK, LaMarca ME, Ginns EI, Martin BM, Tayebi N, SidranskyE (2002) Glucosylsphingosine accumulation in tissues from patientswith Gaucher disease: correlation with phenotype and genotype. MolGenet Metab 76:262–270. CrossRef Medline

Peelaerts W, Bousset L, Van der Perren A, Moskalyuk A, Pulizzi R, GiuglianoM, Van den Haute C, Melki R, Baekelandt V (2015) alpha-Synucleinstrains cause distinct synucleinopathies after local and systemic adminis-tration. Nature 522:340 –344. CrossRef Medline

Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B,Root H, Rubenstein J, Boyer R, Stenroos ES, Chandrasekharappa S, Atha-nassiadou A, Papapetropoulos T, Johnson WG, Lazzarini AM, DuvoisinRC, Di Iorio G, Golbe LI, Nussbaum RL (1997) Mutation in the�-synuclein gene identified in families with Parkinson’s disease. Science276:2045–2047. CrossRef Medline

Proukakis C, Dudzik CG, Brier T, MacKay DS, Cooper JM, Millhauser GL,Houlden H, Schapira AH (2013) A novel alpha-synuclein missense mu-tation in Parkinson disease. Neurology 80:1062–1064. CrossRef Medline

Provencher SW, Glockner J (1981) Estimation of globular protein second-ary structure from circular dichroism. Biochemistry 20:33–37. CrossRefMedline

Recasens A, Dehay B, Bove J, Carballo-Carbajal I, Dovero S, Perez-Villalba A,Fernagut PO, Blesa J, Parent A, Perier C, Farinas I, Obeso JA, Bezard E,Vila M (2014) Lewy body extracts from Parkinson disease brains triggeralpha-synuclein pathology and neurodegeneration in mice and monkeys.Ann Neurol 75:351–362. CrossRef Medline

Rocha EM, Smith GA, Park E, Cao H, Brown E, Hallett P, Isacson O (2015a)Progressive decline of glucocerebrosidase in aging and Parkinson’s dis-ease. Ann Clin Transl Neurol 2:433– 438. CrossRef Medline

Rocha EM, Smith GA, Park E, Cao H, Graham AR, Brown E, McLean JR,Hayes MA, Beagan J, Izen SC, Perez-Torres E, Hallett PJ, Isacson O(2015b) Sustained systemic glucocerebrosidase inhibition induces brainalpha-synuclein aggregation, microglia and complement C1q activationin mice. Antioxid Redox Signal 23:550 –564. CrossRef Medline

Saito Y, Kawashima A, Ruberu NN, Fujiwara H, Koyama S, Sawabe M, Arai T,Nagura H, Yamanouchi H, Hasegawa M, Iwatsubo T, Murayama S(2003) Accumulation of phosphorylated alpha-synuclein in aging hu-man brain. J Neuropathol Exp Neurol 62:644 – 654. CrossRef Medline

Schueler UH, Kolter T, Kaneski CR, Blusztajn JK, Herkenham M, Sandhoff K,

Brady RO (2003) Toxicity of glucosylsphingosine (glucopsychosine) tocultured neuronal cells: a model system for assessing neuronal damage inGaucher disease type 2 and 3. Neurobiol Dis 14:595– 601. CrossRefMedline

Sidransky E, Nalls MA, Aasly JO, Aharon-Peretz J, Annesi G, Barbosa ER,Bar-Shira A, Berg D, Bras J, Brice A, Chen CM, Clark LN, Condroyer C,De Marco EV, Durr A, Eblan MJ, Fahn S, Farrer MJ, Fung HC, Gan-Or Z,et al. (2009) Multicenter analysis of glucocerebrosidase mutations inParkinson’s disease. N Engl J Med 361:1651–1661. CrossRef Medline

Singleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J, Huli-han M, Peuralinna T, Dutra A, Nussbaum R, Lincoln S, Crawley A, Han-son M, Maraganore D, Adler C, Cookson MR, Muenter M, Baptista M,Miller D, Blancato J, et al. (2003) �-Synuclein locus triplication causesParkinson’s disease. Science 302:841. CrossRef Medline

Spillantini MG, Schmidt ML, Lee VM, Trojanowski JQ, Jakes R, Goedert M(1997) �-Synuclein in Lewy bodies. Nature 388:839 – 840. CrossRefMedline

Tsuji S, Choudary PV, Martin BM, Stubblefield BK, Mayor JA, Barranger JA,Ginns EI (1987) A mutation in the human glucocerebrosidase gene inneuronopathic Gaucher’s disease. N Engl J Med 316:570 –575. CrossRefMedline

Tsuji S, Martin BM, Barranger JA, Stubblefield BK, LaMarca ME, Ginns EI(1988) Genetic heterogeneity in type 1 Gaucher disease: multiple geno-types in Ashkenazic and non-Ashkenazic individuals. Proc Natl Acad SciU S A 85:2349 –2352. CrossRef Medline

van Stokkum IH, Spoelder HJ, Bloemendal M, van Grondelle R, Groen FC(1990) Estimation of protein secondary structure and error analysisfrom circular dichroism spectra. Anal Biochem 191:110 –118. CrossRefMedline

Vargas KJ, Makani S, Davis T, Westphal CH, Castillo PE, Chandra SS (2014)Synucleins regulate the kinetics of synaptic vesicle endocytosis. J Neurosci34:9364 –9376. CrossRef Medline

Whitmore L, Wallace BA (2004) DICHROWEB, an online server for pro-tein secondary structure analyses from circular dichroism spectroscopicdata. Nucleic Acids Res 32:W668 –W673. CrossRef Medline

Whitmore L, Wallace BA (2008) Protein secondary structure analyses fromcircular dichroism spectroscopy: methods and reference databases.Biopolymers 89:392– 400. CrossRef Medline

Winner B, Jappelli R, Maji SK, Desplats PA, Boyer L, Aigner S, Hetzer C,Loher T, Vilar M, Campioni S, Tzitzilonis C, Soragni A, Jessberger S, MiraH, Consiglio A, Pham E, Masliah E, Gage FH, Riek R (2011) In vivodemonstration that �-synuclein oligomers are toxic. Proc Natl Acad SciU S A 108:4194 – 4199. CrossRef Medline

Wong K, Sidransky E, Verma A, Mixon T, Sandberg GD, Wakefield LK,Morrison A, Lwin A, Colegial C, Allman JM, Schiffmann R (2004) Neu-ropathology provides clues to the pathophysiology of Gaucher disease.Mol Genet Metab 82:192–207. CrossRef Medline

Xu YH, Quinn B, Witte D, Grabowski GA (2003) Viable mouse models ofacid beta-glucosidase deficiency. Am J Pathol 163:2093–2101. CrossRefMedline

Yap TL, Gruschus JM, Velayati A, Westbroek W, Goldin E, Moaven N, Sid-ransky E, Lee JC (2011) �-Synuclein interacts with glucocerebrosidaseproviding a molecular link between Parkinson and Gaucher diseases.J Biol Chem 286:28080 –28088. CrossRef Medline

Yildiz Y, Matern H, Thompson B, Allegood JC, Warren RL, Ramirez DM,Hammer RE, Hamra FK, Matern S, Russell DW (2006) Mutation of�-glucosidase 2 causes glycolipid storage disease and impaired male fer-tility. J Clin Invest 116:2985–2994. CrossRef Medline

Zarranz JJ, Alegre J, Gomez-Esteban JC, Lezcano E, Ros R, Ampuero I, VidalL, Hoenicka J, Rodriguez O, Atares B, Llorens V, Gomez Tortosa EG, delSer T, Munoz DG, de Yebenes JG (2004) The new mutation, E46K, of�-synuclein causes parkinson and Lewy body dementia. Ann Neurol 55:164 –173. CrossRef Medline

Zhang YQ, Henderson MX, Colangelo CM, Ginsberg SD, Bruce C, Wu T,Chandra SS (2012) Identification of CSPalpha clients reveals a role indynamin 1 regulation. Neuron 74:136 –150. CrossRef Medline

Zhang Y, Pak C, Han Y, Ahlenius H, Zhang Z, Chanda S, Marro S, Patzke C,Acuna C, Covy J, Xu W, Yang N, Danko T, Chen L, Wernig M, Sudhof TC(2013) Rapid single-step induction of functional neurons from humanpluripotent stem cells. Neuron 78:785–798. CrossRef Medline

Taguchi et al. • Glucosylsphingosine Promotes �-Synuclein Pathology J. Neurosci., October 4, 2017 • 37(40):9617–9631 • 9631